Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
2014-March Volume 31 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
2014-March Volume 31 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Ik6 expression provides a new strategy for the therapy of acute lymphoblastic leukemia

  • Authors:
    • Fen Zhou
    • Yunyun Xu
    • Yining Qiu
    • Xiaoyan Wu
    • Zhiquan Zhang
    • Runming Jin
  • View Affiliations / Copyright

    Affiliations: Department of Pediatrics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Hubei 430022, P.R. China
  • Pages: 1373-1379
    |
    Published online on: January 8, 2014
       https://doi.org/10.3892/or.2014.2969
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Our previous study demonstrated that the dominant-negative Ikaros isoform 6 (Ik6) is overexpressed in Chinese children with newly diagnosed B-acute lymphoblastic leukemia (B-ALL) and is strongly associated with a poor outcome. The purpose of the present study was to further explore the function of Ik6 in B-ALL. The association between Ik6 expression as detected by real-time PCR and efficacy of chemotherapy was evaluated. The effect of the alteration in Ik6 on leukemic cell lines was assessed by in vitro gain-of-function and loss-of-function techniques. PCR analysis showed that Ik6 expression was decreased when patients completed induction chemotherapy and reached complete remission. Ik6 expression was significantly increased when patients suffered relapse. Stable transfection of Ik6 into the Nalm-6 cell line revealed that Ik6 enhanced proliferation of Nalm-6 cells through the promotion of G0/G1-to-S-phase transition and enhanced chemoresistance to chemotherapeutics through anti-apoptotic effects. However, Ik6 expression did not affect the invasion of Nalm-6 cells. In contrast, silencing of Ik6 in Sup-B15 cells significantly inhibited proliferation and increased chemosensitivity. The present study suggests that Ik6 may be a biological marker of chemosensitivity and relapse and Ik6 may provide a potential therapeutic strategy for ALL.

Introduction

In spite of continuous progress in the therapy of acute lymphoblastic leukemia (ALL), relapses still occur in up to 20% of children and most adults with ALL (1–4). Moreover, the outcome of relapsed ALL patients is extremely poor (3,5,6). To improve the survival of ALL patients, it is critical to identify new molecular biomarkers such as BCR/ABL which are involved in the regulation of the malignant biological behavior of leukemia cells and are valuable in the prognosis and therapy of leukemia patients.

Ikaros is a lymphoid transcription factor that was identified as a hematological tumor suppressor (7,8). Only Ikaros isoforms that contain at least three DNA-binding zinc fingers possess functional activity, such as Ik1, Ik2 and Ik3. Isoforms lacking two or more zinc-finger domains cannot bind DNA and impair the function of Ikaros proteins in a dominant-negative manner (9). Dominant-negative Ikaros isoform 6, (Ik6), with a deletion of coding exons 3 through 6, is the most common and strongest transcriptional repressor in the Ikaros family (10–12). Ample evidence indicates that overexpression of Ik6 is associated with a poor prognosis of ALL patients (13–15). A recent study showed that the prognosis of Ph-negative patients with Ik6 was close to that of Ph-positive patients (16).

The clinical data available to date suggest that Ik6 should be evaluated as a prognostic marker for newly diagnosed ALL patients and may be involved in leukemogenesis. However, there are few studies concerning the role of Ik6 in the therapy of ALL. In the present study, in order to ascertain whether Ik6 is a marker of chemotherapeutic efficacy and is a potential therapeutic target, we investigated changes in Ik6 expression during treatment of ALL patients and assessed the effects in vitro of Ik6 expression on cell proliferation, cell cycle, chemosensitivity to vincristine (VCR), daunorubicin (DNR) and L-asparaginase (L-Asp) and invasion in ALL cell lines.

Materials and methods

Patients and samples

The 25 patients included in the present study were diagnosed with Ik6-positive B lineage ALL between January 2009 and January 2012 and were treated at Wuhan Union Hospital, in accordance with the CCLG-ALL-2008 Protocol (Children’s Cancer and Leukemia Group). All samples were bone marrow aspirates and were obtained following informed consent in strict accordance with the Declaration of Helsinki. The endpoint of the present study was January 2013, and the expression of Ik6 was measured at the point of initial diagnosis, end of induction therapy, at complete remission and at relapse.

