International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.
International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.
Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.
Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.
Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.
Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.
Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.
International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.
Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.
Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.
Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.
An International Open Access Journal Devoted to General Medicine.
Lung cancer is a global health problem with poor clinical outcomes. According to the survey of Mayo Clinic in 2005, non-small cell lung cancer (NSCLC) accounts for more than 80% of 5,628 patients with primary lung cancer out of all lung cancer cases, and the majority of patients with NSCLC are diagnosed at the advanced stage (1–3). Radiation therapy is regarded as the primary treatment strategy for NSCLC. However, radio-resistance is a key issue limiting its effectiveness (4). Therefore, screening for effective molecular radiosensitizers is urgently required to provide personalized therapy and improve patient survival.
MicroRNAs (miRs; miRNAs) are endogenous non-coding RNAs that function as regulators of gene expression by targeting mRNA degradation or inhibiting their translation (5). Over the previous decade, a number of studies have demonstrated that the altered expression of miRs has been associated with different types of cancer (6), including lung cancer (7). In addition, studies have also suggested that there is an association between certain miRs and radiotherapy (8,9). The function of miR-9 in cancer cells has been considered to be controversial since it serves as a tumor suppressor in melanoma (10) and as a metastasis-promoter in breast cancer (11). Reduced expression of miR-9 is considered to be a marker of poor prognosis in cervical cancer (12) and acute lymphoblastic leukemia (13). However, the function of miR-9 in NSCLC pathogenesis, and the molecular mechanisms by which miR-9 exerts its functions and modulates the malignant phenotypes of NSCLC cells have not been fully determined.
Neuropilin 1 (NRP1) is a transmembrane glycoprotein with large extracellular regions that is extensively expressed in endothelial cells and a variety of tumor cells (14). NRP1 serves a crucial function in tumorigenesis and radio-resistance. Brieger et al (15) identified that the addition of recombinant vascular endothelial growth factor VEGF-121 and VEGF-165 to squamous carcinoma cells increased resistance to radiation-induced cell death by targeting NRP1 receptors. Glinka et al (16) demonstrated that the overexpression of NRP1 decreased the apoptosis rate of glioma cells induced by radiation. In our previous study, NRP1 was highly expressed in the radio-resistant NSCLC A549 cell line, and short hairpin RNA-mediated NRP1 inhibition significantly enhanced radio-sensitivity (17). However, the mechanism by which NRP1 is regulated by certain miRs to exert its functions remains unclear.
The present study demonstrated that miR-9 served a tumor suppressor function in, and enhanced the radio-sensitivity of, NSCLC cells by regulating NRP1. These data will provide novel insights for understanding the mechanisms of NSCLC pathogenesis, and present a potential biomarker in evaluating the effectiveness of radio-therapy treatment.
A549 cells were cultured in Dulbecco's modified Eagle medium (DMEM; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA). All media were supplemented with 10% fetal bovine serum (FBS; HyClone; GE Healthcare, Chicago, IL, USA), 100 U/ml penicillin and 100 µg/ml streptomycin (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) in a humid incubator with 5% CO2. Cells were harvested using 0.25% trypsin (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) and 0.03% EDTA solution at 37°C for 5–10 min. Media were replaced 2–3 times per week.
A549 cells (Type Culture Collection of the Chinese Academy of Sciences, Shanghai, China) were cultured in Dulbecco's modified Eagle's medium (Gibco, Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% (vol/vol) fetal bovine serum (HyClone, GE Healthcare) and 1% penicillin-streptomycin. A549 cells were transfected with 100 nM miR-9 mimic (Sense 5′-UCUUUGGUUAUCUAGCUGUAUGATT-3′, Anti-sense 5′-AUAAAGCUAGAUAACCGAAAGUTT-3) or negative control (NC; Sense 5′-UUCUCCGAACGUGUCACGUTT-3′, Anti-sense 5′-ACGUGACACGUUCGGAGAATT-3′) RNA (GenePharma, Shanghai, China) using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) were sham-irradiated or exposed to irradiation (IR). Subsequent experimentation was performed 24 h after transfection.
