Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
June 2013 Volume 29 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
June 2013 Volume 29 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Ent-11α-hydroxy-15-oxo-kaur-16-en-19-oic-acid induces apoptosis and cell cycle arrest in CNE-2Z nasopharyngeal carcinoma cells

  • Authors:
    • Kefeng Wu
    • Yi Liu
    • Yingnian Lv
    • Liao Cui
    • Wende Li
    • Jianfa Chen
    • Nian Ci Liang
    • Li Li
  • View Affiliations / Copyright

    Affiliations: Guangdong Key Laboratory for Research and Development of Natural Drugs, Guangdong Medical College, Zhanjiang, Guangdong 524023, P.R. China, Department of General Surgery, 422 Hospital of PLA, Zhanjiang, Guangdong 524009, P.R. China, Institute of Biochemistry and Molecular Biology, Guangdong Medical College, Zhanjiang, Guangdong 524023, P.R. China
    Copyright: © Wu et al. This is an open access article distributed under the terms of Creative Commons Attribution License [CC BY_NC 3.0].
  • Pages: 2101-2108
    |
    Published online on: April 3, 2013
       https://doi.org/10.3892/or.2013.2375
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Ent-11α-hydroxy-15-oxo-kaur-16-en-19-oic-acid (5F), a compound isolated from Pteris semipinnata L. (PsL), inhibits cell proliferation and induces cell apoptosis in several cancer lines. We found that 5F induced apoptosis and G2 phase cell cycle arrest in the CNE-2Z nasopharyngeal carcinoma (NPC) cells, accompanied by a decrease of NF-κB expression. 5F suppressed the viability of CNE-2Z cells in a time- and dose-dependent manner. 5F induced G2/M phase cell cycle arrest, but did not induce p21. Further analysis revealed that CNE-2Z cells harbored two p53 mutations. 5F treatment resulted in mitochondrial apoptosis, associated with increased Bax/Bcl-2 ratio, upregulation of cytochrome c in the cytosol, decreased NF-κB-p65 and increased IκB. Of note, 5F significantly sensitized CNE-2Z cells to cisplatin. 5F did not increase ROS, but reduced ROS production alone or in combination with cisplatin. Our data suggest that 5F is a potential anti-NPC drug for the development of single agent therapy and therapy in combination with cisplatin.

Introduction

The incidence rate of nasopharyngeal carcinoma (NPC) in men is higher in rural than in urban China. NPC is the seventh most common cancer in men in rural areas with an incidence rate of 6.08/100,000, followed by bladder cancer, brain cancer and lymphoma (1). Despite significant advances in the therapy and early diagnosis, the prognosis of patients with stage III and IV NPC remains poor, usually due to a relatively high incidence of locoregional recurrence or metastasis (2). Thus, there is an urgent need to develop effective and safe therapeutics for this malignancy.

Ent-11α-hydroxy-15-oxo-kaur-16-en-19-oic-acid (5F) is an active compound in Pteris semipinnata L (PsL). In vitro, 5F has been shown to kill various human cancer cells including lung cancer cells, laryngeal cancer cells, thyroid carcinoma cells, gastric cancer cells and colorectal cancer cells via apoptotic pathways (3–7). Since 5F can induce apoptosis in cells of various types of cancer, it may also be a potential apoptosis-inducing drug in NPC therapy. In the present study, we examined the potential antitumor action of 5F in a human NPC cell line, CNE-2Z, and explored the possible synergism between 5F and cisplatin.

Materials and methods

Cell culture

CNE-2Z is a poorly differentiated human NPC cell line (8). CNE-2Z cells were cultured in RPMI-1640 medium (Sigma-Aldrich) containing 10% fetal bovine serum (FBS) (Sigma-Aldrich), 100 U/ml penicillin and 100 μg/ml streptomycin. Cells were cultured at 37°C in a humidified 5% CO2 incubator.

Mutational analysis of p53

Genomic DNA was extracted from CNE-2Z using a genomic DNA isolation kit (Sangon, Shanghai, China) following the manufacturer’s instructions, and quantified using a NanoDrop spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). The primers for PCR are listed in Table I. A 300 ng aliquot of genomic DNA was added to a PCR master mixture containing 1X PCR buffer (100 mM Tris-HCl, 500 mM KCl, pH 8.3), 200 μM each of deoxynucleoside triphosphate, 200 nM primer, 1.5 mM MgCl2, and 2.5 units of Taq polymerase. PCR was performed under the following cycling conditions: 4 min at 95°C, followed by 45 sec at 94°C, 45 sec at 68°C, 1 min at 72°C for 35 cycles and final extension for 8 min at 72°C. The PCR amplicons were purified with Gel/PCR DNA Fragments Extraction kit (Sangon) and sequenced with the BigDye Terminator kit (Applied Biosystems, Foster City, CA, USA) and ABI Prism 3730 DNA Analyzer (Applied Biosystems) according to the manufacturer’s instructions.

Table I

Primer sequences used to amplify p53 tumor suppressor gene.

Table I

Primer sequences used to amplify p53 tumor suppressor gene.