Cell culture

Sup-B15 and Nalm-6, human B-cell precursor leukemia cell lines, were used for the study. Both cell lines were purchased from the American Type Culture Collection (ATCC) (Rockville, MD, USA) and cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS) (both from Gibco-BRL, Carlsbad, CA, USA) at 37°C in a humidified atmosphere with 5% CO2.

Overexpression or silencing of Ik6 in acute lymphoblastic leukemia cell lines

Nalm-6 cells stably overexpressing Ik6 were obtained as follows. The complete Ik6 coding sequence was amplified by PCR from Sup-B15 cells and cloned into the lentiviral expression vector pHR-SIN-CSIGW. The vector pHR-CSIGW-Ik6 and the viral packaging system (containing an optimized mixture of two packaging plasmids, pMD2.G and psPAX2) were co-transfected into 293T cells to produce competent lentivirus. The viral supernatant was harvested at 48 h post-transfection and was used to infect Nalm-6 cells. The pHR-CSIGW-mock vector was also packaged and used as a negative control. For transfection, 1×106 Nalm-6 cells were collected on day 2 and resuspended in 1 ml complete medium (RPMI-1640 medium supplemented with 10% FBS). Cells were transfected with pHR-CSIGW-Ik6 or pHR-CSIGW-mock at a multiplicity of infection (MOI) of 50 for 8 h. Then half of the above medium was replaced with 1 ml fresh medium. Thereafter, cells were cultured for another 64 h and analyzed for expression of GFP by flow cytometry. The expression of Ik6 protein was further confirmed by western blotting.

Sup-B15 cells with stably silenced Ik6 were obtained through a similar procedure. Firstly, we designed several small interfering RNAs (siRNAs) and screened the most effective one. The target sequence for Ik6 was 5′-GCTACGAGAAGG AGAACGA-3′ and the negative control sequence was 5′-TTC TCCGAACTGTCACGT-3′. Then, the small hairpin RNA (shRNA) was cloned into the self-inactivating lentiviral vector (GeneChem, Shanghai, China) containing a CMV-driven GFP reporter and a U6 promoter upstream of the cloning sites (AgeI and EcoRI).

Real-time RT-PCR assay

Total cellular RNA was extracted from cells using TRIzol reagent and converted to single-stranded cDNA using the Toyobo kit. Real-time PCR amplification was performed using the SYBR-Green Master Mix (Toyobo, Japan) and the StepOnePlus™ Real-Time PCR System (Bio-Rad, Hercules, CA, USA). The primers for Ik6, vascular endothelial growth factor (VEGF), vascular endothelial growth factor receptor (Flt-1), placenta growth factor fragment (PlGF), angiogenin-1 (Ang-1), angiogenin-2 (Ang-2), matrix metalloproteinase-2 (MMP-2) and matrix metalloproteinase-9 (MMP-9) are shown in Table I. Cycling conditions were 95°C for 30 sec followed by 40 cycles of 95°C for 10 sec and 60°C for 35 sec. The relative levels of mRNA expression were quantified by comparison with the internal control (GAPDH). All the samples were performed in triplicate, and the results were analyzed using the 2−ΔΔCt method.

Table I

Sequences of primers used in real-time PCR.

Table I

Sequences of primers used in real-time PCR.

GenePrimer sequences
Ik6F ccctgtaagcgatactccag
Rttgtcccccacgact
VEGFF atcttcaagccatcctgtgtgc
R gctcaccgcctcggcttgt
Flt-1F atcattccgaagcaaggtgtg
R aaacccatttggcacatctgt
PlGFF cacttccccctgttcttctgaa
R caagcaaatggcaaagtgtga
Ang-1F ttcctttcctttgctttcctc
R ctgcagagcgtttgtgttgt
Ang-2F aacatcccagtccacctgag
R ggtcttgctttggtccgtta
MMP-2F ggaagcatcaatcggactg
R gggcgggagaaagtagca
MMP-9F cccacttactttggaaacg
R gaagatgaatggaaatacgc
GAPDHF cctccaaggagtaagacccc
R aggggtctacatggcaactg

[i] F, forward; R, reverse; Ik6, Ikaros isoform 6; VEGF, vascular endothelial growth factor; Flt-1, vascular endothelial growth factor receptor; PlGF, placenta growth factor fragment; Ang-1, angiogenin-1; Ang-2, angiogenin-2; MMP-2, matrix metalloproteinase-2; MMP-9, matrix metalloproteinase-9.

