Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
July-2018 Volume 40 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2018 Volume 40 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Umbilical cord‑derived mesenchymal stem cells can inhibit the biological functions of melanoma A375 cells

  • Authors:
    • Wei Wang
    • Li Li
    • Fei Chen
    • Yu Yang
  • View Affiliations / Copyright

    Affiliations: Department of Pathology, West China Second University Hospital, Sichuan University, Key Laboratory of Birth Defects and Related Diseases of Women and Children, Ministry of Education, Chengdu, Sichuan 610041, P.R. China, Laboratory of Pathology, West China Hospital, Sichuan University, Chengdu, Sichuan 610041, P.R. China, Department of Medical Oncology, Cancer Center of West China Hospital, Sichuan University, Chengdu, Sichuan 610041, P.R. China
  • Pages: 511-517
    |
    Published online on: May 16, 2018
       https://doi.org/10.3892/or.2018.6446
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Tumor tropism is an important property of mesenchymal stem cells (MSCs) that has been used in tumor‑targeting therapies. However, the effects of MSCs on tumors remain controversial. The aim of the present study was to investigate the effects of MSCs on A375 melanoma cells. Umbilical cord‑derived mesenchymal stem cells (UCMSCs) were co‑cultured with A375 cells. MTT and Transwell assays were used to assess cell proliferation and invasion, while flow cytometry was performed to detect the apoptosis and the cell cycle distribution of A375 cells. The expression levels of kinases were assayed by western blotting and fluorescence analysis was conducted to detect cytoskeletal rearrangement. The results clearly indicated that UCMSCs could inhibit the proliferation, induce apoptosis and suppress the invasion of A375 cells. Mechanistic studies revealed decreased expression of several kinases (AKT, STAT3 and mTOR) and UCMSCs were also found to promote cytoskeletal rearrangement in A375 cells. These results confirmed that UCMSCs exert antitumor effects on melanoma A375 cells.

Introduction

Mesenchymal stem cells (MSCs) are multipotent progenitors that constitute a small proportion of many tissues, including bone marrow, umbilical cord, amniotic fluid, adipose tissue and fetal lung tissue (1). MSCs are described as fibroblast-like cells with the property of plastic adherence during in vitro culture. MSCs are able to differentiate into numerous cell lineages (such as adipocytes, osteoblasts, chondrocytes, tenocytes and cells of visceral mesoderm) in the presence of different conditional media (2). MSCs are positive for the expression of CD105, CD73 and CD90 markers, and negative for the expression of the co-stimulatory factors CD34, CD80, CD86 and HLA-II (3). MSCs also have immunosuppressive capabilities, meaning that they can modulate the proliferation and function of all the components of the immune system. Increasing evidence indicates that MSCs inhibit the maturation of Tregs and dendritic cells and suppress the functions of memory and naïve T cells, as well as CD4+ and CD8+ T cells. Similar effects were also observed in B cells and natural killer cells (4).

To date, MSCs are considered to be optimal candidates for use in cell therapy based on these advantages. The in vivo immunomodulatory properties of MSCs play an important role in the maintenance of peripheral tolerance and the induction of transplantation tolerance, which can protect solid-organ grafts from being rejected (5). Transfusion of MSCs in systemic lupus erythematosus patients has been revealed to improve the levels of serological markers and stabilize renal function without the occurrence of serious adverse events (6). In addition, increasing evidence indicates that MSCs are involved in various diseases, such as type I diabetes (7), liver cirrhosis (8), cerebral palsy (9) and other autoimmune diseases (10). Collectively, these studies indicate that MSCs have potentially significant clinical applications.

However, the effect of MSCs on malignant tumors has remained controversial. Certain studies have indicated that MSCs could inhibit breast tumors (11) and lung cancer (12), whereas other studies have demonstrated that MSCs promote the metastasis of pancreatic (13) and prostate cancer cells (14). In the present study, MSCs isolated from umbilical cord were co-cultured with melanoma A375 cells, and the effect of MSCs on the function of A375 cells was investigated.