A total of 24 male 6-week-old Balb/c athymic nude mice (Beijing HFK Bioscience Co., Ltd., Beijing, China), weighing 19–20 g were used in this study. Mice were maintained in a specific pathogen free environment, with a 12 h light/dark cycle at 20–25°C and a humidity of 40–70%, sterilized food and water were freely available. Mice were subcutaneously injected in the right flank with 1×106 cells in 0.1 ml PBS. Once the tumors had formed, caliper measurements were performed daily and tumor volume (V) was calculated using the formula: V=width2xlength/2. When tumors volume reached ~100 mm3, the mice were randomly divided into four groups (control, miR-9, IR and miR-9+IR group; n=6), and the miR-9 and miR-9+IR groups received intratumoral injection of miR-9 plasmids along with the DNA transfection reagent (Entranster™-in vivo, Engreen Biosystem Co., Ltd., Beijing, China) once weekly. For each injection, 15 µg miRNA were mixed with 15 µl Entranster™-in vivo. The IR and miR-9+IR group were exposed to 20 Gy at the tumor site. The mice were euthanatized 15 days following IR, or if a humane endpoint was reached; defined as a loss of more than 15% of body mass, a tumor volume greater than 1.2 cm3, severe fever, vomiting or skin problems (wounds or signs of inflammation) or inability to ambulate or rise for food and water. Following euthanasia, the tumor mass and volume were recorded, and tumor volumes did not exceed 219 mm3. The dissected tumors were collected and prepared for subsequent analyses. All animal experiments were performed in accordance with the institutional guidelines of Jilin University (Changchun, China) for the Care and Use of Laboratory Animals, and this board approved the study protocol was.
A549 cells were sham-irradiated or exposed to IR at a dose rate of 1.0 Gy/min (220 kV; 18 mA) by an X-ray generator (Model X-RAD320, Precision X-ray, North Branford, CT, USA). The male 6-week-old Balb/c athymic nude mice were exposed to a single 20 Gy dose of X rays at a dose rate of 1.55 Gy/min.
Total RNA was extracted from A549 cells using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and reverse transcribed to generate cDNA (PrimeScript RT-PCR kit; Takara Bio, Inc., Otsu, Japan) according to the manufacturer's protocol. The primer sequences are as follows: NPR1 forward, CCCCAAACCACTGATAACTCG, reverse, AGACACCATACCCAACATTCC; GAPDH forward, ACATCGCTCAGACACCATG, reverse, TGTAGTTGAGGTCAATGAAGGG (Sangon Biotech Co., Ltd., Shanghai, China). The Thermocycling conditions were as follows: 95°C for 5 min, 40 cycles of 95°C for 10 sec follows by 60°C for 30 sec. U6 small nuclear RNA and GAPDH were used as internal controls for miR-9 and NRP1, respectively. All samples were normalized to the internal controls and fold changes were calculated through relative quantification (2−ΔΔCq) (18).
The TargetScan predictions (http://www.targetscan.org/vert_71/) were used to identify the putative miRNA target sites in 3′ UTRs of NRP1 gene. The NRP1 gene symbol and human species were retrieved from the database. The 3′ UTR of NRP1 transcript ENST00000374875.1 was selected to analyze the potential binding site of miRNAs.
Gaussian luciferase and alkaline phosphatase activities were measured by luminescence in conditioned medium (DMEM; HyClone; GE Healthcare) without antibiotics and 10% FBS (HyClone; GE Healthcare) 48 h after transfection, as previously described (19). A 2,600 bp fragment of DNA from the NRP1 3′ untranslated region (3′UTR) of A549 cells was amplified by PCR using Q5® High-Fidelity DNA Polymerase (M0491) from New England BioLabs, Inc. (Ipswich, MA, USA). The primer sequences used were as follows: Forward, ATGAACGGTACCAGGCAGACAGAGATGAAAAGACA, reverse, GAACTTCTCGAGTCAGGTGTGGGATATTTTATGAAAATG. Thermocycling conditions were 95°C for 3 min, followed by 35 cycles of 95°C for 15 sec, 58°C for 30 sec, 72°C for 2 min 30 sec, 35 cycles, and one cycle of 72°C for 10 min. DNA was then cloned into the pEZX-MT05 vector (GeneCopoeia, Inc., Rockville, MD, USA). The vector was named wild-type (wt) 3′UTR. Site-directed mutagenesis of the miR-9 binding site in the NRP1 3′UTR was performed using the GeneTailor Site-Directed Mutagenesis System (Invitrogen; Thermo Fisher Scientific, Inc.) and the construct was named mutant (mt) 3′UTR. A549 cells were transfected with 100 ng wt/mt 3′UTR vectors and 100 nM miR-9 mimic/anti-miR-9/NC, using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). Following transfection for 48 h, the activity of Gaussia luciferase and secreted alkaline phosphatase were examined using the Secrete-Pair Dual Luminescence Assay kit (GeneCopoeia, Inc., Rockville, MD, USA). Gaussian luciferase activity was normalized to alkaline phosphatase activity. Normalized luciferase activity of treatment group was compared with that of control group.
