Association between expression of nuclear receptor co‑activator 5 protein and prognosis in postoperative patients with osteosarcoma

  • Authors:
    • Ya Wu
    • Jian Wu
    • Qi‑Rong Dong
    • Nai‑Zhou Guo
  • View Affiliations

  • Published online on: December 5, 2017     https://doi.org/10.3892/ol.2017.7513
  • Pages:1888-1892
Metrics: HTML 0 views | PDF 0 views     Cited By (CrossRef): 0 citations

Abstract

The aim of the present study was to investigate the association between the expression of nuclear receptor co‑activator 5 protein (NCOA5) and the prognosis of postoperative patients with osteosarcoma. Human osteosarcoma samples were collected from 145 patients and normal bone tissues were collected from 100 individuals as controls. Immunohistochemistry (IHC) and reverse transcription‑polymerase chain reaction (RT‑PCR) were employed to measure the levels of NCOA5 protein in cases of human osteosarcoma. The results from the RT‑PCR analysis demonstrated that the positive rate of NCOA5 mRNA expression in human osteosarcoma was 17.24% (25/145). The positive rate in normal bone tissues was 84.00% (84/100), which was significantly higher compared with that of human osteosarcoma tissues (χ2=33.166; P<0.001). IHC staining indicated that the positive rate of NCOA5 protein in the osteosarcoma samples was 26.21% (38/145). The positive rate in normal bone tissues was 82.00% (82/100), which was significantly increased compared with that of human osteosarcoma tissues (χ2=28.166; P<0.001). NCOA5 mRNA and protein expression levels were consistent in human osteosarcoma tissues, and were lower than in control tissues. The expression of NCOA5 was low in human osteosarcoma tissues, while it was high in normal bone tissues. These low NCOA5 expression levels were associated with postoperative survival of human osteosarcoma.

Introduction

Osteosarcoma is the most common primary tumor of bone tissue; it is most common in young people and exhibits a high degree of malignancy (1,2). The treatment of osteosarcoma is neoadjuvant chemotherapy and surgery (3). The five-year survival rate remains at 60–70%, and there has been no significant increase during the past 10 years (4). The primary reason for this is that the mechanism of pathogenesis is not clear. The formation and development of the tumor is a multifactorial, multi-stage and a gradual process; early diagnosis and timely intervention are essential for the prognosis of patients (5). In previous years, the associations between cell proliferation and cell signaling have become an area of interest (6,7).

Previous studies have identified that nuclear receptor co-activator 5 (NCOA5) is a nuclear receptor co-regulator that is widely expressed (8,9). NCOA5 is also a co-regulator for the estrogen receptor and orphan nuclear hormone receptor co-activator BD73 (10). The transcription of NCOA5 is mediated by estrogen receptors to achieve homeostatic regulation of human B cells. NCOA5 gene defects may lead to cancer and diabetes (11,12).

To investigate the association between the expression of NCOA5 and the prognosis of postoperative patients with osteosarcoma, immunohistochemistry (IHC) and reverse transcription-polymerase chain reaction (RT-PCR) were employed in the present studyt to measure the levels of NCOA5 protein in patients with human osteosarcoma, using normal bone tissues as the controls. The association between these groups and the mechanism of the formation of osteosarcoma were explored to create novel targets for early diagnosis of this disease.

Patients and methods

Patient samples

Samples of human osteosarcoma were collected between February 2012 and June 2017 from 145 patients who received surgical resection at The First People's Hospital of Yancheng City (Yancheng, China), and had been diagnosed by pathological confirmation. Detailed clinical data were available for all the patients, including sex, age, differentiation, invasion depth, lymph node metastasis and Union for International Cancer Control stage tumor node metastasis (TNM) stage (13), and none had received preoperative chemotherapy or radiotherapy. Human osteosarcoma patients included 75 males and 70 females, (age range between 15–63 years; average age, 40.9±11.6 years). Normal bone tissue specimens were collected by surgical resection from 100 individuals to serve as a control group. These included 55 males and 45 females, (age range 16–68 years; average age, 34.4±10.3 years). No statistically significant differences were detected in age or sex between the two groups. The protocol used in the present study was in accordance with the Medical Ethics and Human Clinical Trial Committee of The First People's Hospital of Yancheng City, (Identification No. HMU Ethics 20120003). Written informed consent was obtained by all participants in the present study.