Western blotting

Cells were lysed using a nuclear and cytoplasmic protein extraction kit (Beyotime, China) according to the manufacturer’s instructions. The extracts were centrifuged at 12,000 rpm for 15 min at 4°C, and the supernatant was collected. A BCA protein assay kit (Pierce, Rockford, IL, USA) was used to determine the protein concentrations. Samples were resolved in 10% SDS-PAGE and then transferred onto nitrocellulose membranes (Bio-Rad). After being blocked with 5% skim milk in Tris-buffered saline with 0.1% Tween-20, proteins were detected by respective antibodies using an ECL kit (Pierce) and exposed to X-ray film. Blots were visualized with a western blotting detection system (Bio-Rad).

Proliferation assay

To investigate the effects of the alteration in expression Ik6 on leukemia cells, exponentially growing cells (2×104/well) were seeded in quintuplicate in 96-well plates. After seeding for 1, 2, 3 and 4 days, the quantity of viable cells was determined. Ten microliters of CCK-8 Cell Counting Reagent (Dojindo Molecular Technologies, Inc., Japan) was added directly to each well. The plates were sequentially incubated for 4 h at 37°C, and the WST-8 formazan product was measured at 490 nm using a microplate reader (Tecan Sunrise, Switzerland). To investigate the effects of the alteration in Ik6 expression combined with chemotherapeutics on leukemia cells, cells were incubated with culture medium containing various concentrations of the chemotherapeutics [2.5 to 50 ng/ml for vincristine (VCR); 2.5 to 50 ng/ml for daunorubicin (DNR) and 0.1 to 2.5 IU/ml for L-asparaginase (L-Asp)], respectively. After allowing cells to grow for 24 h at 37°C, the viable cell population in each well was reflected by the OD values. Then the fraction of surviving cells was calculated and the IC50 was determined by nonlinear regression analysis using SPSS 11.5 software.

Cell cycle analysis

The cells (106 cells) were collected and fixed with ice-cold 70% ethanol overnight at 4°C. After washing with PBS and resuspension, fixed cells were treated with 50 μg/ml RNase A (Amresco Inc., Solon, OH, USA) for 15 min at 37°C, and then incubated with 5 μg/ml propidium iodide (Sigma Chemical Co., St. Louis, MO, USA) for 30 min at room temperature in the dark. The cell cycle distribution was detected by flow cytometry (Becton-Dickinson, Franklin Lakes, NJ, USA).

Analysis of apoptosis

The apoptosis detection kit was from KeyGen Biotech (Nanjing, China). Cells were incubated with culture medium containing final concentrations of 5.0 ng/ml VCR, 0.5 ng/ml DNR and 0.1 IU/ml L-Asp, respectively, for 24 h. Treated cells were stained with propidium iodide and Annexin V-FITC for 15 min according to the manufacturer’s instructions. The stained cells were subjected to flow cytometric analysis.

Cell migration and invasion assays

Cell migration was evaluated using an uncoated Transwell assay. Cells (2×105) were suspended in 200 μl of serum-free RPMI-1640 medium and placed in the upper chambers of the Transwell plate (Corning, Cambridge, MA, USA). RPMI medium plus 10% FBS (250 μl) and NIH3T3-conditioned medium (250 μl) were added to the lower chambers. Plates were incubated at 37°C for 8 h. The cells of the lower compartments were counted, and the rate of migration was expressed as a percentage of the total number of cells added to each well. The cell invasion assay was similar to the migration assay but a Matrigel-coated Transwell was used.

Statistical analysis

Data are presented as means ± SD. Comparisons between groups were carried out by the Student’s t-test with software SPSS 11.5. Differences were considered to be statistical significant at P<0.05.

Results

Expression of Ik6 during chemotherapy

In the 25 patients with Ik6-positive expression, 8 responded poorly to chemotherapy. Seventeen patients achieved complete remission but 8 patients of these 17 patients later suffered from relapse. After induction chemotherapy, the Ik6 expression was significantly downregulated compared with that before treatment (P<0.01). However, in the children with relapse, Ik6 expression was again increased (P<0.01) (Fig. 1). We also determined the alteration in Ik6 expression in the Sup-B15 cell line after co-culture with different chemotherapeutics. A similar result was found in that VCR, DNR and L-Asp treatment markedly decreased the Ik6 mRNA and protein expression (P<0.05) (Fig. 2).