ExonsPrimer sequences (5′-3′)Product size (bp)
2–4F: GAAGTCTTGGGGATTTAGTGGT
R: CAAAAGCCAAGGAATACACG
1192
5–6F: GGTTGCAGGAGGTGCTTACG
R: GTTTCACCGTTAGCCAGGAT
991
7F: AGGCTGAGGAAGGAGAATGG
R: GGGTAGTAGTATGGAAGAAATCGG
406
8–9F: AGGGTGGTTGGGAGTAGATG
R: GCAGGCTAGGCTAAGCTATGAT
791
10F: GAGGCTGAGGCACAAGAATC
R: CCCTGGGTTTGGATGTTCTG
601
11F: GCAACAAGAGTGAAACTCCGT
R: TTACATCTCCCAAACATCCCT
594

[i] F, forward; R, reverse.

Ent-11α-hydroxy-15-oxo-kaur-16-en-19-oic-acid (5F)

5F was isolated from PsL as previously described (9) (Fig. 1A). 5F was dissolved in propylene glycol (PG) and diluted with the culture medium immediately prior to use (final PG concentration ≤1.2%). In all experiments, the cells in RPMI-1640 medium plus PG only were used as the control.

Figure 1

5F inhibits the growth of CNE-2Z nasopharyngeal carcinoma cells. (A) Chemical structure of 5F. The circle indicates the conjugated double bonds structure. (B) Cell viability was examined following treatment with different concentrations of 5F as indicated for 24, 48 or 72 h using MTT assay. Drug effect was expressed as percentage relative to the controls (*P<0.05, **P<0.01). (C) Morphology of the cells was examined 24 h after 5F exposure under an inverted phase contrast microscope (magnification, ×100).

Cell viability assay

CNE-2Z cells (5×103) were seeded in each well of a 96-well plate in 200 μl medium. At 24 h, the cells were exposed to 5F (0–80 μg/ml), cisplatin (10 μg/ml), or a combination of 5F (10 μg/ml) and cisplatin (10 μg/ml). Cell viability was examined after an additional 24, 48 or 72 h using MTT assay. Drug effect was expressed as percentage relative to the controls. Morphology of the cells was examined 24 h after 5F exposure under an inverted phase contrast microscope.

DAPI staining assay

Cells were fixed with 4% paraformaldehyde for 20 min, washed with PBS, and then incubated with DAPI (2 μg/ml) (Beyotime Institute Biotechnology, Haimen, China) at room temperature (RT) for 10 min. Following removal of free DAPI with PBS, cells were observed under a fluorescence microscope.

Cell cycle distribution

CNE-2Z cells were seeded at a density of 1×105 cells/well in a 6-well plate. Following treatment, cells were fixed overnight with 70% ethanol at −20°C and stained with PI solution (100 μg/ml) (Sigma-Aldrich). Cell cycle distribution analysis was performed using a flow cytometer.

Measurement of apoptosis

Following treatment, cells were harvested, washed with PBS and resuspended in 195-μl binding buffer. The samples were then incubated with 5 μl Annexin V-FITC for 15 min in the dark at 4°C and subjected to flow cytometry analysis immediately. Data acquisition and analysis were performed on a Becton-Dickinson FACSCalibur flow cytometer using CellQuest software. Caspase-3 activity was measured using Caspase-3 Colorimetric Assay kit (Nanjing KeyGen Biotech. Co., Ltd., Nanjing, China) according to the manufacturer’s instructions. Caspase-3 activity was expressed as: ODtest compound/ODcontrol.

Reactive oxygen species (ROS) generation

The intracellular ROS level was measured using a fluorescent dye DCFH-DA (ROS Assay kit, Beyotime Institute Biotechnology). Cells were exposed to 5F (0 and 10 μg/ml), cisplatin (10 μg/ml), or a combination of 5F (10 μg/ml) and cisplatin (10 μg/ml) for 3 h, and incubated in the dark with 10 μM DCFH-DA in serum-free medium for 20 min at 37°C. ROS generation was detected using a FACScan flow cytometer with the excitation and emission settings at 488 and 530 nm, respectively.

Western blot analysis

Cells were lysed on ice in SDS Lysis Buffer (Beyotime Institute Biotechnology) supplemented with protease inhibitors and phosphatase inhibitor (Roche), and 1 mM PMSF (Sigma). Cytoplasmic extract was obtained using a Cytoplasmic Protein Extraction kit (Beyotime Institute Biotechnology). The protein concentration was determined using a BCA Protein Assay kit (Beyotime Institute Biotechnology). Immunoblots of 50 μg total protein were probed with the following antibodies: cytochrome c, IκB, actin (Santa Cruz Biotechnology, Santa Cruz, CA, USA), Bcl-2, Bax (Zhongshan Golden Bridge Biotechnology, Wuhan, China), p21 (Boster Bio-Engineering Ltd., Wuhan, China), NF-κB-p65 (Phospho-Ser536) (SAB Signalway Antibody, Pearland, TX, USA). Protein bands were visualized using chemiluminescent reagents.

