This article is mentioned in:

Introduction

Gastric cancer is the second leading cause of cancer-associated mortalities globally and is a major cause of mortality in Asia (1–3). According to a survey in 2015, the mortality rate from gastric cancer ranked second in overall cancer mortality in China (4). Accordingly, therapeutic strategies for treating gastric cancer are in demand.

Surgery and radiotherapy form the mainstay of current therapeutic strategies for localized tumors; however, these treatments are not completely successful and subsequence tumor recurrence and metastases may occur (5). Furthermore, their high cost may be prohibitive and postoperative complications may be severe (6).

Fluorouracil (5-FU) is a classic drug used for gastric cancer treatment (7). It is generally known to exert its antitumor effects by stopping the production of DNA (8). However, numerous cases of drug resistance have been previously reported (7,8). Therefore, alternative treatment options with improved efficacy and fewer side effects are required. For this reason, 5-FU was selected as a positive control for the present study.

In recent years, there has been interest in the application of traditional Chinese medicine for the treatment of tumors (9–11). Proponents claim that ‘Lei-Wan’, the scientific term for Omphalia lapidescens, possesses medicinal activity against a variety of parasites, including roundworms, spirometra and ancylostomes (12). Numerous studies have sought to elucidate the anti-tumor effects of ‘Lei-Wan’ and its underlying molecular mechanisms (13,14). Purified Omphalia lapidescens protein (pPeOp) is a protein extracted from the sclerotium of Omphalia lapidescens by polyvinyl pyrrolidone (PVP) extraction buffer. In a previous study, it was demonstrated that pPeOp promotes apoptosis and cell cycle arrest of tumor cells (MC-4), but did not cause toxicity to normal gastric cells (MC-1) (15). Those wishing to study the underlying biology of pPeOp would have to study its influence on the intricate network of numerous regulatory molecules that govern tumor genesis.

In the present study, the ability of pPeOp to inhibit the migration of SGC-7901 gastric cancer cells was investigated. SGC-7901 cells were treated with different dosages of pPeOp, following which, the extent of apoptosis and cell cycle arrest was determined. Furthermore, the potential underlying mechanism of action of pPeOp was investigated by studying the Janus kinase (JAK)-signal transducer and activator of transcription (STAT) signaling pathway and a number of key regulatory molecules [matrix metallopeptidase (MMP)2, MMP9, cyclin D1, cyclin A2, cyclin B1, cyclin dependent kinase (CDK)1, CDK2, CDK4, B-cell lymphoma (Bcl)-2, p53 and caspase-3].

Materials and methods

pPeOp extraction and purification

The fruiting body of Omphalia lapidescens was provided by Fang Hui Chun Tang (Hangzhou, China). A total of 200 mg of the fruiting body of Omphalia lapidescens was washed three times with distilled water at 4°C and placed into 0.875 ml of cold PVP extraction buffer (15% 1.0 M Tris-HCl, pH 8.0; 2% PVP; 25% glycerol) on ice for 4 h. The samples were then centrifuged (12,000 × g, 20 min) at 4°C, and the supernatant was collected and retained for purification.

A SephadexG-50 column (GE Healthcare Life Sciences, Little Chalfont, UK), pre-equilibrated with 50 mM Tris-HCl buffer (pH 8.5), was employed to purify the sample (1 ml sample for each experiment). The absorbance was measured at 280 nm, and the flow rate was 0.2 ml/min, producing three peaks. In accordance with a previously described protocol (15), the second A280 nm peak fraction was ultrafiltrated using a Millipore ultrafiltration tube (EDM Millipore, Billerica, MA, USA). Finally, the protein was sterilized by filtration using a 0.22 µm filter, and then stored at −20°C for later use.

Cell culture

The human gastric cancer cell line SGC-7901 was provided from Zhejiang Provincial Center for Disease Control and Prevention (Zhejiang, China). SGC-7901 cells were cultured in RPMI-1640 medium (cat no. GNM31800; Hangzhou Genom Biomedical Technology Co., Ltd., Hangzhou, China; http://www.genom.com.cn/) supplemented with 5% (v/v) fetal bovine serum (cat no. 22011-8612; Zhejiang Tianhang Biotechnology Co., Ltd., Zhejiang, China), 100 U/ml penicillin and 100 µg/ml streptomycin at 37°C, 5% CO2.