Immunohistochemical staining

The EnVision and DAB chromogenic reagent kit (Agilent Technologies, Inc., Santa Clara, CA, USA) was used for immunostaining to detect the distribution of NCOA5 (Antibody Diagnostic; Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA). Immunohistochemical procedures were performed in strict accordance with the manufacturer's protocol (Applied Biosystems; Thermo Fisher Scientific, Inc.). The EnVision and 3,3′-diaminobenzidine chromogenic reagent kits (Antibody Diagnostic; Applied Biosystems) were used for immunohistochemical staining. All slide staining was performed under the same conditions: The tissue was sliced to 4-µm thickness, dehydrated with 21% sucrose, de-waxed and subjected to antigen retrieval in 0.01 mol/l citric acid pH 6.0 at 95°C for 10 min. Normal goat serum (10%; Toyobo Life Science, Osaka, Japan) was placed on the slide and incubated for 10 min at room temperature. Slides were then incubated with the corresponding specific primary antibodies (mouse anti-osteonection/NCOA5; cat. no. ab70831; Abcam, Cambridge, UK; 1:1,000) for 1.5 h at room temperature. Tissue sections were then washed with PBS 3 times for 3 min. Subsequently, tissue sections were incubated with secondary antibody horseradish peroxidase-conjugated mouse anti-osteonection/NCOA5 IgG (1:1,000; cat. no. ab125508; Abcam) for 30 min at room temperature. Proteins were detected using 3,3′-Diaminobenzidine (5 min at room temperature), while the nucleus was stained with 10% hematoxylin at 37°C for 7 min. Tissue samples were then dehydrated in 75, 85, 95 and 100% gradient ethanol series, cleared by 1% xylene and sealed with rubber cement. Each batch of staining contained a positive control sourced from patients with confirmed osteosarcoma [with the known positive section reagent (cat. no. ab92431; Abcam; 1:1,000)] and a negative control, in which the corresponding specific antibody was replaced by PBS.

Samples with nuclei with yellow or tan reactant particles were considered positive. A total of four independent experiments were conducted, and four fields of view were assessed by optical microscopy at ×200 magnification. Analysis of the staining scores was semi-quantitative: Final staining scores were calculated by multiplying the positive cell percentage score and the staining intensity score. The positive cell staining percentage score criteria were as follows: 0–15%, 0; >15–30%, 1; >30–45%, 2; and >45%, 3. These staining scores were then classified as follows: >2, negative (−); 2–4, weakly positive (+); 4–6, positive (++); and ≥6, strongly positive (+++). For the convenience of statistical analysis, samples within the (−) group were defined as the negative expression group (−), and samples within the (+), (++) and (+++) groups were defined as the positive expression group (+).

Detection of NCOA5 mRNA expression by RT-PCR

Total RNA was isolated from tissues using TRIzol® reagent (NanoDrop Technologies; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol and was quantified using a NanoDrop spectrophotometer (NanoDrop Technologies; Thermo Fisher Scientific, Inc.). A total of 2 µg RNA was reverse transcribed to complementary DNA using the QuantiNova Reverse Transcription kit (50) according to the manufacturer's protocol (cat. no. 205411; Qiagen GmbH, Hilden, Germany). Samples were then amplified by semi-quantitative PCR with β-actin as a reference. The sequences of the primers (Sangon Biotech., Co., Ltd., Shanghai, China) are listed in Table I. Thermocycler conditions were as follows: Pre-denaturation at 94°C for 4 min, followed by 30 cycles of 94°C for 10 sec, 55°C for 30 sec and 72°C for 60 sec.

Table I.

Primer sequences for reverse transcription-polymerase chain reaction analysis.

Table I.

Primer sequences for reverse transcription-polymerase chain reaction analysis.

PrimersPrimer sequences (5′-3′)Product size (bp)
NCOA5
  Forward CTGCTGGCAGACAACAGGTA344
  Reverse CTGTTTGCTGCTGTGGAAAA344
B-actin
  Forward TGACGTGGACATCCGCAAAG231
  Reverse CTGGAAGGTGGACAGCGAGG231

[i] NCOA5, nuclear receptorco-activator 5.

Amplification of NCOA5 by PCR was examined using 1% agarose gel electrophoresis. The absorbance value of the sample gene and the reference (β-actin) were read, and the results were expressed as the ratio (sample value/reference value). If the ratio of osteosarcoma to reference absorbance values was positive, NCOA5 mRNA expression was considered to be positive; if it was negative, NCOA5 mRNA expression of the sample was categorized as negative.