Statistical analysis

Data are presented as the means ± SD. The differences between the groups were examined with one-way analysis of variance (ANOVA) using the SPSS 13 software (SPSS Inc., Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

5F inhibits the proliferation of CNE-2Z NPC cells

In vitro, 5F has been shown to inhibit cell viability of various human cancer cells (3–7). To test if 5F prevents the proliferation and growth of NPC cells, we treated CNE-2Z NPC cells with different concentrations of 5F for 24, 48 or 72 h and examined the cell proliferation using a standard MTT method. 5F treatment led to a time- and dose-dependent decrease of the cell viability of CNE-2Z cells (Fig. 1B). Moreover, 5F-treated cells exhibited a rounded and granulated morphology, and were detached from culture wall after a 24-h exposure (Fig. 1C). Thus, 5F also inhibits the proliferation and growth of CNE-2Z NPC cells.

5F induces apoptosis of CNE-2Z cells

To test whether 5F inhibits the cell growth of CNE-2Z cells by inducing apoptosis, we stained 5F-treated cells with the fluorescent dye DAPI and observed nucleus changes under the fluorescence microscope. Compared with untreated cells, 5F-treated cells demonstrated bright nuclear condensation, nuclear pyknosis and apoptotic bodies, indicating that 5F induces apoptosis in CNE-2Z cells (Fig. 2A). To extend our observation, we further stained 5F-treated cells with Annexin V-FITC, an early indicator of apoptosis. As shown in Fig. 2B and C, 5F treatment of CNE-2Z cells resulted in a 5.1, 13.4, 18.9, 55 and 27.4% increase of Annexin V-positive cells at 5, 10, 20, 40 and 80 μg/ml 5F, respectively. These results clearly show that 5F induces significant apoptosis in CNE-2Z cells.

Figure 2

5F induces apoptosis of CNE-2Z cells. (A) Cells were fixed with 4% paraformaldehyde for 20 min, washed with PBS, and then incubated with DAPI (2 μg/ml) at room temperature for 10 min (magnification, ×100). (B) Following treatment with 5F for 24 h, cells were harvested, washed with PBS, resuspended in binding buffer and then incubated with Annexin V-FITC for 15 min in the dark at 4°C and subjected to flow cytometry analysis. (C) Quantification of (B). *P<0.05, **P<0.01.

Figure 5

5F downregulates the ratio of Bcl-2/Bax. (A) Cells were treated with different concentrations of 5F as indicated for 24 h. Bax and Bcl-2 proteins were measured by western blot analysis. (B) Quantification of Bcl-2 relative to actin of (A). **P<0.01. (C) Cells were treated as in (A). Effects of 5F on the release of cytochrome c from mitochondria into the cytosol were measured by western blot analysis. (D) Quantification of (C). **P<0.01.

5F induces G2 cell cycle arrest in CNE-2Z cells independently of p53-p21 axis

It has been well documented that 5F induces G2 phase of cell cycle arrest in several cell lines. To determine whether the growth-inhibitory effect of 5F in CNE-2Z cells is associated with the induction of cell cycle arrest, we analyzed the distribution of cells in the different phases of the cell cycle using flow cytometry. Following treatment with 5, 10, 20, 40 and 80 μg/ml 5F for 24 h, the percentage of cells in the G2/M phase was 11.04, 12.59, 15.48, 34.5 and 32.88%, respectively (Fig. 3A and B), indicating that 5F induces cell cycle arrest in the G2 phase in CNE-2Z cells.

Figure 3

5F induces G2 cell cycle arrest in CNE-2Z cells independently of p53-p21 axis. (A) Following treatment with 5F for 24 h, cells were fixed overnight with 70% ethanol at −20°C and stained with PI solution. Cell cycle distribution analysis was performed using a flow cytometer. (B) Representative cell cycle histogram of (A) demonstrating the percentage of the cells in the G2 phase. Compared with blank control **P<0.01). (C) Effect of 5F on p21 expression, as measured by western blot analysis. Compared with blank control (**P<0.01). (D) Quantification of (C). **P<0.01. (E) Sequencing analysis shows (arrows) a G-to-C change, at position 56 of exon 8 of the TP53 gene. (F) Sequencing analysis shows (arrows) a deletion of gggctggggacctgga in the position 16–31 of intron 3 of the TP53 gene.

To investigate the mechanism by which 5F causes the G2-phase cell cycle arrest, we examined the effects of 5F on the expression of p21, which regulates the G2-phase checkpoint (10–12). Notably, 5F significantly reduced p21 protein levels at 40 and 80 μg/ml (Fig. 3C and D). p21 is the critical downstream transcriptional target of p53, the reduction but not the increase of p21 by 5F suggests that there may be a p53 mutation in CNE-2Z cells. Therefore, we sequenced the gene of p53 of CNE-2Z cells and found two types of changes. The first was a G-to-C change, at position 56 in exon 8 (Fig. 3E), and the other was a deletion of GGGCTGGGGACCTGGA in the position 16–31 in intron 3 (Fig. 3F). Thereafter, the failure to induce p21 by 5F is likely due to the loss-of-function of p53.

5F reduces intracellular ROS levels

ROS induces endogenous DNA damages and plays an important role in apoptosis in a variety of cells. To test the possibility that 5F induces cell apoptosis and G2 phase arrest by inducing ROS generation in CNE-2Z cells, we measured intracellular ROS levels. As shown in Fig. 4A and B, 5F significantly decreased ROS generation in CNE-2Z cells for 3 h. Thus, 5F reduces intracellular ROS levels and the induction of the G2 phase might not be due to the ROS-induced DNA damages.