Materials and methods

Cell culture

The UCMSCs were purchased from the Sichuan Umbilical Cord Blood Stem Cell Bank (Chengdu, China). Following dissolving in a 37°C water bath, UCMSCs were maintained in Dulbecco's modified Eagle's medium (DMEM; Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS; Invitrogen) at 1×105 cells/well in a 6-well plate (BD Falcon; BD Biosciences, Bedford, MA, USA). The medium was changed every two days, and adherent cells were harvested after two weeks using 0.25% trypsin (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA). Only UCMSCs passaged <6 times were used for co-culture since in our previous study (15) we observed that the differentiation of UCMSCs increased dramatically when they were passaged more than 6 times. Melanoma cells A375 [obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA)] were cultured in RPMI-1640 (Gibco; Thermo Fisher Scientific) with 10% FBS. The co-culture ratio of UCMSCs to A375 cells was 2:1.

Cell proliferation assay

Cell proliferation was assessed by an MTT assay at 24, 48 and 72 h following co-culture.

Analysis of apoptosis and cell cycle distribution by flow cytometry

An apoptosis assay was performed by incubating the cells with 3 µl Annexin V-FITC (Beyotime Institute of Biotechnology, Beijing, China) for 10 min and then counterstaining with 5 µl PI, and detecting the apoptotic cells by flow cytometry. The cell cycle distribution of the A375 cells was also assessed by flow cytometry.

RNA extraction and quantitative PCR

Total RNA was extracted from A375 cells using an RNeasy Mini kit (Qiagen, Dusseldorf, Germany) at 24, 48 and 72 h post co-culture with UCMSCs. cDNA was synthesized using a ReverTra Ace qPCR RT kit (FSQ-101; Toyobo Co., Ltd., Kagoshima, Japan) with the following transcription conditions: 65°C (5 min), 37°C (15 min) and 98°C (5 min). Real Master Mix (SYBR Green; FP202; Tiangen Biotech, Beijing, China) was used for the qPCR with an iCycler iQ™ Optical Module (Beckman Coulter, Fullerton, CA, USA) under the following conditions: 95°C for 30 sec, followed by 40 cycles at 95°C for 30 sec, 58°C for 30 sec and 72°C for 30 sec. A melt curve analysis followed, consisting of increasing temperatures from 55 to 95°C in 0.5°C increments at 10-sec intervals for 40 cycles. The primers used are listed in Table I. All amplifications were performed three times.

Table I.

List of primers in quantitative PCR detection.

Table I.

List of primers in quantitative PCR detection.

GeneForward primerReverse primerGenBank number
BCL2 CAGGTTATATCTCATCTTTGAG GTTGAGTAACGAGCTGACCCCKY098794
Survivin ACCATAACCCACCACAGC CAGTTCGTCCCTTTCCAGDQ508249
MCL1 ATTCCAGAACAGGAGTACAGCTGT CAGATGTACCCCTTGTTGTAGAGTNM_021960
Bax GACTTGAGTTGGGAGGGGAA GAGGCTCAGCGCCAGGGCTGGGKJ890756
Fas TGGCAACGCTGTCCTGTG CCTTTTGCCAGTAGATGCGAGKR709619
TNFα GGTGCTTGTTCCTCAGCCTC CAGGCAGAAGAGCGTGGTGM10988
GAPDH GAAGGTGAAGGTCGGAGTC GAAGATGGTGATGGGATTTCJ04038

[i] BCL, B-cell lymphoma; MCL, myeloid cell leukemia; TNF, tumor necrosis factor; GAPDH, glyceraldehydes-3-phosphate dehydrogenase.

Invasion assay

An invasion assay was performed using 24-well (8-µm pore size) Transwell plates (Corning, Lowell, MA, USA). The A375 cells were plated in the upper chambers, which were pre-coated with Matrigel (20%; BD Biosciences, Sparks, MD, USA), while UCMSCs were maintained in the bottom chamber. Toluidine blue (Leagene, Beijing, China)was used to stain the invaded A375 cells at 24 and 48 h post co-culture.