Cell viability assay

Cultured SGC-7901 cells were detached with 0.25% trypsin during the logarithmic growth phase. The suspension of SGC-7901 cells containing 1×106/ml cells was seeded into a 96-well plate and incubated at 37°C with 5% CO2 for 24 h in preparation for an MTS assay. Subsequently, pPeOp (30, 60 and 90 µg/ml), 100 µg/ml5-FU (cat no. 51-21-8; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) or PVP (90 µg/ml) diluted with RPMI-1640, which had been sterilized through a 0.22 µm filter, were added to the cells and incubated for 24 h at 37°C. A CellTiter 96®AQueous One Solution Assay kit (cat no. G3580; Promega Corporation, Madison, WI, USA) was used for the MTS assay, according to the manufacture protocol. According to the manufacturer's protocol, 20 µl MTS solution (Promega Corporation) was added to each well, briefly agitated for 30 sec and incubated at 37°C for 60 min. Absorbance at 490 nm was measured using an automatic microwell plate reader (Thermo Labsystems, Helsinki, Finland). The light microscope used to visualize cells was the Nikon eclipse ti (Nikon Corporation, Tokyo, Japan) at a magnification of ×100.

Cell migration assay

Cellular migration was investigated using a wound-healing assay. SGC-7901 cells (1×106/ml) were seeded into 6-well plates and cultured under standard aforementioned conditions for ~24 h. When cells were ~80% confluent, a wound was scratched into the cell layer with a 200 µl pipette tip. Cells were then treated with 30, 60 or 90 µg/ml pPeOp, 90 µg/ml PVP or 100 µg/ml 5-FU; for 24 h at 37°C. Cells were then washed with pre-warmed PBS (37°C) to remove cell debris and allowed to migrate for 24 h prior to image capture.

Flow cytometry detection of cell cycle

SGC-7901 cells were located in 6-well plates and incubated under standard aforementioned conditions for 24 h in preparation for a cell cycle assay. Then, cells were treated with pPeOp (30, 60 or 90 µg/ml), PVP (100 µg/ml) or 5-FU (100 µg/ml) under standard aforementioned conditions for 24 h. Cultured cells were harvested with EDTA-free trypsin (0.25%) and washed twice with ice-cold PBS. Subsequently, cells (1×106 /ml) were incubated with 0.5 ml propidium iodide (PI)/RNase staining buffer (cat no. 550825; BD Biosciences, San Jose, CA, USA) for 15 min at room temperature (25°C) in the dark prior to being fixed with 1% paraformaldehyde (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) at 25°C for 30 min, and stored in 70% ethanol at −20°C for 15 min. Cell cycle progression analyses were performed using a Beckman FC500 (Beckman Coulter, Inc., Brea, CA, USA) flow cytometer with red fluorescent light at a wavelength of 488 nm. Win Cycle software (version 32; Beckman Coulter, Inc.) were used for analyses.

Flow cytometry detection of apoptosis

FITC Annexin V Apoptosis Detection kit I (cat no. 556547; BD Biosciences) was used to assay cell apoptosis. Cultured cells, subsequent to treatment with pPeOp (30, 60 or 90 µg/ml), PVP (100 µg/ml) or 5-FU (100 µg/ml) under standard aforementioned conditions for 24 h, were collected with EDTA-free trypsin (0.25%) and washed twice with ice-cold PBS. Subsequently, cells (1×106/ml) were resuspended in 100 µl 1Xbinding buffer solution (BD Biosciences), to which 5 µl of fluorescein isothiocyanate/Annexin V (BD Biosciences) and 5 µl PI (BD Biosciences) were added. Cells were then gently vortexed and incubated for 15 min at room temperature (25°C) in the dark. Incubated cells were washed again with 1X binding buffer and resuspended in 200 µl of 1X binding buffer. PI (5 µl) and 400 µl of 1X binding buffer were added to each sample, and samples were analyzed using a Beckman FC500 flow cytometer (Beckman Coulter, Inc.). The software used to analyze apoptosis was CXP analysis (version 32; Beckman Coulter, Inc.).