Figure 4

5F reduces intracellular ROS levels and sensitizes CNE-2Z cells to cisplatin. (A) Cells were exposed to 5F, cisplatin, or a combination of 5F and cisplatin for 3 h, and incubated in the dark with 10 μM DCFH-DA for 20 min at 37°C. ROS generation was detected using a FACScan flow cytometer. (B) Quantification of (A). **P<0.01. (C) Cells were treated with 5F, cisplatin, or a combination of 5F and cisplatin for 24, 48 and 72 h. MTT assays were used to check the viability. **P<0.01. (D) Cells were treated as in (A). Caspase-3 activity was measured using Caspase-3 Colorimetric assay. Caspase-3 activity was expressed as: ODtest compound/ODcontrol. *P<0.05, **P<0.01.

5F sensitizes CNE-2Z cells to cisplatin independently of its reduction of ROS

It has been reported that cisplatin cytotoxicity is mediated by increased generation of ROS. Several reports have demonstrated that cisplatin-induced cytotoxicity could be ameliorated by using antioxidants or oxygen radical scavengers (13–15). The reduction of ROS by 5F predicts that 5F may attenuate cisplatin cytotoxicity. We thus determined whether 5F antagonizes cisplatin-stimulated intracellular ROS generation. We found that cisplatin increased ROS production (Fig. 4A and B) and 5F reduced the ROS production in cisplatin-treated CNE-2Z cells, whereas 5F significantly sensitized CNE-2Z cells to cisplatin-induced cytotoxicity after 24, 48 and 72 h of treatment (Fig. 4C). Moreover, a synergistic interaction in increasing caspase-3 activity was also observed when 5F (10 μg/ml) was added to 10 μg/ml of cisplatin in CNE-2Z NPC cells (Fig. 4D). Thus, 5F sensitizes CNE-2Z cells to cisplatin via the apoptosis pathway.

5F downregulates Bcl-2 and upregulates IκBα

To elucidate the mechanism by which 5F induces apoptosis in CNE-2Z cells, we measured the protein levels of Bcl-2 and Bax. Treatment of CNE-2Z cells with 5F resulted in a dose-dependent decrease of anti-apoptotic Bcl-2 protein. By contrast, 5F did not significantly influence the expression of the pro-apoptotic Bax protein (Fig. 5A and B). Accordingly, 5F induced a dose-dependent release of cytochrome c from mitochondrion (Fig. 5C and D). These data indicated that 5F induces the activation of mitochondrial-mediated internal apoptosis pathway by downregulating Bcl-2.

Bcl-2 is regulated by nuclear factor κB (NF-κB). To test if 5F induces apoptosis by downregulating Bcl-2 through NF-κB, we examined p65, a subunit of NF-κB, and IκBα, an inhibitor of NF-κB (16). We found that the level of p65 was reduced by 5F whereas the level of IκBα was upregulated by 5F (Fig. 6). These results suggest that 5F might induce apoptosis of CNE-2Z cells by downregulating Bcl-2 by decreasing NFκB signaling.

Figure 6

5F increases IκBα and decreases NF-κB-p65. (A) Cells were treated with different concentrations of 5F as indicated for 24 h. NF-κB-p65 and IκB proteins were measured by western blot analysis. (B) Quantification of NF-κB-p65 relative to actin. **P<0.01. (C) Quantification of IκB relative to actin. **P<0.01.

Discussion

In the present study, we demonstrated that 5F significantly inhibited the proliferation of CNE-2Z cells in a dose- and time-dependent manner, and this inhibitory effect was p53 independent. Moreover, 5F induced mitochondrial-mediated apoptosis in CNE-2Z cells, accompanied by a decrease of Bcl-2 and NF-κB. Finally, we found that 5F sensitized CNE-2Z cells to cisplatin independently of its reduction of ROS. Our data suggest that 5F may be a potential anti-NPC agent.

Deregulation of cell cycle progression and evasion of apoptosis are hallmarks of cancer cells (17). Accordingly, inhibition of cell cycle progression may be particularly useful in the treatment of cancer. 5F has been demonstrated to arrest cells at the G2 phase in FRO cells (an anaplastic thyroid carcinoma cell line) and A549 cells (a non-small cell lung cancer cell line) (5,3). Consistent with these reports, the present study showed that 5F could induce G2-phase arrest in CNE-2Z cells. The G2 phase of the cell cycle is controlled by cyclin-dependent kinase 1 (CDK1) and can be inhibited by upregulation of the cyclin-dependent kinase (CDK) inhibitor p21 (18). Several studies have shown that anticancer drugs can increase the number of cells in G2/M cell cycle phases, accompanied by upregulation of p21 (19–23). Therefore, we measured the expression of p21 in CNE-2Z cells to further investigate the reason for the G2/M-phase arrest mediated by 5F. Markedly, our results showed that 5F reduced the expression of p21 in CNE-2Z cells. In fact, the functions of p21 are very complex. Despite the critical role of p21 in arresting cell cycle progression and promoting differentiation and senescence, it was shown that p21 could also promote cellular proliferation and tumorigenesis under certain conditions. Consequently, depending on the cellular context and circumstances, p21 is often deregulated in human cancer, suggesting that it can act either as a tumor suppressor or as an oncogene (24). The tumor suppressor p53 is a nuclear transcription factor that induces the expression of its numerous downstream targets including p21, leading to cell cycle arrest, senescence and apoptosis (25). In the present study, we found p53 is a mutant in CNE-2Z cells. The reduction of p21 by 5F in CNE-2Z cells may be partly due to the p53 mutation.