Figure 1

Ik6 expression of 25 B-ALL children during chemotherapy. (A) Ik6 expression was decreased when patients completed induction chemotherapy (**P<0.01, n=17), or reached complete remission (**P<0.01, n=17). (B) In contrast, Ik6 expression was increased when patients suffered relapse (**P<0.01, n=8). Ik6, Ikaros isoform 6; B-ALL, B-acute lymphoblastic leukemia.

Figure 2

Effect of chemotherapeutics on the expression of Ik6 in Sup-15 cells. Treatment with VCR, DNR and L-Asp significantly decreased the (A) mRNA and (B) protein expression of Ik6 (*P<0.05, n=3) in Sup-15 cells. Ik6, Ikaros isoform 6; VCR, vincristine; DNR, daunorubicin; L-Asp, L-asparaginase.

Overexpression of Ik6 in Nalm-6 cells enhances cell proliferation and alters cell cycle distribution

Nalm-6 cells expressed GFP after being transfected with Ik6 or with the control, and GFP fluorescence was observed in almost 95% of the cells (Fig. 3A). Real-time PCR and immunoblotting showed a generally higher level of Ik6 mRNA and protein expression in Nalm-6 cells following Ik6 overexpression (Fig. 3B and C).

Figure 3

Lentiviral-mediated expression of Ik6 in Nalm-6 cells. (A) Expression of GFP in Nalm-6 cells transfected with Ik6 or control for 72 h. (B and C) The expression levels of mRNA and protein of Ik6 were confirmed by real-time RT-PCR and western blotting (***P<0.001, n=3). Ik6, Ikaros isoform 6.

After transfection with Ik6, Nalm-6/Ik6 cells exhibited increased cell proliferation compared with the Nalm-6 cells lacking the protein (Fig. 4A, P<0.05, n=5). Cell cycle results showed that Ik6-expressing Nalm-6 cells exhibited a decreased proportion of cells in the static phase (G0/G1) and an increased proportion in the synthetic (S) and mitotic phases (G2/M) of the cell cycle (Fig. 4B and C). Therefore, expression of Ik6 in Nalm-6 cells promoted cell cycle progression from the G0/G1 phase to the S and G2/M phase.

Figure 4

Ik6 overexpression promotes the proliferation of Nalm-6 cells. (A) The CCK-8 assay indicated that the percentage of viable cells in the Nalm-6/Ik6 group was significantly higher than those in the control group during the culture period (P<0.05, n=5). (B and C) The result of the cell cycle analysis showed that Nalm-6/Ik6 cells exhibited a decreased proportion of cells in the static phase (G0/G1) and an increased proportion in the synthesis (S) and mitotic phase (G2/M) of the cell cycle. (*P<0.05, **P<0.01, n=3). Ik6, Ikaros isoform 6.

Overexpression of Ik6 in Nalm-6 cells decreases sensitivity to chemotherapeutics through an anti-apoptotic effect

The effects of VCR, DNR and L-Asp on the growth of leukemia cells were evaluated, and the results indicated that the resistance to VCR, DNR and L-Asp was increased in the Ik6 transfectants. The IC50 values of VCR (34.94 vs. 20.51 ng/ml), DNR (12.25 vs. 1.89 ng/ml) and L-Asp (2.37 vs. 0.36I U/ml) were higher than that of the control (P<0.05) (Fig. 5). The results from flow cytometry and western blotting revealed that Ik6 decreased the drug-induced apoptosis together with the upregulation of the bcl-xl protein (Fig. 6A and B).

Figure 5

Ik6 overexpression enhances the chemoresistance of Nalm-6 cells. The CCK-8 assay revealed a dose-dependent growth inhibition, and the growth inhibition rate of Nalm-6/Ik6 cells was lower than that of the control cells following treatment with the same concentrations of VCR, DNR or L-Asp (P<0.05, n=5). Ik6, Ikaros isoform 6; VCR, vincristine; DNR, daunorubicin; L-Asp, L-asparaginase.