Statistical methods

SPSS 13.0 statistical software (SPSS, Inc., Chicago, IL, USA) was used for statistical analysis. The χ2 test was used to compare the distribution of NCOA5 between osteosarcoma and normal bone tissues. The Kaplan-Meier survival analysis with log-rank test was performed to analyze the association between the expression levels of the proteins in cancer tissue or other clinicopathological characteristics and the survival rate of patients. Associations between the expression of NCOA5 and overall survival of postoperative patients with osteosarcoma were assessed using Cox regression analysis. P<0.05 was considered to indicate a statistically significantly difference.

Results

Cell nucleus staining distribution of NCOA5 in human osteosarcoma and normal bone tissues

The positive rate of NCOA5 staining in human osteosarcoma tissues was 26.21% (38/145), which was significantly lower compared with the positive rate of NCOA5 in normal bone tissues, which was 82.00% (82/100; P<0.05; Fig. 1).

NCOA5 mRNA expression in human osteosarcoma and normal bone tissues

The results from RT-PCR indicate that mRNA NCOA5 was expressed in osteosarcoma and normal bone tissues (P<0.05; Table I). The positive rate of NCOA5 mRNA expression in osteosarcoma was 17.24% (25/145), which was significantly lower compared with that in normal bone tissue (84.00%, 84/100; χ2=33.166; P<0.001; Fig. 2). Compared with the normal bone tissue, the rate of NCOA5 expression was significantly lower in pulmonary metastatic osteosarcoma tissues.

Association between the expression of NCOA5 mRNA and the clinicopathological characteristics of osteosarcoma

The expression levels of NCOA5 mRNA and protein in osteosarcoma were consistent and were lower than those in the normal controls. NCOA5 exhibited a low level of expression in osteosarcoma, and was not associated with sex, age or tumor size. However, it was associated with recurrence and metastasis (P<0.01; Table II).

Table II.

Association between NCOA5 mRNA and protein expression with clinicopathological features in osteosarcoma.

Table II.

Association between NCOA5 mRNA and protein expression with clinicopathological features in osteosarcoma.

CharacteristicsnNCOA5 mRNA positive rate, n (%)χ2P-valueNCOA5 protein positive rate, n (%)χ2P-value
Sex 0.1900.663 0.0080.927
  Male7515 (20.0) 12 (16.0)
  Female7011 (15.7) 11 (15.7)
Age (years) 0.1210.728 0.0050.945
  <407313 (17.8) 12 (16.4)
  ≥407210 (13.9) 13 (18.1)
Tumor diameter (cm) 0.3510.553 0.0720.789
  ≥106311 (17.5) 10 (15.9)
  <108213 (15.9) 15 (18.3)
Pulmonary metastasis 7.6010.006 7.6010.006
  Yes6526 (40.0) 26 (40.0)
  No805 (6.3) 5 (6.3)

[i] The χ2 test was used to compare the distribution of NCOA5 with clinicopathological features in osteosarcoma. P<0.05 was considered to indicate a statistically significant difference. NCOA5, nuclear receptor co-activator 5.

Association between the expression of NCOA5 and overall survival of postoperative patients with osteosarcoma

The overall survival time of NCOA5-positive patients was (60.92±3.45) months after a median follow-up of 61.5 months (61.5±77.3 months). The overall survival of NCOA5-negative patients was (25.68±5.65) months. Kaplan-Meier survival analysis demonstrated that there was a significant difference between these data (χ2=0.990; P=0.031; Fig. 3).

In addition, adjuvant therapy, sex, age, gross morphology, tumor invasion depth and lymph node metastasis were not identified as independent factors affecting the overall survival of postoperative patients (Table III).

Table III.

Analysis of survival factors in patients with osteosarcoma.

Table III.

Analysis of survival factors in patients with osteosarcoma.