Western blot analysis

Collected A375 cells were washed twice with cold PBS and proteins were extracted using a protein extraction reagent (Pierce, Rockford, IL, USA) containing protease inhibitors (Roche Applied Science, Indianapolis, IN, USA). Protein concentration was assessed using the Micro BCA Protein Assay kit (Pierce). Protein samples (20 µg) were separated by 12% SDS-polyacrylamide gel electrophoresis and transferred onto nitrocellulose membranes (Invitrogen). Following blocking, the membranes were incubated with primary antibodies (Table II) followed by horseradish peroxidase-conjugated secondary antibodies (1:5,000; cat. no. ab97040; Abcam, Cambridge, UK). Antigen-antibody complexes were visualized using an enhanced chemiluminescence reagent (Amersham Biosciences, Fairfield, CT, USA).

Table II.

The antibodies used in western blot analysis.

Table II.

The antibodies used in western blot analysis.

Antibody (dilutions)Catalogue numberCompany
AKT (1:1,000)AF6261Affinity Biosciencesa
p-AKT (1:1,000)AF0016Affinity Biosciences
PI3K (1:500)AF6242Affinity Biosciences
p-PI3K (1:500)AF3241Affinity Biosciences
STAT3 (1:1,000)AF6294Affinity Biosciences
P-STAT3 (1:1,000)AF3294Affinity Biosciences
ERK (1:1,000)AF0155Affinity Biosciences
P-ERK (1:1,000)AF1015Affinity Biosciences
MTOR (1:1,000)AF6308Affinity Biosciences
P-MTOR (1:1,000)AF3310Affinity Biosciences
GAPDH (1:1,000)200608Zen BioScienceb

a Affinity Biosciences, Zhenjiang, China

b Zen BioScience Co., Ltd., Chengdu, China.

Fluorescence detection

A375 cells were maintained on glass slides and co-cultured with UCMSCs for 48 h. Primary antibodies against E-cadherin and vimentin were applied to the cells for 4 h at room temperature. Following secondary antibody staining, A375 cells were viewed under a confocal scanning microscope (Carl Zeiss, Jena, Germany)at 488 and 525 nm.

Statistical analysis

qPCR and western blotting results were analyzed with Bio-Rad CFX manager software (Bio-Rad Laboratories, Inc., Hercules, CA, USA) and Image Lab software 3.0 (Bio-Rad Laboratories), respectively. Cell cycle distribution was analyzed by ModFit 3.2 (Verity Software House, Topsham, ME, USA). All data are expressed as the mean ± standard error using Student's t-test. SPSS 19.0 (IBM SPSS Statistics, Armonk, NY, USA) was used for statistical analysis. Values of P<0.05 and P<0.01 were considered to indicate statistically significant differences compared with the control group. All figures were generated with GraphPad Prism 5 (GraphPad Software, Inc., La Jolla, CA, USA).

Results

Apoptosis of A375 cells can be induced by UCMSCs

Flow cytometry was performed to detect the occurrence of apoptosis in A375 cells co-cultured with UCMSCs. The results indicated no obvious variation in the apoptotic rate between the A375 monoculture and A375+MSC co-culture groups at 24 h (4.5 vs. 3.7%, respectively) or 48 h (1.6 vs. 2.1%, respectively). However, the apoptotic rate increased markedly in the A375+MSC co-culture group (21.4%) compared with the A375 monoculture group (5.3%) at 72 h (Fig. 1A).

Figure 1.