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) assay

MMP2, MMP9, cyclin D1, cyclin A2, cyclin B1, CDK1, CDK2, CDK4, Bcl-2, p53, caspase-3, JAK1, JAK2 and STAT3) were analyzed by RT-qPCR. In brief, cells (1×106 /ml), subsequent to treatment with pPeOp (30, 60 or 90 µg/ml), PVP (100 µg/ml) or 5-FU (100 µg/ml) under standard aforementioned conditions for 24 h, were trypsinized and total RNA was isolated using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). cDNA was synthesized using a Maxima First Strand cDNA Synthesis kit (Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol, which was used as a template for qPCR. Taq®PCR Master Mix (cat no. A6001; Promega Corporation) for qPCR, and performed using a Step One Plus Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. Data were normalized to the expression level of a GAPDH reference gene. Fold-changes in the amplified cDNA were calculated by the (2−ΔΔCq) method (16). Primer sequences used are presented in Table I. All primers were purchased from Sangon Biotech Co., Ltd. (Shanghai, China). RT-qPCR was performed using an Eppendorf Realplex-4 Real Time PCR Machine (Eppendorf, Hamburg, Germany). The PCR amplification conditions were as follows: One cycle at 95°C pre-denaturing for 2 min, followed by 40 cycles at 95°C denaturing for 15 sec, and annealing temperature of 62.9°C (GAPDH, JAK1, JAK2, STAT3, caspase-3, p53, Bcl-2), 57.8°C (MMP2, MMP9, cyclin A2, cyclin B1, cyclin D1) or 61°C (CDK1, CDK2, CDK4) for 1 min. At the end of the PCR cycle, a dissociation curve was performed with StepOne™ Software (version 2.2.2; Applied Biosystems; Thermo Fisher Scientific, Inc.) to confirm amplification of a single product. The results are represented as the fold-change in gene expression relative to GAPDH.

Table I. Specific primers used for polymerase chain reaction analysis.

Table I.

Specific primers used for polymerase chain reaction analysis.

Gene	Forward primer, 5′-3′	Reverse primer, 5′-3′	Ampl
GAPDH	TGACTTCAACAGCGACACCCA	CACCCTGTTGCTGTAGCCAAA	121
CDK1	TGCTGGGGTCAGCTCGTTACTCA	TGGGATGCTAGGCTTCCTGGTT	326
CDK2	GTGGGCCCGGCAAGATTTTAG	GCCGAAATCCGCTTGTTAGGG	378
CDK4	CTTGATCTGAGAATGGCTACCTCT	CATGAAGGAAATCTAGGCCTCTTA	682
Cyclin D1	CATCTCTGTACTTTGCTTGCTCAT	CGCTATTTCCTACACCTATTGGAC	499
Cyclin B1	TCGAGCAACATACTTTGG	GCAAAAAGCTCCTGCTGC	101
Cyclin A2	AGACCCTGCATTTGGCTGTG	ACAAACTCTGCTACTTCTGG	1,110
MMP2	TGATGGTGTCTGCTGGAAAG	GACACGTGAAAAGTGCCTTG	280
MMP9	GGAGACCTGAGAACCAATCTC	TCCAATAGGTGATGTTGTGG	1,078
Caspase-3	CATGGAAGCGAATCAATGGACT	CTGTACCAGACCGAGATGTCA	3,036
p53	TAGTGTGGTGGTGCCCTATG	CCAGTGTGATGATGGTGAGG	699
JAK1	CCTGCTGGTGGCTACTAAGA	AGATGTGTGTTCTCGTGCCT	3,262
JAK2	GCCTTCTTTCAGAGCCATCA	CCAGGGCACCTATCCTCATA	1,148
STAT3	GACATGGAGTTGACCTCGGAGTG	GGTGGCAGAATGCAGGTAGGC	103
Bcl-2	GGATTGTGGCCTTCTTTGAG	CCAAACTGAGCAGAGTCTTC	234

[i] Ampl, amplification; CDK, cyclin dependent kinase; MMP, matrix metallopeptidase; JAK, Janus kinase; STAT, signal transducer and activator of transcription; Bcl, B-cell lymphoma.