Univariate analysisMultivariate analysis


Clinicopathological featuresBSEP-value95%CIBSEP-value95%CI
Age0.6580.6040.269 0.6120.5980.325
Sex0.0600.6020.940 0.0680.6150.915
Tumor size1.7560.7650.0421.02–3.081.2110.5440.0311.06–3.13
Tumor location0.0520.5120.819 0.0630.6100.875
Pathological type0.5980.5120.294 0.6260.6510.312
Lymph node metastasis1.7960.621<0.0011.42–4.261.8260.631<0.0011.55–4.52
Low NCOA5 expression3.0031.0710.0031.41–6.083.0121.0760.0031.48–6.23

[i] The Kaplan-Meier survival analysis with log-rank test was used to perform univariate analysis examining the association between the expression levels of the proteins in cancer tissue or other clinicopathological characteristics and the survival rate of patients. P<0.05 was considered to indicate a statistically significant difference. CI, confidence interval; NCOA5, nuclear receptor co-activator 5; SE, standard error; B, regression coefficient.

Discussion

Previous studies have indicated that the occurrence and development of tumors is a complicated process (14); disorders in the regulation of cell growth and proliferation may affect the occurrence and development of tumors (15). Concurrently, the abnormal expression of tumor-associated genes, and the abnormal activation of cell signal transduction and cell proliferation cycle are also involved in numerous aspects of tumor development (16,17). Cell growth and proliferation in the human body are affected and controlled by a number of factors (18,19). In particular, cell signaling proteins, growth factors and their receptors, apoptotic proteins and transcription factors, and the changes to these factors are closely associated with the occurrence and development of tumors (20,21).

Previous studies have also revealed that the NCOA5 protein may be associated with interleukin (IL)-6, tumor necrosis factor (TNF)-α and nuclear factor (NF)-κB (2224). Prevention of the overexpression of IL-6 may limit the occurrence and development of certain types of cancer. TNF-α was significantly increased in NCOA5 gene-deficient animal tumors. However, this gene defect is not reversible in vivo, and the specific mechanism requires additional study (25).

Previous studies have also identified that the decrease in NCOA5 expression in esophageal squamous cell carcinoma (ESCC) tissue is associated with the differentiation status of the tumor and the TNM stage, while is not associated with age, sex, weight loss, tumor location or lymph node metastasis (26,27). In addition, the expression of NCOA5 in normal tissues was higher compared with that in tumor tissues. As the level of tumor differentiation and TNM stage are important indicators of the malignant degree of tumors, the results of the present study suggest that the decreased expression of NCOA5 may be involved in the promotion of tumor progression (2830).

One limitation of the current study is the relatively small sample size. Nevertheless, to the best of our knowledge, the present study is among the largest studies addressing NCOA5 protein expression in osteosarcoma. The results of the present study indicated that the expression of NCOA5 in osteosarcoma was significantly lower compared with that in normal bone tissue. In addition, the expression levels of NCOA5 protein in benign bone tumor tissues were significantly higher than in osteosarcoma tissues, which may indicate an association between the occurrence and development of tumors and low NCOA5 expression.

The present study demonstrated that the expression of NCOA5 protein in human specimens is closely associated with the occurrence of osteosarcoma. The expression of NCOA5 in osteosarcoma tissues was significantly lower compared with that in normal bone tissue. This indicates that NCOA5 may be a tumor-suppressor gene in humans.

The results of the present study suggested that the expression of NCOA5 is consistent in different types of osteosarcoma tissues, such as those with or without pulmonary metastasis. The expression of NCOA5 in osteosarcoma was significantly lower compared to that in normal bone tissue. The low expression of NCOA5 may be a cause of osteosarcoma, and therefore, it may be important to detect the expression of NCOA5 in osteosarcoma for the diagnosis of this disease.

In the present study, it was also identified that the expression of NCOA5 protein in patients with osteosarcoma was associated with survival prognosis, and the clinical features of the tumor were significantly associated with the survival rate, differentiation and staging.

In conclusion, the results of the present study indicate the potential role of NCOA5 in the progression of osteosarcoma, highlighting its low expression as an independent prognostic factor. Furthermore, additional studies examining NCOA5 may also assist in developing novel therapeutic strategies for osteosarcoma.

Acknowledgements

The present study was supported by Jiangsu Pharmaceutical Association (grant no. 201542) and the Science and Technology commission of Yancheng City (grant no. YK2015002).