Previous reports have shown that several antitumor agents (such as cisplatin) arrest cell cycle at the G2/M phase, accompanied by apoptosis (26). Induction of tumor cell death by apoptosis is a major mechanism employed by antitumor agents. In the present study, we demonstrated apoptosis-inducing effects of 5F in CNE-2Z cells using DAPI staining and Annexin V-FITC staining assay. The mitochondrial-mediated apoptotic pathway contributes to apoptosis of cancer cells induced by several antitumor agents (27–29). Elevated ratio of Bax/Bcl2 is an important marker of apoptosis in several cancer cells (23,30–33). Based on the quantification of western blot signals by densitometry, an approximately 23-fold increase of Bax/Bcl2 was observed following treatment with 80 μg/ml of 5F for 24 h (Fig. 5A and B). In addition, the release of cytochrome c from mitochondria into the cytosol was also observed. These results suggest that 5F-induced apoptosis in CNE-2Z cells is mediated, at least in part, by the mitochondrial pathway. On the other hand, caspase-3 plays a pivotal role in the terminal execution phase of apoptosis (34). An increasing caspase-3 activity was observed when 10 μg/ml of 5F was added to 10 μg/ml of cisplatin in CNE-2Z cells, which suggests that the sensitization of CNE-2Z cells by 5F to cisplatin is associated with enhanced apoptosis.

The transcription factor NF-κB is an important mediator of cell cycle progression and cell survival associated with carcinogenesis (35). Upregulation of NF-κB is positively associated with poor outcome of several types of cancer, including NPC (36,37). In resting cells, NF-κB exists in the cytoplasm and is inhibited by complexing with IκB. Phosphorylation of IκB by IκB kinase (IKK) causes ubiquitination and degradation of IκB. Subsequently, NF-κB is released and translocates to the nucleus, where NF-κB regulates the transcription of a number of genes which are involved in tumorigenesis and cell growth (38,35). These findings indicate that NF-κB is a potential therapeutic target in cancer. In the present study, we investigated the effects of 5F on the pattern of NF-κB activation. Our results showed that treatment of CNE-2Z cells with 5F significantly inhibited the expression of p-NF-κB/p65 protein and degradation of IκBα protein. This study suggested that the effects of 5F on NF-κB/p65 might be through inhibition of the phosphorylation and subsequent proteolysis of IκBα.

Several antitumor agents such as cisplatin, adriamycin (ADR), bleomycin and tumor necrosis factor (TNF) have been reported to exert cytotoxic effects through ROS induction (39–42), therefore, we determined the role of ROS formation in 5F-induced cell death in CNE-2Z cells. Notably, 5F induced apoptosis and, at the same time, reduced the ROS generation in CNE-2Z cells. ROS scavenging of 5F might be related to conjugated double bonds. Cisplatin is one of the most effective chemotherapeutic agents, but has prominent side-effects such as nephrotoxicity. These side-effects are believed to be related to its ability to induce ROS production (43,44). Animal studies have indicated that antioxidants or oxygen radical scavengers could either ameliorate or protect against cisplatin toxicity (44,45). Results from the current study demonstrated that 5F possesses antioxidant properties in addition to anticancer properties. Therefore, 5F combined with cisplatin might improve cisplatin anticancer effects by reducing the cisplatin-induced ROS.

In conclusion, 5F inhibited CNE-2Z cell proliferation through cell cycle arrest at the G2/M phase and apoptosis induction related to the mitochondrial-mediated apoptotic pathway and NF-κB inhibition. Our results also indicate that 5F sensitizes CNE-2Z cells to cisplatin-induced cytotoxicity and reduces ROS production induced by cisplatin. Our previous studies in mice showed that 5F could be effective against liver and lung cancer with minimal side-effects (46,47). These results suggest 5F is a promising anti-NPC agent.

Acknowledgements

This study was supported by the National Natural Science Foundation of China (no. 3987099), the Science and Technology Innovation Fund of Guangdong Medical College (STIF201104) and the Research Committee, Guangdong Medical College (no. XB0601).

References

1 

Chen WQ, Zeng HM, Zheng RS, Zhang SW and He J: Cancer incidence and mortality in China, 2007. Chin J Cancer Res. 24:1–8. 2012. View Article : Google Scholar

2 

Chang JT, Ko JY and Hong RL: Recent advances in the treatment of nasopharyngeal carcinoma. J Formos Med Assoc. 103:496–510. 2004.

3 

Li L, Chen GG, Lu YN, Liu Y, Wu KF, Gong XL, Gou ZP, Li MY and Liang NC: Ent-11α-hydroxy-15-oxo-kaur-16-en-19-oic-acid inhibits the growth of human lung cancer A549 cells by arresting cell cycle and triggering apoptosis. Chin J Cancer Res. 24:109–115. 2012.