Western blotting assay

MMP2, MMP9, cyclin D1, cyclin A2, cyclin B1, CDK1, CDK2, CDK4, Bcl-2, p53, caspase-3, JAK1, JAK2 and STAT3 were analyzed by western blot analysis. Cells (1×106), subsequent to treatment with pPeOp (30, 60 or 90 µg/ml), PVP (100 µg/ml) or 5-FU (100 µg/ml) under standard aforementioned conditions for 24 h, were collected following treatment with PBS (1 ml, 30 min); centrifuged for 10 min at 200 × g and the supernatant was discarded. The pellet was then incubated with 200 µl lysis buffer (cat no. C0201; Beyotime Institute of Biotechnology, Shanghai, China) for 30 min on ice, and agitated every 10 sec. Lysates were separated using centrifugation at 4°C for 15 min at 10,000 × g, the supernatant was collected, and protein determined by BCA Protein Assay kit (cat no. KGP902; Nanjing KeyGen Biotech Co., Ltd., Nanjing, China). Protein (40 µg per lane) was loaded onto a 12% standard polyacrylamide gel and resolved by SDS-PAGE. Resolved proteins were subsequently transferred onto an Immobilon®-P Transfer Membrane (cat no. IPVH00010; Merck KGaA), saturated with 5% milk in Tris-buffered saline and 0.5% Tween-20 (TBST) at 25°C for 2 h. Antibodies against JAK1 (cat no. ab138005; 1:1,000 dilution), JAK2 (cat no. ab32101; 1:1,000 dilutions) and STAT3 (cat no. ab76315; 1:200,000 dilutions) were purchased from Abcam (Cambridge, UK). Antibodies against MMP2 (cat no. 13132; 1:1,000 dilutions), MMP9 (cat no. 3852; 1:1,000 dilutions), cyclin A2 (cat no. 4656; 1:2,000 dilutions), cyclin B1 (cat no. 4138; 1:1,000 dilutions), cyclin D1 (cat no. 2978; 1:1,000 dilutions), CDK1 (cat no. ab32384; 1:1,000 dilutions), CDK2 (cat no. 2546; 1:1,000 dilutions), CDK4 (cat no. 12790; 1:1,000 dilutions), Bcl-2 (cat no. 2870; 1:1,000 dilutions), p53 (cat no. 2527; 1:1,000 dilutions) and caspase-3 (cat no. 14220; 1:1,000 dilutions) were purchased from Cell Signaling Technology, Inc. (Danvers, MA, USA). Anti-GAPDH (cat no. YM3029; 1:5,000 dilutions), used as a control, was purchased from Immuno Way Biotechnology Company (TX, USA). Horseradish peroxidase (HRP)-conjugated goat anti-rabbit immunoglobulin G (cat no. A0208; 1:1,000 dilutions) or goat anti-mouse immunoglobulin G (cat no. A0216;1: 1,000 dilutions) were used as secondary antibodies. All secondary antibodies were purchased from the Beyotime Institute of Biotechnology. The membranes were incubated overnight with primary antibodies (described above) at 4°C. Membranes were washed three times with TBST. Membranes that were incubated with GAPDH antibodies were then incubated with goat anti-mouse IgG secondary antibody (described above), while membranes which were incubated with MMP2, MMP9, cyclin D1, cyclin A2, cyclin B1, CDK1, CDK2, CDK4, Bcl-2, p53, caspase-3, JAK1, JAK2 and STAT3 antibodies were then incubated with goat anti-rabbit IgG HRP secondary antibodies (described above) for 2 h at 4°C, and washed three times with TBST. Membranes were visualized on film in a dark room using ECL substrate solution (cat no. P0018A; Beyotime Institute of Biotechnology) and results quantified using ImageJ software (version 1.8.0; National Institutes of Health, Bethesda, MA, USA).

Statistical analyses

All experiments were conducted in triplicate. Data are presented as the mean ± standard deviation. SPSS software (version 20.0; IBM Corp., Armonk, NY, USA) was used for statistical analyses. The MTS cell viability data were subjected to one-way analysis of variance (ANOVA), followed by Fisher's least significant difference (LSD) post-hoc test. Flow cytometry-based analyses were also analyzed using one-way ANOVA, followed by Fisher's LSD. Western blot results were quantitated using Image J software and analyzed by one-way ANOVA, followed by Fisher's LSD. P<0.05 was considered to indicate a statistically significant difference.

Results

Effect of pPeOp on the viability of SGC-7901 cells

Initially, the effect of pPeOp on the proliferation of SGC-7901 gastric cancer cells was investigated. Cells treated with PVP (90 µg/ml, 24 h) maintained a normal morphology comparable to that of untreated cells (Fig. 1). However, when SGC-7901 cells were treated for 24 h with graded concentrations of pPeOp (30, 60 and 90 µg/ml), cells decreased in size and presented a spherical appearance (Fig. 1A). In addition to the morphological changes, the viability was also affected. The survival rates of cells after 24 h of treatment were as follows: PVP (100 µg/ml), 95.26±5.21%; 5-FU (100 µg/ml), 60.13±3.13%; pPeOp (30 µg/ml), 70.97±6.18%; pPeOp (60 µg/ml), 58.44±5.74%; pPeOp (90 µg/ml) 35.22±2.33%. The half maximal inhibitory concentration was 64.326 µg/ml. An increase in the concentration of pPeOp resulted in a proportional and significant increase in the rate of inhibition (P<0.05; Fig. 1B). These results suggested that pPeOp inhibits the viability of SGC-7901 cells.