A total of 48 h after radiation exposure, media was removed from the A549 cells, which were then washed twice with ice-cold PBS. Lysis was performed using cell lysis buffer (Beyotime Institute of Biotechnology, Haimen, China), and cell lysates were collected by scraping the plates prior to centrifugation at 10,000 × g at 4°C for 5 min. Proteins were quantified using a bicinchoninic acid assay kit according to the manufacturers protocol (Applygen Technologies Inc., Beijing, China). A total of 30 µg protein, denatured in gel loading buffer (Applygen Technologies Inc., Beijing, China), was loaded per well and separated using SDS-PAGE electrophoresis (5% stacking gel and 10% separating gel) at 100 V voltage until bromophenol blue runs out of separating gel, and then transferred onto polyvinylidene fluoride membranes (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The membranes were blocked in 5% skimmed milk at room temperature for 1 h, prior to incubation at 4°C overnight with the designated primary antibodies (rabbit anti-Neuropilin 1 (Abcam, Cambridge, UK; cat. no., ab81321), rabbit anti-phospho-p38 MAPK (CST Biological Reagents Co., Ltd., Shanghai, China; cat. no., 9215), rabbit anti-total-p38 MAPK (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany; cat. no., M0800), rabbit anti-pERK1/2 (T202/Y204) (CST Biological Reagents Co., cat. no., 4370), mouse anti-ERK1/2 (CST Biological Reagents Co., cat. no., 9107), rabbit anti-pAKT (S473; CST Biological Reagents Co., cat. no., 4060), mouse anti-AKT (CST Biological Reagents Co. cat. no., 2966), rabbit PI3 Kinase p110α (C73F8; CST Biological Reagents Co., cat. no., 4249) and mouse anti-GAPDH (Santa Cruz Biotechnology, Inc., Dallas, TX, USA; cat. no., sc-47724). All antibodies were used at a dilution of 1:1,000. Membranes were then incubated with the corresponding horseradish peroxidase-conjugated secondary antibodies (goat anti-rabbit IgG; Beyotime Institute of Biotechnology) for 2 h at room temperature. Densitometry was performed using ImageJ (version 1.50i; National Institutes of Health, Bethesda, MD, USA).
A total of 5×103 A549 cells were seeded into 96-well plates and transfected with miR-9 mimics or control RNA. Following IR, the cells were cultured in DMEM (Hyclone; GE Healthcare, Chicago, IL, USA) with 10% FBS (HyClone; GE Healthcare) at 37°C for 0, 24 and 48 h. The effect of miR-9 on cell growth and viability was determined by MTT assay (Cell Growth Determination kit; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) according to the manufacturer's instructions, DMSO was used to dissolve the crystals, and the optical density was measured at 570 nm.
For cell-cycle analysis, 1×106 cells transfected with miRNAs or control RNA were cultured in complete DMEM (Hyclone; GE Healthcare) at 37°C in triplicate in 6-well plates. At 48 h post-transfection, cells were exposed to 10 Gy IR. The cell-cycle distribution was analyzed by 0.05 mg/ml propidium iodide staining (37°C for 30 min) and flow cytometry (BD Biosciences, Franklin Lakes, NJ, USA). The cells were stained for 20 min at room temperature using the Annexin V-FITC Apoptosis Detection kit I (BD Biosciences) according to the manufacturer's protocol. The data obtained from this assay was analyzed using Modfit software (version 3.3; Verity House Software, Topsham, ME, USA).