Figure 6

Ik6 overexpression decreases the drug-induced apoptosis of Nalm-6 cells. (A) The result of the flow cytometry revealed that, in contrast to the control cells, cell apoptosis induced by the drugs was markedly reduced in Nalm-6/Ik6 cells (*P<0.05, n=3). (B) Western blot analysis of apoptosis-related proteins showed that the expression of bcl-xl in Nalm-6/Ik6 cells was upregulated. Ik6, Ikaros isoform 6.

Ik6 does not affect the invasiveness of Nalm-6 cells

Real-time PCR was performed to measure the expression of genes regulating invasion, and the results revealed no significant differences in the expression levels for the mRNA coding of VEGF, Flt-1, PlGF, Ang1, Ang2, MMP-2 and MMP-9 between Nalm-6/Ik6 cells and the control (P>0.05) (Fig. 7A). In the migration and invasion assays, cells from both groups transmigrated from the upper to the lower chamber, but the quantity of cells in the lower chamber was not statistically different (P>0.05) (Fig. 7B).

Figure 7

Ik6 overexpression has no effect on the invasive ability of leukemia cells. (A) The mRNA level of genes regulating invasion, VEGF, Flt-1, PlGF, Ang-1, Ang-2, MMP-2 and MMP-9, in Nalm-6/Ik6 cells was detected by real-time RT-PCR. Using Nalm-6/mock cells as the control, the result showed that there was no differences in the expression of these genes (n=5). (B) The migration and invasion assays showed that there was no difference in migratory and invasive abilities between the Nalm-6/Ik6 cells and control cells (#P>0.05, n=3). Ik6, Ikaros isoform 6; VEGF, vascular endothelial growth factor; Flt-1, vascular endothelial growth factor receptor; PlGF, placenta growth factor fragment; Ang-1, angiogenin-1; Ang-2, angiogenin-2; MMP-2, matrix metalloproteinase-2; MMP-9, matrix metalloproteinase-9.

Silencing of Ik6 in Sup-B15 cells inhibits proliferation and increases chemosensitivity

To further confirm the effect of Ik6 on proliferation and chemosensitivity of leukemia cells, Sup-B15 cells were modified to block Ik6 expression via a lentiviral-mediated shRNA vector. As shown in Fig. 8A, Ik6 mRNA and protein expression was downregulated in the Sup-B15/Ik6 shRNA cells when compared with the control. Ik6 shRNA significantly inhibited the proliferative activity of Sup-B15 cells (Fig. 8B, P<0.05) and enhanced the chemosensitivity to VCR, DNR and L-Asp. The IC50 values of control cells to VCR, DNR and L-Asp were 2.6-, 2.9- and 3.4-fold higher than these values in the Sup-B15/Ik6 shRNA cells (P<0.05, Fig. 9).

Figure 8

Silencing of Ik6 decreases the proliferation of Sup-B15 cells. (A) Lentiviral-mediated shRNA targeting Ik6 in Sup-B15 cells. The expression of Ik6 mRNA and protein was detected by real-time RT-PCR and western blotting, respectively. (***P<0.001, n=5). (B) Silencing of Ik6 in Sup-B15 cells inhibited cell proliferation (*P<0.05, n=5). Ik6, Ikaros isoform 6; shRNA, small hairpin RNA.

Figure 9

Silencing of Ik6 enhances the chemosensitivity of Sup-B15 cells to VCR, DNR and L-Asp (P<0.05, n=5). Ik6, Ikaros isoform 6; VCR, vincristine; DNR, daunorubicin; L-Asp, L-asparaginase.

Discussion

In an effort to understand the phenomenon of leukemia relapse, several predictors of the ultimate outcome have been identified in the hopes of providing clues that may lead to more effective treatment (17,18). The Ik6 variant of the IKZF1 gene, an unfavorable prognostic marker in the outcome analysis of ALL, was independently associated with both overall survival and relapse-free survival (16). Ph/BCR-ABL was also known as a high-risk prognostic factor, but the emergence of tyrosine kinase inhibitors has significantly improved complete remission rates and the outcome of Ph-positive ALL patients (19,20). Therefore, just as Ph not only indicates risk but is also a therapeutic target, Ik6 may not only provide insight into leukemogenesis but may also lead to the establishment of new treatment strategies targeting ALL.