Figure 1. pPeOp decreases viability of SGC-7901 cells. (A) SGC-7901 cells treated with 30, 60 or 90 µg/ml pPeOp, 90 µg/ml PVP or 100 µg/ml 5-FU for 24 h, and visualized by light microscopy. (B) Cell viability rates analyzed by MTS assay. Data were normalized to the Normal group. *P<0.05 vs. Normal control. pPeOp, purified Omphalia lapidescens protein; PVP, polyvinyl pyrrolidone; 5-FU, 5-fluorouracil.

Effect of pPeOp on the migration of SGC-7901 cells

A wound healing assay was used to assess the migration ability of SGC-7901 cells following treatment with pPeOp. As presented in Fig. 2A, compared with the normal and negative normal treatments, the migration ability of SGC-7901 cells was markedly decreased following pPeOp treatment.

Figure 2. pPeOp inhibits SGC-7901 cell migration. SGC-7901 cells were treated with 30, 60 or 90 µg/ml pPeOp, 90 µg/ml PVP or 100 µg/ml 5-FU for 24 h. (A) Effects of pPeOp on SGC-7901 cells using a wound healing assay. (B) Effects of pPeOp on the expression of the migration-associated proteins MMP2 and MMP9, using GAPDH as loading control. (C) Reverse transcription-quantitative polymerase chain reaction was used to assess cell migration-associated factors expression levels in SGC-7901 cells. All data were normalized to the Normal group. *P<0.05 vs. Normal control. pPeOp, purified Omphalia lapidescens protein; PVP, polyvinyl pyrrolidone; 5-FU, 5-fluorouracil; MMP, matrix metallopeptidase.

Invasion and metastasis of carcinomas are closely associated with extracellular matrix (ECM) degradation (17,18). MMPs are well characterized and demonstrate proteolytic activity in the ECM, and have recently emerged as key molecules involved in mediating tumor invasion and metastasis (19). Therefore, MMP2 and MMP9 were selected for further studies. MMP2 and MMP9 levels were evaluated by RT-qPCR and western blot analysis. The results demonstrated that MMP2 and MMP9 were significantly downregulated at the mRNA and protein levels compared with the normal control, in proportion to the pPeOp dosage (P<0.05; Fig. 2B and C). However, compared with the normal group, cells treated with PVP did not show any significant difference in gene or protein expression profiles (P>0.05; Fig. 2B and C). Thus, the results suggest that pPeOp inhibits the ability of SGC-7901 cells to migrate.

Effect of pPeOp on the cell cycle progression of SGC-7901 cells

The influence pPeOp has on the progression of SGC-7901 cells through the cell cycle was investigated using flow cytometry of cells post-treatment with either normal/5-FU/PVP or graded concentrations of pPeOp (Fig. 3A). The percentage of cells in G2/M phases decreased, whereas the proportion of cells in G0/G1, S phases increased in the pPeOp-treated group compared with the control (P<0.05, Fig. 3A). This suggests that pPeOp blocks DNA replication, thereby arresting cells in the S phase.

Figure 3. pPeOp arrest SGC-7901 cell cycle in the S phase. (A) SGC-7901 cells were treated with 30, 60 or 90 µg/ml pPeOp, 90 µg/ml PVP or 100 µg/ml 5-FU for 24 h and analyzed by flow cytometry. The bar graph summarizes the percentage of cells per cell cycle. (B) Western blot analysis was used to assess cell cycle-associated protein expression levels. All data were normalized to the Normal group. (C) Quantification of cycle-associated mRNA levels normalized to GAPDH. Values are presented as the mean ± standard deviation of at least three independent experiments. *P<0.05 vs. Normal control. pPeOp, purified Omphalia lapidescens protein; PVP, polyvinyl pyrrolidone; 5-FU, 5-fluorouracil; CDK, cyclin dependent kinase.