The apoptosis detection of A375 cells co-cultured with UCMSCs. (A) Flow cytometry for the apoptosis assay. (B) Real-time PCR detection of apoptosis-associated molecules. *P<0.05, **P<0.01 vs. the control. UCMSCs, umbilical cord-derived mesenchymal stem cells.

qPCR was then used to detect the levels of apoptosis-associated molecules in the different groups. Among the apoptosis-promoting factors, the expression of Bax was found to be increased at 72 h (P<0.05) while Fas was markedly increased at 48 h (P<0.01) and 72 h (P<0.05) post co-culture compared with the A375 monoculture group. TNF-α was also found to be increased at 48 and 72 h (both P<0.05) in the presence of UCMSCs. We also investigated three anti-apoptotic molecules: BCL2 was suppressed at 48 and 72 h (both P<0.05) while the expression of MCL1 was inhibited at 24 h (P<0.05), 48 h (P<0.05) and 72 h (P<0.01) post co-culture. Survivin was only decreased after 72 h (P<0.05) (Fig. 1B). Our results indicated that UCMSCs could induce apoptosis in A375 cells.

UCMSCs inhibit the proliferation of A375 cells, however, have no effect on the cell cycle

Subsequently, we detected whether the proliferation and the cell cycle of A375 cells could be influenced by UCMSCs. In the MTT assay, the proliferation did not significantly differ between the A375 monoculture and the A375+UCMSCs co-culture groups at 24 and 48 h. However, the proliferation of A375 cell was markedly inhibited (P<0.01) at 72 h post co-culture with UCMSCs (Fig. 2A). Flow cytometry was then used to assess the cell cycle distribution in various groups of A375 cells. The results indicated that UCMSCs had no effect on the cell cycle at 48 or 72 h post co-culture (Fig. 2B and C).

Figure 2.

Proliferation and cell cycle assay by flow cytometry. (A) Proliferation assay by MTT. (B) Cell cycle detection (C). Cell cycle analysis. **P<0.01 vs. the control.

UCMSCs suppress the invasive ability of A375 cells

As invasion is another important property of malignant tumor cells, we investigated the influence of UCMSCs on the invasive ability of A375 cells in a Transwell chamber pre-coated with Matrigel. As displayed in Fig. 3, the invaded cell numbers showed no obvious difference between the A375 and A375+MSC groups at 24 h post co-culture. However, the invasion of the A375 cells was significantly suppressed in the presence of UCMSCs after 48 h of co-culture.

Figure 3.

Detection of the invasion of A375 cells co-cultured with UCMSCs. Magnification, ×100. UCMSCs, umbilical cord-derived mesenchymal stem cells.

UCMSCs inhibit the expression of several AKT/STAT3/PI3K/mTOR pathway components in A375 cells

To identify the mechanism by which the functions of A375 cells were attenuated by UCMSCs, western blotting was performed to detect the protein expression of several important kinases at 48 and 72 h post co-culture. We found that all tested kinases (AKT/p-AKT, PI3K/p-PI3K, STAT3/p-STAT3, ERK/p-ERK and mTOR), except ERK (P<0.05), demonstrated no significant variation between the A375 monoculture and A375+MSC co-culture groups at 48 h (Fig. 4). Following 72 h of co-culture, UCMSCs led to the downregulation of the expression of AKT (P<0.05), p-AKT (P<0.01), p-PI3K (P<0.05), p-STAT3 (P<0.01), ERK (P<0.01), p-ERK (P<0.05), mTOR (P<0.05) and p-mTOR (P<0.05) (Fig. 4). These results indicated the important role of the AKT/STAT3/PI3K/mTOR pathway in the regulation of the function of A375 cells by UCMSCs.

Figure 4.

Expression of kinases of A375 cells co-cultured with UCMSCs. (A) Western blot analysis. (B) Data analysis. *P<0.05, **P<0.01 vs. the control. UCMSCs, umbilical cord-derived mesenchymal stem cells.

UCMSCs promote cytoskeletal remodeling in A375 cells

The invasion of malignant tumor cells involves decreased adherence and enhanced migration properties, and these changes are part of the epithelial-mesenchymal transition (EMT) (16). During the EMT process, cytoskeletal molecules (including E-cadherin, N-cadherin, laminin and vimentin) play important regulatory roles (17). In the present study, we detected the occurrence of cytoskeletal rearrangement by staining for E-cadherin and vimentin at 48 h post co-culture with UCMSCs. The results indicated that the cytoskeletal rearrangement was obvious in the A375+MSC co-culture group compared with the A375 monoculture group (Fig. 5), indicating that in the presence of UCMSCs, the invasion of A375 cells may be regulated by certain cytoskeletal molecules.