References

1 

Huang J, Liu K, Song D, Ding M, Wang J, Jin Q and Ni J: Krüppel-like factor 4 promotes high-mobility group box 1-induced chemotherapy resistance in osteosarcoma cells. Cancer Sci. 107:242–249. 2016. View Article : Google Scholar : PubMed/NCBI

2 

Li YS, Deng ZH, Zeng C and Lei GH: JNK pathway in osteosarcoma: Pathogenesis and therapeutics. J Recept Signal Transduct Res. 36:465–470. 2016. View Article : Google Scholar : PubMed/NCBI

3 

Lamplot JD, Denduluri S, Qin J, Li R, Liu X, Zhang H, Chen X, Wang N, Pratt A, Shui W, et al: The current and future therapies for human osteosarcoma. Curr Cancer Ther Rev. 9:55–77. 2013. View Article : Google Scholar : PubMed/NCBI

4 

Chakravarthi PS, Kattimani VS, Prasad LK and Satish PR: Juxtacortical osteosarcoma of the mandible: Challenges in diagnosis and management. Natl J Maxillofac Surg. 6:127–131. 2015. View Article : Google Scholar : PubMed/NCBI

5 

Commandeur AE, Styer AK and Teixeira JM: Epidemiological and genetic clues for molecular mechanisms involved in uterine leiomyoma development and growth. Hum Reprod Update. 21:593–615. 2015. View Article : Google Scholar : PubMed/NCBI

6 

Zhou W, Zhu Y, Chen S, Xu R and Wang K: Fibroblast growth factor receptor 1 promotes MG63 cell proliferation and is associated with increased expression of cyclin-dependent kinase 1 in osteosarcoma. Mol Med Rep. 13:713–719. 2016. View Article : Google Scholar : PubMed/NCBI

7 

Yang J, Cheng D, Zhou S, Zhu B, Hu T and Yang Q: Overexpression of X-box binding protein 1 (XBP1 correlates to poor prognosis and up-regulation of PI3K/mTOR in human osteosarcoma. Int J Mol Sci. 16:28635–28646. 2015. View Article : Google Scholar : PubMed/NCBI

8 

Liu CY and Feng GS: NCOA5, a molecular link between type 2 diabetes and liver cancer. Hepatobiliary Surg Nutr. 3:106–108. 2014.PubMed/NCBI

9 

Tetel MJ, Auger AP and Charlier TD: Who's in charge? Nuclear receptor coactivator and corepressor function in brain and behavior. Front Neuroendocrinol. 30:328–342. 2009. View Article : Google Scholar : PubMed/NCBI

10 

Gao S, Li A, Liu F, Chen F, Williams M, Zhang C, Kelley Z, Wu CL, Luo R and Xiao H: NCOA5 Haploinsufficiency results in glucose intolerance and subsequent hepatocellular carcinoma. Cancer Cell. 24:725–737. 2013. View Article : Google Scholar : PubMed/NCBI

11 

Lahusen T, Henke RT, Kagan BL, Wellstein A and Riegel AT: The role and regulation of the nuclear receptor co-activator AIB1 in breast cancer. Breast Cancer Res Treat. 116:225–237. 2009. View Article : Google Scholar : PubMed/NCBI

12 

Chauhan C, Zraly CB, Parilla M, Diaz MO and Dingwall AK: Histone recognition and nuclear receptor co-activator functions of Drosophila cara mitad, a homolog of the N-terminal portion of mammalian MLL2 and MLL3. Development. 139:1997–2008. 2012. View Article : Google Scholar : PubMed/NCBI

13 

Chen VW, Ruiz BA, Hsieh MC, Wu XC, Ries LA and Lewis DR: Analysis of stage and clinical/prognostic factors for lung cancer from SEER registries: AJCC staging and collaborative stage data collection system. Cancer. 120 Suppl 23:S3781–S3792. 2014. View Article : Google Scholar

14 

Chinenov Y, Gupte R and Rogatsky I: Nuclear receptors in inflammation control: Repression by GR and beyond. Mol Cell Endocrinol. 380:55–64. 2013. View Article : Google Scholar : PubMed/NCBI

15 

Pavlin MR, Brunzelle JS and Fernandez EJ: Agonist ligands mediate the transcriptional response of nuclear receptor heterodimers through distinct stoichiometric assemblies with coactivators. J Biol Chem. 289:24771–24778. 2014. View Article : Google Scholar : PubMed/NCBI

16 

Gyamfi MA and Wan YJ: Pathogenesis of alcoholic liver disease: The role of nuclear receptors. Exp Biol Med (Maywood). 235:547–560. 2010. View Article : Google Scholar : PubMed/NCBI

17 

Brand TM, Iida M, Li C and Wheeler DL: The nuclear epidermal growth factor receptor signaling network and its role in cancer. Discov Med. 12:419–432. 2011.PubMed/NCBI