To verify the data obtained by flow cytometry, how pPeOp treatment influenced the expression of several cell cycle regulators, including cyclin A2, cyclin B1, cyclin D1, CDK1, CDK2, and CDK4 was investigated using RT-qPCR and western blot analysis. The results indicated that protein and mRNA expression levels of all six genes were significantly decreased post-treatment with pPeOp compared with the normal control (P<0.05; Fig. 3B and C). Furthermore, no significant differences were observed between untreated cells and cells treated with PVP (P>0.05; Fig. 3B and C). Collectively, these results suggest that pPeOp arrests cell cycle progression of SGC-7901 cells.

Effect of pPeOp on the apoptosis of SGC-7901 cells

Flow cytometry was used to investigate how treatment with normal/5-FU/PVP or varying dosages of pPeOp affects the proportions of SGC-7901 cells undergoing apoptosis (Fig. 4A). The results demonstrated that pPeOp treatment induced SGC-7901 cancer cells to undergo apoptosis in a dose-dependent manner. Cells treated with 5-FU (100 µg/ml for 24 h) demonstrated a high rate of apoptosis (21%; Fig. 4A). In addition, cells treated with pPeOp (90 µg/ml for 24 h) experienced a markedly increased rate of apoptosis (35.1%; Fig. 4A), surpassing that of 5-FU treatment.

Figure 4. pPeOp induced SGC-7901 cell apoptosis. (A) SGC-7901 cells treated with 30, 60, 90 µg/ml pPeOp, 90 µg/ml PVP or 100 µg/ml 5-FU for 24 h and analyzed using flow cytometry. Values are presented as the mean ± standard deviation from at least three independent experiments performed in triplicate. (B) Western blot analysis was used to assess cell apoptosis-associated expression levels in SGC-7901 cells. (C) Reverse transcription-quantitative polymerase chain reaction was used to assess apoptosis-associated expression levels in SGC-7901 cells. All data were normalized to the Normal Group. Quantification of cycle-associated proteins and mRNA levels were normalized to GAPDH. *P<0.05 vs. Normal control. pPeOp, purified Omphalia lapidescens protein; PVP, polyvinyl pyrrolidone; 5-FU, fluorouracil; PI, propidium iodide; FITC, fluorescein isothiocyanate; Bcl, B-cell lymphoma.

Subsequently, the molecular events underlying this modulation in apoptosis were investigated by determining the expression of apoptosis-associated factors, namely caspase-3, p53 and Bcl-2, at the mRNA and protein levels. The results indicated that pPeOp significantly upregulated the expression of caspase-3 and p53, and markedly downregulated the expression of Bcl-2 (P<0.05; Fig. 4B and C). There was no significant difference in the expression of these regulators between normal and PVP-treated cells (P>0.05; Fig. 4B and C). These results collectively demonstrate that pPeOp is effective for inducing SGC-7901 cells to apoptosis, superseding even a conventional chemotherapeutic agent.

Effect of pPeOp on the JAK-STAT pathway

The aforementioned experiments highlight the effects that pPeOp exhibits on a variety of important biological programs, including cell proliferation, migration, apoptosis and cell cycle progression. However, the mechanism underlying these effects remains poorly understood. According to the results of a microarray assay, numerous differentially expressed genes were detected (data not shown). Following Kyoto Encyclopedia of Genes and Genomes analysis, the JAK-STAT signaling pathway was the most notable regulated signaling pathway influenced by pPeOp proteins (data not shown). Therefore, it was hypothesized that pPeOp may exert its anti-tumor effects through its inhibition of the JAK-STAT signaling pathway in SGC-7901 human gastric cells.

In order to investigate this hypothesis, SGC-7901 cells were treated with different concentrations of pPeOp for 24 h and the expression of JAK1, JAK2 and STAT3 mRNA and proteins were explored using RT-qPCR and western blotting. The results demonstrated that the expression of JAK1, JAK2 and STAT3 mRNAs and proteins were significantly decreased post-treatment with 60 and 90 µg/ml pPeOp, compared with the control (P<0.05; Fig. 5A and B). These results provide evidence for the anti-tumor effects of pPeOp being attributed to the inhibition of JAK-STAT signaling.