Transfected and control A549 cells were plated into 6-well plates at specific cell densities (200 cells for 0 Gy, 500 cells for 2 Gy, 1,000 cells for 4 Gy, 3,000 cells for 6 Gy and 5,000 cells for 8 Gy) and received 0, 2, 4, 6 or 8 Gy X-ray 24 h subsequent to seeding, and were then cultured in DMEM (Hyclone; GE Healthcare) at 37°C for 7–14 days to allow colonies to grow. The cells were then rinsed 3 times with PBS, fixed in 100% methanol (at room temperature for 20 min), and stained with Giemsa stain (0.04%) for 30 min at room temperature. The number of the colonies containing at least 50 cells was counted using a light microscope at magnification, ×40. The surviving fraction was calculated as the number of colonies counted/(the number of cells seeded × plating efficiency). Experiments were performed in triplicate and repeated three times.
For the transwell migration assays, 2.5×104 A549 cells were plated in the top chamber on non-coated membrane (24-well insert; Corning, NY, USA). For the invasion assays, 5×104 A549 cells were plated in the top chamber on Matrigel®-coated membranes (24-well insert; BD Biosciences). The cells were plated in DMEM (Hyclone; GE Healthcare) without serum, or supplemented 10% FBS (HyClone; GE Healthcare) was used as the chemoattractant in the lower chamber. The cells were then incubated for 12 h at 37°C. Cells remaining on the upper side of the filter membrane were removed with PBS-rinsed cotton swabs. The filters were then fixed in 100% ethanol for 20 min at room temperature, and stained with 0.1% crystal violet for 20 min at room temperature. The stained cells were counted under a light microscope (magnification, ×40). The average count was calculated in 6 random fields of view. Experiments were performed in triplicate and repeated three times.
Statistical analysis was performed using SPSS 18.0 (SPSS, Inc., Chicago, IL, USA). The results from three independent experiments are presented as mean ± standard deviation. Differences between the control and experimental groups were analyzed using one-way analysis of variance, followed by between group comparisons performed using the Student-Newman-Keuls test. P<0.05 was considered to indicate a statistically significant difference.
In our previous study, it had been demonstrated that a high expression of NRP1 was correlated with the growth, survival and radio-resistance of NSCLC cells via the VEGF-PI3K-NF-κB pathway (17). We hypothesized that certain miRNAs may be involved in these biological processes through regulating NRP1 expression. In view of this consideration, the present study used the TargetScan algorithm to determine the potential miRNAs that may bind to the 3′UTR of NRP1 and it was identified that NRP1 possessed a conserved miR-9 binding site within its 3′UTR in the majority of species examined (Fig. 1A). A luciferase reporter assay was additionally performed to identify the ability of miR-9 to bind to the 3′UTR of NRP1 mRNA. Notably, co-transfecting the miR-9 mimics with the luciferase-linked NRP1 wild-type 3′UTR construct downregulated luciferase activity, whereas co-transfection with the mutated 3′UTR construct did not (Fig. 1B). In addition, inhibition of endogenous miR-9 expression in cells transduced with anti-miR-9 resulted in increased luciferase activity from the wild-type construct, but had no effect on the mutated NRP1 3′UTR (Fig. 1C). These data suggest that miR-9 regulated the expression of NRP1 mRNA (Fig. 1D) and protein (Fig. 1E) in A549 cells.