4 

Vlantis AC, Lo CS, Chen GG, Ci Liang N, Lui VW, Wu K, Deng YF, Gong X, Lu Y, Tong MC and van Hasselt CA: Induction of laryngeal cancer cell death by Ent-11-hydroxy-15-oxo-kaur-16-en-19-oic acid. Head Neck. 32:1506–1518. 2010. View Article : Google Scholar : PubMed/NCBI

5 

Liu ZM, Chen GG, Vlantis AC, Liang NC, Deng YF and van Hasselt CA: Cell death induced by ent-11alpha-hydroxy-15-oxo-kaur-16-en-19-oic-acid in anaplastic thyroid carcinoma cells is via a mitochondrial-mediated pathway. Apoptosis. 10:1345–1356. 2005. View Article : Google Scholar : PubMed/NCBI

6 

Liu Z, Ng EK, Liang NC, Deng YF, Leung BC and Chen GG: Cell death induced by Pteris semipinnataL. is associated with p53 and oxidant stress in gastric cancer cells. FEBS Lett. 579:1477–1487. 2005.PubMed/NCBI

7 

Chen GG, Liang NC, Lee JF, Chan UP, Wang SH, Leung BC and Leung KL: Over-expression of Bcl-2 against Pteris semipinnataL-induced apoptosis of human colon cancer cells via a NF-kappa B-related pathway. Apoptosis. 9:619–627. 2004.PubMed/NCBI

8 

Gu SY, Zhao WP, Zeng Y, Tang WP, Zhao ML, Deng HH and Li K: New human nasopharyngeal epithelial cell line established from a patient with poorly differentiated nasopharyngeal carcinoma. Chin J Cancer. 2:70–72. 1983.

9 

Deng YF and Liang NC: Study on extraction and separation of diterpenoids from Pteris semipinnata. Chin Pharm J. 39:742–744. 2004.

10 

Sherr CJ: Cancer cell cycles. Science. 274:1672–1677. 1996. View Article : Google Scholar : PubMed/NCBI

11 

Nigg EA: Cyclin-dependent protein kinases: key regulators of the eukaryotic cell cycle. Bioessays. 17:471–480. 1995. View Article : Google Scholar : PubMed/NCBI

12 

Gautier J, Solomon MJ, Booher RN, Bazan JF and Kirschner MW: cdc25 is a specific tyrosine phosphatase that directly activates p34cdc2. Cell. 67:197–211. 1991. View Article : Google Scholar : PubMed/NCBI

13 

Jiang M, Wei Q, Pabla N, Dong G, Wang CY, Yang T, Smith SB and Dong Z: Effects of hydroxyl radical scavenging on cisplatin-induced p53 activation, tubular cell apoptosis and nephrotoxicity. Biochem Pharmacol. 73:1499–1510. 2007. View Article : Google Scholar : PubMed/NCBI

14 

Kim YH, Kim YW, Oh YJ, Back NI, Chung SA, Chung HG, Jeong TS, Choi MS and Lee KT: Protective effect of the ethanol extract of the roots of Brassica rapaon cisplatin-induced nephrotoxicity in LLC-PK1cells and rats. Biol Pharm Bull. 29:2436–2441. 2006.PubMed/NCBI

15 

Satoh M, Kashihara N, Fujimoto S, Horike H, Tokura T, Namikoshi T, Sasaki T and Makino H: A novel free radical scavenger, edarabone, protects against cisplatin-induced acute renal damage in vitro and in vivo. J Pharmacol Exp Ther. 305:1183–1190. 2003. View Article : Google Scholar : PubMed/NCBI

16 

Van Waes C: Nuclear factor-kappaB in development, prevention, and therapy of cancer. Clin Cancer Res. 13:1076–1082. 2007.PubMed/NCBI

17 

Senderowicz AM: Targeting cell cycle and apoptosis for the treatment of human malignancies. Curr Opin Cell Biol. 16:670–678. 2004. View Article : Google Scholar : PubMed/NCBI

18 

Skladanowski A, Côme MG, Sabisz M, Escargueil AE and Larsen AK: Down-regulation of DNA topoisomerase IIalpha leads to prolonged cell cycle transit in G2 and early M phases and increased survival to microtubule-interacting agents. Mol Pharmacol. 68:625–634. 2005.PubMed/NCBI

19 

Cho JH, Lee JG, Yang YI, Kim JH, Ahn JH, Baek NI, Lee KT and Choi JH: Eupatilin, a dietary flavonoid, induces G2/M cell cycle arrest in human endometrial cancer cells. Food Chem Toxicol. 49:1737–1744. 2011. View Article : Google Scholar : PubMed/NCBI

20 

Castro J, Ribó M, Navarro S, Nogués MV, Vilanova M and Benito A: A human ribonuclease induces apoptosis associated with p21WAF1/CIP1induction and JNK inactivation. BMC Cancer. 11:92011. View Article : Google Scholar : PubMed/NCBI

21 

Kalimutho M, Minutolo A, Grelli S, Formosa A, Sancesario G, Valentini A, Federici G and Bernardini S: Satraplatin (JM-216) mediates G2/M cell cycle arrest and potentiates apoptosis via multiple death pathways in colorectal cancer cells thus overcoming platinum chemo-resistance. Cancer Chemother Pharmacol. 67:1299–1312. 2011. View Article : Google Scholar

22 

Huang WW, Ko SW, Tsai HY, Chung JG, Chiang JH, Chen KT, Chen YC, Chen HY, Chen YF and Yang JS: Cantharidin induces G2/M phase arrest and apoptosis in human colorectal cancer colo 205 cells through inhibition of CDK1 activity and caspase-dependent signaling pathways. Int J Oncol. 38:1067–1073. 2011.