Figure 5. pPeOp inhibited the JAK-STAT3 signaling pathway in SGC-7901 cells. (A) SGC-7901 cells treated with 30, 60 and 90 µg/ml pPeOp, 90 µg/ml PVP or 100 µg/ml 5-FU for 24 h, data is presented as the mean ± standard deviation for at least three independent experiments. Western blot analysis was used to assess JAK1, JAK2 and STAT3 expression levels in SGC-7901 cells. (B) Reverse transcription-quantitative polymerase chain reaction was performed to evaluate JAK1, JAK2 and STAT3 expression levels in SGC-7901 cells. Data were normalized to the Normal group. Quantification of mRNA levels was normalized to GAPDH. *P<0.05 vs. Normal control. pPeOp, purified Omphalia lapidescens protein; PVP, polyvinyl pyrrolidone; 5-FU, fluorouracil; JAK, Janus kinase; STAT, signal transducer and activator of transcription.

Discussion

Metastasis, the dissemination of cancer cells from the primary site to distant sites, is the primary contributor to the mortality of patients with cancer (20,21). The ECM, which serves as a barrier for cell invasion, is breached by MMPs in the evolution process of tumor metastasis (22). MMP9 and MMP2 have been reported to be involved in cancer metastasis due to their ability to degrade type IV collagen, a major component of the basement membrane (23). In the present study, the migration ability of SGC-7901 cells was significantly decreased, whereas MMP2 and MMP9 were significantly downregulated at the mRNA and protein levels in relation to the pPeOp dosage, compared with the control group.

Dysregulation of cell cycle control is a major hallmark underlying tumor growth and metastasis (24,25). Cyclins are a family of regulators that control the progression of the cell cycle through the activation of different CDKs. Cyclin D1, cyclin A2 and cyclin B1 facilitate the cell's progression through G0/G1, S and G2/M phases, respectively (26–28). In the present study, pPeOp was demonstrated to arrest the cell cycle in the S phase, and expression levels of cyclin A2, cyclin B1, cyclin D1, CDK1, CDK2 and CDK4 were all decreased in SGC-7901 cells, compared with control group.

Apoptosis is an adenosine 5′triphosphate-dependent and strictly regulated program, in which cells commit themselves to physiological suicide (29). Accordingly, apoptosis is essential for the elimination of excess, redundant and otherwise unhealthy cells in the maintenance of tissue homeostasis and stabilization (30,31). A number of studies have reported that p53, which is described as a ‘tumor suppressor’, regulates a variety of apoptotic signals in SGC-7901 cell (32,33). Bcl-2, an anti-apoptosis molecule, serves a critical function in controlling apoptosis (34). Caspase-3, classified as an executioner, mediates the final process of cell death (35). In the present study, pPeOp treatment induced SGC-7901 cancer cells to undergo apoptosis in a dose-dependent manner. Furthermore, the expression level of p53 and caspase-3 were significantly upregulated, and Bcl-2 were significantly downregulated, in SGC-7901 cells. In addition, the apoptosis rate of SGC-7901 cells that were treated with 90 µg/ml pPeOp group was increased compared with cells that were treated with 100 µg/ml of the conventional chemotherapeutic agent 5-FU.

The JAK-STAT signaling pathway is abnormally activated in gastric carcinoma, in which regulated gene expression is involved in cell proliferation, cell cycle, invasion, metastasis and survival (36–38). A constitutively active JAK-STAT signaling pathway has been revealed to prevent apoptosis by upregulating the expression of anti-apoptosis proteins, including Bcl-2, Bcl-extra-large, myeloid cell leukemia 1 and surviving (39–41). In addition, JAK-STAT has been demonstrated to accelerate cell cycle progression by enhancing the activity of cyclins (42,43). Masuda et al (44) and Sinibaldi et al (45) reported that inappropriate activation of STAT3 may increase expression of cyclin D1 and subsequently affect cell cycle progression. A number of studies have demonstrated that the expression of activated STAT3 modulated metastasis of tumor cells by promoting gene transcription of MMP2 and MMP9 (46,47). Therefore, inhibition of JAK-STAT is a promising strategy for cancer therapy. In the present study, levels of JAK1, JAK2, and STAT3 were significantly decreased at mRNA and protein levels.

The results of the present study suggest that pPeOp suppresses metastasis, arrests the cell cycle, induces apoptosis and inhibits JAK-STAT signaling in SGC-7901 cells. Therefore, pPeOp may be a promising agent for the treatment of gastric cancer.

Acknowledgements

The present study was supported by grants from the National Natural Science Foundation Project (grant no. 81374023), the Zhejiang Provincial Natural Science Foundation (grant no. Y207765) and the Zhejiang Provincial Medical and Health Science and Technology Project (grant nos. 2015KYA038 and 2016KYA033).

References