The expression of NRP1 was detected in 5 NSCLC cell lines including H358, H460, H1299, A549 and SK-MES-1 in a previous study (17), and it was identified that the A549 cell line demonstrated the highest expression of NRP1 and the strongest radio-resistance. In addition, the tumors formed from NRP1-inhibited A549 cells grew at a decreased rate compared with those from normal A549 cells (17). Therefore, A549 cells were selected as the primary cell line. Whether miR-9 overexpression functioned similarly to NRP1 inhibition was examined. miR-9 mimics were transiently transfected into A549 cells for functional analysis. A significant decrease in cell viability at 24 h and a more marked decrease at 48 h was observed compared with the control (Fig. 2A). Concurrently, a significant increase in apoptosis was detected with miR-9 treatment vs. the control (Fig. 2B). Cell cycle assays indicated that transfection with miR-9 mimics arrested cell cycle progression in the G2/M phase at 48 h (Fig. 2C). In addition, we measured the migratory and invasive abilities of A549 cells via transwell migration and Matrigel® invasion assays. The results indicated that the number of migratory (Fig. 2D) and invasive cells (Fig. 2E) decreased following transfection with miR-9 mimics compared with untreated A549 cells. Furthermore, the tumor formation assay in nude mice demonstrated that the growth of tumors formed from miR-9-treated A549 cells was delayed compared with the normal control group (Fig. 3C). Overall, these results indicated that miR-9 functioned as a tumor suppressor in A549 cells by inhibiting cell proliferation, promoting apoptosis and attenuating migratory and invasive capacities.
It had been demonstrated previously that knockdown of endogenous NRP1 enhanced the radio-sensitivity of A549 cells (17). Combined with the results of the present study, we hypothesized that miR-9 was also able to effect the radio-sensitivity of A549 cells. A549 cells were transfected with or without miR-9 mimics and the effect upon IR was observed. The viability of cells transfected with miR-9 mimics was significantly decreased at 24 h, and even greater at 48 h compared with the normal control (Fig. 3A). Colony assays indicated that the survival fraction of A549 cells in the miR-9-transfected group was decreased compared with that in the miR-NC group upon IR with 0, 2, 4, 6 or 8 Gy (Fig. 3B). These data suggested that the overexpression of miR-9 may significantly enhance the in vitro radio-sensitivity of NSCLC cells. Next, the nude mouse subcutaneous tumor model was constructed. The mice were randomly divided into four groups (control, miR-9, IR and miR-9+IR group) and the corresponding experimental treatment was administered. The results indicated that the growth of the tumors treated with miR-9 and IR were significantly delayed compared with other groups (Fig. 3C), which suggested that miR-9 overexpression combined with radiotherapy may induce a stronger in vivo anti-tumor effect compared with radiotherapy alone.
The expression of NRP1 and miR-9 in IR- and non-IR-treated tumors from the nude mice were additionally examined. The NRP1 expression was significantly upregulated, while the miR-9 was markedly downregulated, which indicates a marked correlation with radiosensitivity (Fig. 4A). As a non-tyrosine kinase receptor, NRP1 may moderately increase PI3K and phosphorylation of ERK P38 MAPK, ERK1/2, protein kinase B (Akt) and NF-κB to promote tumor cell proliferation and metastasis, and inhibit apoptosis and enhance radio-resistance (17,20). Therefore, as NRP1 is a downstream target of miR-9, miR-9 may also downregulate PI3K and the phosphorylation of P38 MAPK, ERK1/2, Akt and NF-κB. Consequently, it was identified that the overexpression of miR-9 inhibited PI3K and phosphorylation of NF-κB, P38 MAPK, ERK1/2 and Akt, but the relative expression of total protein was not significantly altered (Fig. 4B). Therefore, one of the mechanisms of miR-9-mediated radio-sensitivity may function by regulating PI3K and the phosphorylation of NF-κB, ERK1/2, P38 MAPK and Akt via NRP1.
miRs serve a crucial function in controlling proliferation, differentiation and tumorigenesis. A previous study demonstrated the downregulation of miR-9 in gastric, colon and ovarian cancer, and miR-9 upregulation in human breast cancer, brain tumors and biliary tract cancer associated with the controversial functions (21). miR-9 exhibits tumor-suppressive activity in human gastric cancer (22) and colorectal cancer (23), whilst it serves an oncogenic role in bladder cancer (24), osteosarcoma (25) and mixed lineage leukemia-rearranged leukemia (26). These conflicting results are also reflected in studies on the same types of tumors, such as ovarian cancer (27,28) and NSCLC (21,29), in which miR-9 has exhibited tumorigenesis-associated and anti-tumor activities in different studies. The reasons for these contradicting conclusions may be due to the heterogeneity of the tumors and the different materials, such as cell lines, used. In the present study, it was identified that miR-9 may inhibit the proliferation, invasion and migration in A549 cells, which possessed marked radio-resistance compared with other NSCLC cell lines. In addition, it was associated with the high expression of NRP1 (17). In the present study, it was demonstrated that miR-9 directly downregulated expression of NRP1 by binding to its 3′UTR and enhanced the radio-sensitivity of A549 cells.