23 

Dia VP and Mejia EG: Lunasin promotes apoptosis in human colon cancer cells by mitochondrial pathway activation and induction of nuclear clusterin expression. Cancer Lett. 295:44–53. 2010. View Article : Google Scholar : PubMed/NCBI

24 

Abbas T and Dutta A: p21 in cancer: intricate networks and multiple activities. Nat Rev Cancer. 9:400–414. 2009. View Article : Google Scholar : PubMed/NCBI

25 

Vousden KH and Prives C: Blinded by the light: the growing complexity of p53. Cell. 137:413–431. 2009. View Article : Google Scholar : PubMed/NCBI

26 

Chu G: Cellular responses to cisplatin: The roles of DNA-binding proteins and DNA repair. J Biol Chem. 269:787–790. 1994.PubMed/NCBI

27 

Malugin A, Kopecková P and Kopecek J: HPMA copolymer-bound doxorubicin induces apoptosis in ovarian carcinoma cells by the disruption of mitochondrial function. Mol Pharm. 3:351–361. 2006. View Article : Google Scholar : PubMed/NCBI

28 

Yim EK, Lee KH, Bae JS, Namkoong SE, Um SJ and Park JS: Proteomic analysis of antiproliferative effects by treatment of 5-fluorouracil in cervical cancer cells. DNA Cell Biol. 23:769–776. 2004. View Article : Google Scholar : PubMed/NCBI

29 

Boulikas T and Vougiouka M: Cisplatin and platinum drugs at the molecular level (Review). Oncol Rep. 10:1663–1682. 2003.PubMed/NCBI

30 

Lin JP, Yang JS, Lee JH, Hsieh WT and Chung JG: Berberine induces cell cycle arrest and apoptosis in human gastric carcinoma SNU-5 cell line. World J Gastroenterol. 12:21–28. 2006.PubMed/NCBI

31 

Hwang JM, Kuo HC, Tseng TH, Liu JY and Chu CY: Berberine induces apoptosis through a mitochondria/caspases pathway in human hepatoma cells. Arch Toxicol. 80:62–73. 2006. View Article : Google Scholar : PubMed/NCBI

32 

Mantena SK, Sharma SD and Katiyar SK: Berberine, a natural product, induces G1-phase cell cycle arrest and caspase-3-dependent apoptosis in human prostate carcinoma cells. Mol Cancer Ther. 5:296–308. 2006. View Article : Google Scholar : PubMed/NCBI

33 

Kuo CL, Chou CC and Yung BY: Berberine complexes with DNA in the berberine-induced apoptosis in human leukemic HL-60 cells. Cancer Lett. 93:193–200. 1995. View Article : Google Scholar : PubMed/NCBI

34 

Vaux DL and Korsmeyer SJ: Cell death in development. Cell. 96:245–254. 1999. View Article : Google Scholar

35 

Aggarwal BB: Nuclear factor-kappaB: the enemy within. Cancer Cell. 6:203–208. 2004.PubMed/NCBI

36 

Sun W, Guo MM, Han P, Lin JZ, Liang FY, Tan GM, Li HB, Zeng M and Huang XM: Id-1 and the p65 subunit of NF-κB promote migration of nasopharyngeal carcinoma cells and are correlated with poor prognosis. Carcinogenesis. 33:810–817. 2012.

37 

Zhang Y, Lang JY, Liu L, Wang J, Feng G, Jiang Y, Deng YL, Wang XJ, Yang YH, Dai TZ, Xie G, Pu J and Du XB: Association of nuclear factor κB expression with a poor outcome in nasopharyngeal carcinoma. Med Oncol. 28:1338–1342. 2011.

38 

Gupta S, Hastak K, Afaq F, Ahmad N and Mukhtar H: Essential role of caspases in epigallocatechin-3-gallate-mediated inhibition of nuclear factor kappa B and induction of apoptosis. Oncogene. 23:2507–2522. 2004. View Article : Google Scholar : PubMed/NCBI

39 

Miyajima A, Nakashima J, Yoshioka K, Tachibana M, Tazaki H and Murai M: Role of reactive oxygen species in cis-dichlorodiammineplatinum-induced cytotoxicity on bladder cancer cells. Br J Cancer. 76:206–210. 1997. View Article : Google Scholar : PubMed/NCBI

40 

Meijer C, Mulder NH, Timmer-Bosscha H, Zijlstra JG and de Vries EG: Role of free radicals in an adriamycin-resistant human small cell lung cancer cell line. Cancer Res. 47:4613–4617. 1987.PubMed/NCBI

41 

Sausville EA, Stein RW, Peisach J and Horwitz SB: Properties and products of the degradation of DNA by bleomycin and iron (II). Biochemistry. 17:2746–2754. 1978. View Article : Google Scholar : PubMed/NCBI

42 

Yamauchi N, Kuriyama H, Watanabe N, Neda H, Maeda M and Niitsu Y: Intracellular hydroxyl radical production induced by recombinant human tumor necrosis factor and its implication in the killing of tumor cells in vitro. Cancer Res. 49:1671–1675. 1989.