We previously reported that Ik6 expression in the bone marrow cells of newly diagnosed ALL patients is associated with a higher level of 33-day minimal residual disease, which indicated excessive proliferation and primary chemoresistance of leukemia cells (16). However, there have been few published data concerning the dynamic expression of Ik6 during chemotherapy. The present study demonstrated that Ik6 expression is downregulated by chemotherapeutic agents in vivo and in vitro. A high level of Ik6 mRNA expression was detected in relapsed patients. Thus, Ik6 is not only a predictor of poor prognosis at initial diagnosis but is also a marker for monitoring chemotherapeutic efficacy and relapse during treatment. Certainly, more data from Ik6-positive patients are needed to provide the relationship between the exact level of Ik6 mRNA expression and response to treatment and relapse.

To explore the potential role of Ik6 in the treatment of ALL, we evaluated the effect of Ik6 on leukemia cell growth and found that overexpression of Ik6 increased cell proliferation. The results were in accordance with these of studies on in vitro systems, which demonstrated that Ik6 transfection stimulated the proliferation of pituitary cells (21) and human CD34+ cord blood cells (22). Furthermore, Ik6-expressing cells progressed more rapidly through the cell cycle than the control cells, in as much as they peaked in the S phase earlier.

Additionally, we analyzed the role of Ik6 in leukemia cell chemosensitivity. Our study demonstrated that the overexpression of Ik6 increased the chemoresistance of leukemia cells in vitro. The Ik6-expressing Nalm-6 cells were 1.7 times more resistant to VCR, 6.5 times more resistant to DNR and 6.6 times more resistant to L-Asp. The following clinical studies support the above-mentioned results. Tonnelle et al (14) reported that the response of patients with positive expression of Ik6 to induction treatment was not favorable; 7 of 8 patients did not reach complete remission and 1 achieved remission at the end of the induction therapy. A large sample of clinical data showed that 16.07% of the patients with Ik6 did not achieve remission and 48.44% suffered from relapse (16). VCR, DNR and L-Asp are currently the first-line chemotherapeutic drugs for the treatment of pediatric ALL. All of these drugs can induce apoptosis of leukemic cells. In the present study, we found that when Ik6 expression was increased in Nalm-6 cells, following treatment with the three drugs, significantly enhanced proliferative activity of Nalm-6 cells and a decreased level of apoptosis were noted with upregulation of bcl-xl. To further confirm the role of Ik6 in therapy, we found that silencing of Ik6 significantly inhibited proliferation and sensitizes Sup-B15 cells to the chemotherapeutic agents.

As well as acquired drug resistance, extramedullary tissue infiltration of leukemic cells is a major obstacle to leukemia treatment (23). Excessive egress of leukemia cell blasts results in invasion into various organs or tissues, such as the central nervous system (CNS) and testis (24,25). The results of our studies on leukemia cell invasion indicated that there was no effect of Ik6 on the invasive ability of leukemia cells in vitro.

In the present study, we found that Ik6 may be utilized as a gene marker to predict the clinical efficacy of chemotherapy. The patients with Ik6 overexpression should receive more intensive therapy, and detection for multidrug resistance should be carried out. More importantly, Ik6 regulates the proliferation and chemosensitivity of leukemia cells, and anti-apoptosis may be the mechanism of action. Regulatory apoptosis pathways that are associated with Ik6 are a potential target for a novel strategy for the chemotherapy of ALL.

Acknowledgements

The authors would like to thank Dengli Hong and Zhen Li of the Department of Medical Stem Cell Biology of Shanghai Jiaotong University for supporting the present study. The study was supported by a grant from the National Nature Science Foundation of China (81300414).