To understand the clinicopathological significance of miR-9, the effect of miR-9 overexpression in A549 lung cancer cells was examined. The results indicated that miR-9 overexpression significantly decreased the viability of A549 cells and arrested cell cycle progression at the G2/M phase. As it has been established that cells in the G2/M phase are sensitive to IR, with sensitivity decreasing as cells proceed from G1 to S phase (30), the results from the flow cytometry analysis suggested that upregulation of miR-9 may enhance A549 cell radio-sensitivity by disrupting the G2/M phase of the cell cycle. In addition, the overexpression of miR-9 increased the cell apoptosis rate and inhibited cell migration and invasion compared with the transfected group. These results were consistent with those observed in NRP1 knockdown cells in our previous study (17), indicating that miR-9 serves a role of tumor suppressor by targeting NRP1 in A549 cells. In fact, NRP1 is an oncogenic promoter that is expressed in a wide variety of human tumor cell lines, and it has been demonstrated that NRP1 may enhance the binding of VEGF to vascular endothelial growth factor receptor 2 (VEGFR2), which resulted in promoting VEGF165-mediated tumor angiogenesis, cell migration and tumorigenicity (31).
It was also suggested that NRP1 may increase the resistance of tumor cells to radiotherapy (17,32). Therefore, we hypothesized that miR-9 may be also involved in the regulation of radiosensitivity. It was identified that miR-9 overexpression significantly inhibited the viability and colony-forming ability of A549 cells following IR, which demonstrated that miR-9 enhanced the radio-sensitivity of this cell line in vitro. Furthermore, a nude mouse subcutaneous tumor model was constructed to analyze the effect of miR-9 to radiotherapy. The results indicated that miR-9 overexpression, combined with IR, exerted a more marked anti-tumor effect compared with IR alone. All these data suggest that miR-9 enhanced the radio-sensitivity in vitro and in vivo.
The intrinsic tumor radio-resistance relies on cell survival and apoptosis, cell cycle and DNA repair pathways (33). A total of 4 classical signal transduction pathways, including PI3K/AKT, MAPK/ERK, NF-κB and transforming growth factor-β, were involved in the regulation of tumor radiation response, which may be activated either upon radiation exposure or through the phosphorylation of receptor tyrosine kinase such as EGFR and Insulin-like growth factor 1 receptor (34). The results of the present study revealed that treatment with IR inhibited miR-9 expression, and correspondingly increased NRP1 expression in the tumors formed from A549 cells. The upregulated NRP1 expression increased the rate interaction between VEGFR2 and NRP1 and enhanced radio-resistance by the activated VEGFR2-PI3K-NF-κB pathway (17,20). It implied that increasing radio-sensitivity by upregulating miR9, which targets NRP1, may be a potential treatment strategy. Compared with the control group in the present study, the expression levels of PI3K, NF-κB, phosphorylated (p)ERK, pAkt and pP38 were all altered following the overexpression miR-9, indicating that miR-9 may inhibit multiple signaling pathways to enhance radio-sensitivity. These results may offer insights for the improved understanding of the whole network regulating radio-resistance, and may assist additional improvements in the radiotherapy treatment strategy for NSCLC.