43 

Chirino YI and Pedraza-Chaverri J: Role of oxidative and nitrosative stress in cisplatin-induced nephrotoxicity. Exp Toxicol Pathol. 61:223–242. 2009. View Article : Google Scholar : PubMed/NCBI

44 

Rybak LP, Whitworth CA, Mukherjea D and Ramkumar V: Mechanisms of cisplatin-induced ototoxicity and prevention. Hear Res. 226:157–167. 2007. View Article : Google Scholar : PubMed/NCBI

45 

van den Berg JH, Beijnen JH, Balm AJ and Schellens JH: Future opportunities in preventing cisplatin induced ototoxicity. Cancer Treat Rev. 32:390–397. 2006.PubMed/NCBI

46 

Chen GG, Leung J, Liang NC, Li L, Wu K, Chan UP, Leung BC, Li M, Du J, Deng YF, Gong X, Lv Y, Chak EC and Lai PB: Ent-11α-hydroxy-15-oxo-kaur-16-en-19-oic-acid inhibits hepatocellular carcinoma in vitro and in vivo via stabilizing IκBα. Invest New Drugs. 30:2210–2218. 2012.

47 

Li MY, Leung J, Kong AW, Liang NC, Wu K, Hsin MK, Deng YF, Gong X, Lv Y, Mok TS, Underwood MJ and Chen GG: Anticancer efficacy of 5F in NNK-induced lung cancer development of A/J mice and human lung cancer cells. J Mol Med. 88:1265–1276. 2010. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wu K, Liu Y, Lv Y, Cui L, Li W, Chen J, Liang NC and Li L: Ent-11α-hydroxy-15-oxo-kaur-16-en-19-oic-acid induces apoptosis and cell cycle arrest in CNE-2Z nasopharyngeal carcinoma cells. Oncol Rep 29: 2101-2108, 2013.
APA
Wu, K., Liu, Y., Lv, Y., Cui, L., Li, W., Chen, J. ... Li, L. (2013). Ent-11α-hydroxy-15-oxo-kaur-16-en-19-oic-acid induces apoptosis and cell cycle arrest in CNE-2Z nasopharyngeal carcinoma cells. Oncology Reports, 29, 2101-2108. https://doi.org/10.3892/or.2013.2375
MLA
Wu, K., Liu, Y., Lv, Y., Cui, L., Li, W., Chen, J., Liang, N. C., Li, L."Ent-11α-hydroxy-15-oxo-kaur-16-en-19-oic-acid induces apoptosis and cell cycle arrest in CNE-2Z nasopharyngeal carcinoma cells". Oncology Reports 29.6 (2013): 2101-2108.
Chicago
Wu, K., Liu, Y., Lv, Y., Cui, L., Li, W., Chen, J., Liang, N. C., Li, L."Ent-11α-hydroxy-15-oxo-kaur-16-en-19-oic-acid induces apoptosis and cell cycle arrest in CNE-2Z nasopharyngeal carcinoma cells". Oncology Reports 29, no. 6 (2013): 2101-2108. https://doi.org/10.3892/or.2013.2375
Copy and paste a formatted citation
x
Spandidos Publications style
Wu K, Liu Y, Lv Y, Cui L, Li W, Chen J, Liang NC and Li L: Ent-11α-hydroxy-15-oxo-kaur-16-en-19-oic-acid induces apoptosis and cell cycle arrest in CNE-2Z nasopharyngeal carcinoma cells. Oncol Rep 29: 2101-2108, 2013.
APA
Wu, K., Liu, Y., Lv, Y., Cui, L., Li, W., Chen, J. ... Li, L. (2013). Ent-11α-hydroxy-15-oxo-kaur-16-en-19-oic-acid induces apoptosis and cell cycle arrest in CNE-2Z nasopharyngeal carcinoma cells. Oncology Reports, 29, 2101-2108. https://doi.org/10.3892/or.2013.2375
MLA
Wu, K., Liu, Y., Lv, Y., Cui, L., Li, W., Chen, J., Liang, N. C., Li, L."Ent-11α-hydroxy-15-oxo-kaur-16-en-19-oic-acid induces apoptosis and cell cycle arrest in CNE-2Z nasopharyngeal carcinoma cells". Oncology Reports 29.6 (2013): 2101-2108.
Chicago
Wu, K., Liu, Y., Lv, Y., Cui, L., Li, W., Chen, J., Liang, N. C., Li, L."Ent-11α-hydroxy-15-oxo-kaur-16-en-19-oic-acid induces apoptosis and cell cycle arrest in CNE-2Z nasopharyngeal carcinoma cells". Oncology Reports 29, no. 6 (2013): 2101-2108. https://doi.org/10.3892/or.2013.2375
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team