18 

Poos K, Smida J, Maugg D, Eckstein G, Baumhoer D, Nathrath M and Korsching E: Genomic heterogeneity of osteosarcoma-shift from single candidates to functional modules. PLoS One. 10:e01230822015. View Article : Google Scholar : PubMed/NCBI

19 

Basu-Roy U, Basilico C and Mansukhani A: Perspectives on cancer stem cells in osteosarcoma. Cancer Lett. 338:158–167. 2013. View Article : Google Scholar : PubMed/NCBI

20 

Zhao R, Ni D, Tian Y, Ni B and Wang A: Aberrant ADAM10 expression correlates with osteosarcoma progression. Eur J Med Res. 19:92014. View Article : Google Scholar : PubMed/NCBI

21 

Talmadge JE and Gabrilovich DI: History of myeloid-derived suppressor cells. Nat Rev Cancer. 13:739–752. 2013. View Article : Google Scholar : PubMed/NCBI

22 

Dhar D, Seki E and Karin M: NCOA5, IL-6, Type-2 diabetes and HCC: The deadly quartet. Cell Metab. 19:6–7. 2014. View Article : Google Scholar : PubMed/NCBI

23 

Cumsille P, Coronel A, Conca C, Quiñinao C and Escudero C: Proposal of a hybrid approach for tumor progression and tumor-induced angiogenesis. Theor Biol Med Model. 12:132015. View Article : Google Scholar : PubMed/NCBI

24 

Arvelo F, Sojo F and Cotte C: Tumour progression and metastasis. Ecancermedicalscience. 10:6172016. View Article : Google Scholar : PubMed/NCBI

25 

Gillespie MA, Gold ES, Ramsey SA, Podolsky I, Aderem A and Ranish JA: An LXR-NCOA5 gene regulatory complex directs inflammatory crosstalk-dependent repression of macrophage cholesterol efflux. EMBO J. 34:1244–1258. 2015. View Article : Google Scholar : PubMed/NCBI

26 

Lee E, Pandey NB and Popel AS: Crosstalk between cancer cells and blood endothelial and lymphatic endothelial cells in tumour and organ microenvironment. Expert Rev Mol Med. 17:e32015. View Article : Google Scholar : PubMed/NCBI

27 

Marcu LG and Harriss-Phillips WM: In Silico modelling of treatment-induced tumour cell kill: Developments and advances. Comput Math Methods Med. 2012:9602562012. View Article : Google Scholar : PubMed/NCBI

28 

Fang M, Yuan J, Peng C and Li Y: Collagen as a double-edged sword in tumor progression. Tumour Biol. 35:2871–2882. 2014. View Article : Google Scholar : PubMed/NCBI

29 

Lin G, Sun XJ, Han QB, Wang Z, Xu YP, Gu JL, Wu W, Zhang GU, Hu JL, Sun WY and Mao WM: Epidermal growth factor receptor protein overexpression and gene amplification are associated with aggressive biological behaviors of esophageal squamous cell carcinoma. Oncol Lett. 10:901–906. 2015. View Article : Google Scholar : PubMed/NCBI

30 

Shiomi H, Eguchi Y, Tani T, Kodama M and Hattori T: Cellular distribution and clinical value of urokinase-type plasminogen activator, its receptor, and plasminogen activator inhibitor-2 in esophageal squamous cell carcinoma. Am J Pathol. 156:567–575. 2000. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

February 2018
Volume 15 Issue 2

Print ISSN: 1792-1074
Online ISSN:1792-1082

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
APA
Wu, Y., Wu, J., Dong, Q., & Guo, N. (2018). Association between expression of nuclear receptor co‑activator 5 protein and prognosis in postoperative patients with osteosarcoma. Oncology Letters, 15, 1888-1892. https://doi.org/10.3892/ol.2017.7513
MLA
Wu, Y., Wu, J., Dong, Q., Guo, N."Association between expression of nuclear receptor co‑activator 5 protein and prognosis in postoperative patients with osteosarcoma". Oncology Letters 15.2 (2018): 1888-1892.
Chicago
Wu, Y., Wu, J., Dong, Q., Guo, N."Association between expression of nuclear receptor co‑activator 5 protein and prognosis in postoperative patients with osteosarcoma". Oncology Letters 15, no. 2 (2018): 1888-1892. https://doi.org/10.3892/ol.2017.7513