The present study was supported by the National Natural Science Foundation of China (grant no. 81573085, 81672091, 81541142, 81371890 and 81201737) and Beijing Natural Science Foundation (grant no. 7172232). An abstract for this study was published following its acceptance for a poster presentation at the Annual Meeting-American Society for Radiation Oncology 24–27 September 2017, San Diego, CA, USA (International Journal of Radiation Oncology 99: E628, 2017).
|
Spiro SG and Silvestri GA: One hundred years of lung cancer. Am J Respir Crit Care Med. 172:523–529. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Parkin DM, Bray F, Ferlay J and Pisani P: Global cancer statistics. 2002 CA Cancer J Clin. 55:1–108. 2005. | |
|
Yang P, Allen MS, Aubry MC, Wampfler JA, Marks RS, Edell ES, Thibodeau S, Adjei AA, Jett J and Deschamps C: Clinical features of 5,628 primary lung cancer patients: Experience at Mayo Clinic from 1997 to 2003. Chest. 128:452–462. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Siegel R, Naishadham D and Jemal A: Cancer statistics, 2012. CA Cancer J Clin. 62:10–29. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Lee RC, Feinbaum RL and Ambros V: The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 75:843–854. 1993. View Article : Google Scholar : PubMed/NCBI | |
|
Calin GA and Croce CM: MicroRNA signatures in human cancers. Nat Rev Cancer. 6:857–866. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Ortholan C, Puissegur MP, Ilie M, Barbry P, Mari B and Hofman P: MicroRNAs and lung cancer: New oncogenes and tumor suppressors, new prognostic factors and potential therapeutic targets. Curr Med Chem. 16:1047–1061. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Salim H, Akbar NS, Zong D, Vaculova AH, Lewensohn R, Moshfegh A, Viktorsson K and Zhivotovsky B: miRNA-214 modulates radiotherapy response of non-small cell lung cancer cells through regulation of p38MAPK, apoptosis and senescence. Br J Cancer. 107:1361–1373. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Oh JS, Kim JJ, Byun JY and Kim IA: Lin28-let7 modulates radiosensitivity of human cancer cells with activation of K-Ras. Int J Radiat Oncol Biol Phys. 76:5–8. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Liu S, Kumar SM, Lu H, Liu A, Yang R, Pushparajan A, Guo W and Xu X: MicroRNA-9 up-regulates E-cadherin through inhibition of NF-κB1-Snail1 pathway in melanoma. J Pathol. 226:61–72. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Ma L, Young J, Prabhala H, Pan E, Mestdagh P, Muth D, Teruya-Feldstein J, Reinhardt F, Onder TT, Valastyan S, et al: miR-9, a MYC/MYCN-activated microRNA, regulates E-cadherin and cancer metastasis. Nat Cell Biol. 12:247–256. 2010.PubMed/NCBI | |
|
Hu X, Schwarz JK, Lewis JS Jr, Huettner PC, Rader JS, Deasy JO, Grigsby PW and Wang X: A microRNA expression signature for cervical cancer prognosis. Cancer Res. 70:1441–1448. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Rodriguez-Otero P, Román-Gómez J, Vilas-Zornoza A, José-Eneriz ES, Martín-Palanco V, Rifón J, Torres A, Calasanz MJ, Agirre X and Prosper F: Deregulation of FGFR1 and CDK6 oncogenic pathways in acute lymphoblastic leukaemia harbouring epigenetic modifications of the MIR9 family. Br J Haematol. 155:73–83. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Wild JR, Staton CA, Chapple K and Corfe BM: Neuropilins: Expression and roles in the epithelium. Int J Exp Pathol. 93:81–103. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Brieger J, Schroeder P, Gosepath J and Mann WJ: VEGF-subtype specific protection of SCC and HUVECs from radiation induced cell death. Int J Mol Med. 15:145–151. 2005.PubMed/NCBI | |
|
Glinka Y, Mohammed N, Subramaniam V, Jothy S and Prud'homme GJ: Neuropilin-1 is expressed by breast cancer stem-like cells and is linked to NF-κB activation and tumor sphere formation. Biochem Biophys Res Commun. 425:775–780. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Dong JC, Gao H, Zuo SY, Zhang HQ, Zhao G, Sun SL, Han HL, Jin LL, Shao LH, Wei W and Jin SZ: Neuropilin 1 expression correlates with the Radio-resistance of human non-small-cell lung cancer cells. J Cell Mol Med. 19:2286–2295. 2015.PubMed/NCBI | |