References

1 

Pui CH, Robison LL and Look AT: Acute lymphoblastic leukaemia. Lancet. 371:1030–1043. 2008. View Article : Google Scholar : PubMed/NCBI

2 

Rivera GK, Zhou Y, Hancock ML, et al: Bone marrow recurrence after initial intensive treatment for childhood acute lymphoblastic leukemia. Cancer. 103:368–376. 2005. View Article : Google Scholar : PubMed/NCBI

3 

Fielding AK, Richards SM, Chopra R, et al: Outcome of 609 adults after relapse of acute lymphoblastic leukemia (ALL); an MRC UKALL12/ECOG 2993 study. Blood. 109:944–950. 2007. View Article : Google Scholar : PubMed/NCBI

4 

Thomas X, Boiron JM, Huguet F, et al: Outcome of treatment in adults with acute lymphoblastic leukemia: analysis of the LALA-94 trial. J Clin Oncol. 22:4075–4086. 2004. View Article : Google Scholar : PubMed/NCBI

5 

Marjerrison S, Antillon F, Fu L, et al: Outcome of children treated for relapsed acute lymphoblastic leukemia in Central America. Cancer. 119:1277–1283. 2013. View Article : Google Scholar : PubMed/NCBI

6 

Oriol A, Vives S, Hernández-Rivas JM, et al: Outcome after relapse of acute lymphoblastic leukemia in adult patients included in four consecutive risk-adapted trials by the PETHEMA Study Group. Haematologica. 95:589–596. 2010. View Article : Google Scholar : PubMed/NCBI

7 

Wang JH, Nichogiannopoulou A, Wu L, et al: Selective defects in the development of the fetal and adult lymphoid system in mice with an Ikaros null mutation. Immunity. 5:537–549. 1996. View Article : Google Scholar : PubMed/NCBI

8 

Winandy S, Wu P and Georgopoulos K: A dominant mutation in the Ikaros gene leads to rapid development of leukemia and lymphoma. Cell. 83:289–299. 1995.

9 

Rebollo A and Schmitt C: Ikaros, Aiolos and Helios: transcription regulators and lymphoid malignancies. Immunol Cell Biol. 81:171–175. 2003. View Article : Google Scholar : PubMed/NCBI

10 

Mullighan CG, Miller CB, Radtke I, et al: BCR-ABL1 lymphoblastic leukaemia is characterized by the deletion of Ikaros. Nature. 453:110–114. 2008. View Article : Google Scholar : PubMed/NCBI

11 

Iacobucci I, Lonetti A, Cilloni D, et al: Identification of different Ikaros cDNA transcripts in Philadelphia-positive adult acute lymphoblastic leukemia by a high-throughput capillary electrophoresis sizing method. Haematologica. 93:1814–1821. 2008. View Article : Google Scholar

12 

Koipally J and Georgopoulos K: A molecular dissection of the repression circuitry of Ikaros. J Biol Chem. 277:27697–27705. 2002. View Article : Google Scholar : PubMed/NCBI

13 

Mullighan CG, Su X, Zhang J, et al: Deletion of IKZF1 and prognosis in acute lymphoblastic leukemia. N Engl J Med. 360:470–480. 2009.PubMed/NCBI

14 

Tonnelle C, Imbert MC, Sainty D, Granjeaud S, N’Guyen C and Chabannon C: Overexpression of dominant-negative Ikaros 6 protein is restricted to a subset of B common adult acute lymphoblastic leukemias that express high levels of the CD34 antigen. Hematol J. 4:104–109. 2003. View Article : Google Scholar

15 

Zhou F, Mei H, Jin R, Li X and Chen X: Expression of Ikaros isoform 6 in Chinese children with acute lymphoblastic leukemia. J Pediatr Hematol Oncol. 33:429–432. 2011. View Article : Google Scholar : PubMed/NCBI

16 

Mi JQ, Wang X, Yao Y, et al: Newly diagnosed acute lymphoblastic leukemia in China (II): prognosis related to genetic abnormalities in a series of 1091 cases. Leukemia. 26:1507–1516. 2012. View Article : Google Scholar : PubMed/NCBI

17 

Harrison CJ: Cytogenetics of paediatric and adolescent acute lymphoblastic leukaemia. Br J Haematol. 144:147–156. 2009. View Article : Google Scholar : PubMed/NCBI

18 

Szczepański T, Harrison CJ and van Dongen JJ: Genetic aberrations in paediatric acute leukaemias and implications for management of patients. Lancet Oncol. 11:880–889. 2010.PubMed/NCBI

19 

Mizuta S, Matsuo K, Yagasaki F, et al: Pre-transplant imatinib-based therapy improves the outcome of allogeneic hematopoietic stem cell transplantation for BCR-ABL-positive acute lymphoblastic leukemia. Leukemia. 25:41–47. 2011. View Article : Google Scholar : PubMed/NCBI