|
Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI | |
|
Hershkovitz-Rokah O, Modai S, Pasmanik-Chor M, Toren A, Shomron N, Raanani P, Shpilberg O and Granot G: MiR-30e induces apoptosis and sensitizes K562 cells to imatinib treatment via regulation of the BCR-ABL protein. Cancer Lett. 356:597–605. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Hong TM, Chen YL, Wu YY, Yuan A, Chao YC, Chung YC, Wu MH, Yang SC, Pan SH, Shih JY, et al: Targeting neuropilin 1 as an antitumor strategy in lung cancer. Clin Cancer Res. 13:4759–4768. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Xu T, Liu X, Han L, Shen H, Liu L and Shu Y: Up-regulation of miR-9 expression as a poor prognostic biomarker in patients with non-small cell lung cancer. Clin Transl Oncol. 16:469–475. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Wan HY, Guo LM, Liu T, Liu M, Li X and Tang H: Regulation of the transcription factor NF-kappaB1 by microRNA-9 in human gastric adenocarcinoma. Mol Cancer. 9:162010. View Article : Google Scholar : PubMed/NCBI | |
|
Zhu M, Xu Y, Ge M, Gui Z and Yan F: Regulation of UHRF1 by microRNA-9 modulates colorectal cancer cell proliferation and apoptosis. Cancer Sci. 106:833–839. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Wang H, Zhang W, Zuo Y, Ding M, Ke C, Yan R, Zhan H, Liu J and Wang J: miR-9 promotes cell proliferation and inhibits apoptosis by targeting LASS2 in bladder cancer. Tumour Biol. 36:9631–9640. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Zhu SW, Li JP, Ma XL, Ma JX, Yang Y, Chen Y and Liu W: miR-9 modulates osteosarcoma cell growth by targeting the GCIP tumor suppressor. Asian Pac J Cancer Prev. 16:4509–4513. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Chen P, Price C, Li Z, Li Y, Cao D, Wiley A, He C, Gurbuxani S, Kunjamma RB, Huang H, et al: miR-9 is an essential oncogenic microRNA specifically overexpressed in mixed lineage leukemia-rearranged leukemia. Proc Natl Acad Sci USA. 110:pp. 11511–11516. 2013; View Article : Google Scholar : PubMed/NCBI | |
|
Zhao HM, Wei W, Sun YH, Gao JH, Wang Q and Zheng JH: MicroRNA-9 promotes tumorigenesis and mediates sensitivity to cisplatin in primary epithelial ovarian cancer cells. Tumour Biol. 36:6867–6873. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Guo LM, Pu Y, Han Z, Liu T, Li YX, Liu M, Li X and Tang H: MicroRNA-9 inhibits ovarian cancer cell growth through regulation of NF-kappaB1. FEBS J. 276:5537–5546. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Wang J, Yang B, Han L, Li X, Tao H, Zhang S and Hu Y: Demethylation of miR-9-3 and miR-193a genes suppresses proliferation and promotes apoptosis in non-small cell lung cancer cell lines. Cell Physiol Biochem. 32:1707–1719. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Pawlik TM and Keyomarsi K: Role of cell cycle in mediating sensitivity to radiotherapy. Int J Radiat Oncol Biol Phys. 59:928–942. 2004. View Article : Google Scholar : PubMed/NCBI | |
|
Murga M, Fernandez-Capetillo O and Tosato G: Neuropilin-1 regulates attachment in human endothelial cells independently of vascular endothelial growth factor receptor-2. Blood. 105:1992–1999. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Kawakami T, Tokunaga T, Hatanaka H, Kijima H, Yamazaki H, Abe Y, Osamura Y, Inoue H, Ueyama Y and Nakamura M: Neuropilin 1 and neuropilin 2 co-expression is significantly correlated with increased vascularity and poor prognosis in nonsmall cell lung carcinoma. Cancer. 95:2196–2201. 2002. View Article : Google Scholar : PubMed/NCBI | |
|
Yahyanejad S, Theys J and Vooijs M: Targeting Notch to overcome radiation resistance. Oncotarget. 7:7610–7628. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Zhao L, Lu X and Cao Y: MicroRNA and signal transduction pathways in tumor radiation response. Cell Signal. 25:1625–1634. 2013. View Article : Google Scholar : PubMed/NCBI |