20 

Wassmann B, Pfeifer H, Goekbuget N, et al: Alternating versus concurrent schedules of imatinib and chemotherapy as front-line therapy for Philadelphia-positive acute lymphoblastic leukemia (Ph+ALL). Blood. 108:1469–1477. 2006. View Article : Google Scholar : PubMed/NCBI

21 

Ezzat S, Zhu X, Loeper S, Fischer S and Asa SL: Tumor-derived Ikaros 6 acetylates the Bcl-XL promoter to up-regulate a survival signal in pituitary cells. Mol Endocrinol. 20:2976–2986. 2006. View Article : Google Scholar : PubMed/NCBI

22 

Suzuki K, Ono R, Ohishi K, et al: IKAROS isoform 6 enhances BCR-ABL1-mediated proliferation of human CD34+ hematopoietic cells on stromal cells. Int J Oncol. 40:53–62. 2012.PubMed/NCBI

23 

Song JH, Kim SH, Cho D, Lee IK, Kim HJ and Kim TS: Enhanced invasiveness of drug-resistant acute myeloid leukemia cells through increased expression of matrix metalloproteinase-2. Int J Cancer. 125:1074–1081. 2009. View Article : Google Scholar

24 

Suminoe A, Matsuzaki A, Hattori H, Koga Y, Ishii E and Harav T: Expression of matrix metalloproteinase (MMP) and tissue inhibitor of MMP (TIMP) genes in blasts of infant acute lymphoblastic leukemia with organ involvement. Leuk Res. 31:1437–1440. 2007. View Article : Google Scholar : PubMed/NCBI

25 

Kaddu S, Zenahlik P, Beham-Schmid C, Kerl H and Cerroni L: Specific cutaneous infiltrates in patients with myelogenous leukemia: a clinicopathologic study of 26 patients with assessment of diagnostic criteria. J Am Acad Dermatol. 40:966–978. 1999. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhou F, Xu Y, Qiu Y, Wu X, Zhang Z and Jin R: Ik6 expression provides a new strategy for the therapy of acute lymphoblastic leukemia. Oncol Rep 31: 1373-1379, 2014.
APA
Zhou, F., Xu, Y., Qiu, Y., Wu, X., Zhang, Z., & Jin, R. (2014). Ik6 expression provides a new strategy for the therapy of acute lymphoblastic leukemia. Oncology Reports, 31, 1373-1379. https://doi.org/10.3892/or.2014.2969
MLA
Zhou, F., Xu, Y., Qiu, Y., Wu, X., Zhang, Z., Jin, R."Ik6 expression provides a new strategy for the therapy of acute lymphoblastic leukemia". Oncology Reports 31.3 (2014): 1373-1379.
Chicago
Zhou, F., Xu, Y., Qiu, Y., Wu, X., Zhang, Z., Jin, R."Ik6 expression provides a new strategy for the therapy of acute lymphoblastic leukemia". Oncology Reports 31, no. 3 (2014): 1373-1379. https://doi.org/10.3892/or.2014.2969
Copy and paste a formatted citation
x
Spandidos Publications style
Zhou F, Xu Y, Qiu Y, Wu X, Zhang Z and Jin R: Ik6 expression provides a new strategy for the therapy of acute lymphoblastic leukemia. Oncol Rep 31: 1373-1379, 2014.
APA
Zhou, F., Xu, Y., Qiu, Y., Wu, X., Zhang, Z., & Jin, R. (2014). Ik6 expression provides a new strategy for the therapy of acute lymphoblastic leukemia. Oncology Reports, 31, 1373-1379. https://doi.org/10.3892/or.2014.2969
MLA
Zhou, F., Xu, Y., Qiu, Y., Wu, X., Zhang, Z., Jin, R."Ik6 expression provides a new strategy for the therapy of acute lymphoblastic leukemia". Oncology Reports 31.3 (2014): 1373-1379.
Chicago
Zhou, F., Xu, Y., Qiu, Y., Wu, X., Zhang, Z., Jin, R."Ik6 expression provides a new strategy for the therapy of acute lymphoblastic leukemia". Oncology Reports 31, no. 3 (2014): 1373-1379. https://doi.org/10.3892/or.2014.2969
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team