Figure 5.

Cytoskeletal rearrangement of the A375 cells co-cultured with UCMSCs. Magnification, ×100. UCMSCs, umbilical cord-derived mesenchymal stem cells.

Discussion

In the present study, we co-cultured melanoma A375 cells with MSCs isolated from umbilical cord to study the role of UCMSCs in regulating the functions of A375 cells. Although UCMSCs had no effect on the cell cycle of A375 cells, this study clearly indicated that UCMSCs inhibited the cell proliferation and invasion, as well as induced the apoptosis of A375 cells. In the mechanistic analysis, the expression levels of AKT/PI3K/STAT3/mTOR pathway components were downregulated following UCMSC co-culture. Furthermore, marked cytoskeletal rearrangement was observed in the A375+UCMSC co-culture group. Collectively, these results confirmed that UCMSCs can exert an antitumor effect on A375 melanoma cells.

The effect of MSCs on malignant tumor cells remains controversial. The reported discrepancies may be due to the heterogeneity of MSCs or the timing and dose of MSC treatments, or the involvement of other unknown molecules and mechanisms. Liu et al (18) reported that UCMSCs could inhibit the growth of human cholangiocarcinoma HCCC-9810 cells in xenograft models, and that UCMSC-conditioned medium suppressed cell proliferation (inhibition rate: 6.21 vs. 49.86%) and induced cell apoptosis (9.3 vs. 48.1%) in a dose- and time-dependent manner. In an immunoblot analysis, the same authors also found that p-PDK1, p-AKT, β-catenin, cyclin-D1 and c-Myc mediated the functional changes of HCCC-9810 cells induced by UCMSCs (18). In another study, pancreatic cancer cells were co-implanted with MSCs in NOD/SCID mice, and it was demonstrated that MSC-derived myofibroblast-like cells could maintain the stemness of tumor-initiating stem cells among pancreatic cancer cells. The mechanistic analysis indicated that the Notch-signaling pathway appeared to contribute to the regulation of stemness by MSCs (13). Wang et al (19) explored the effect of the fusion of MSCs with esophageal carcinoma cells, and observed that MSCs markedly decreased tumor cell growth, increased apoptosis and suppressed tumorigenicity. They also observed that the expression of DUSP6/MKP3 in the MAPK pathway increased and the exogenous overexpression confirmed the growth suppression. Sun et al (20) engineered MSCs stably transfected with TNF-related apoptosis-inducing ligand (TRAIL) and co-cultured them with hepatoblastoma HepG2 cells directly, or applied MSC-conditioned media to the HepG2 cells. The survival rate of HepG2 cells was markedly decreased by the co-culture conditions, and TRAIL was indicated to serve an important role in promoting cell death. All of these studies revealed the uncertainty regarding the effect of MSCs on malignant tumors.

However, the present study clearly demonstrated the antitumor effect of MSCs on A375 melanoma cells in a co-culture system. We not only observed inhibition of proliferation, induction of apoptosis and suppression of invasion, but also further investigated the possible mechanism of the MSC-mediated antitumor effect. Certain important kinases (including AKT, PI3K and STAT3) were downregulated in A375 cells upon MSC co-culture, and this finding was consistent with previous research. Of note was the observation of the rearrangement of the cytoskeleton of A375 cells co-cultured with MSCs. Based on this, we hypothesized that MSCs could inhibit tumor invasiveness by regulating the EMT. However, further research is required to confirm this hypothesis. The limitation of the present study was that only one cell line was included, since this was just a preliminary study concerning the role of UCMSCs in regulating malignant tumor functions. Our following study will include tumor cell lines from lung, cervical, breast and prostate cancer.

Acknowledgements

The authors thank the professor Li Zhang (Laboratory of Pathology, West China Hospital, Sichuan University) for his continuous support to this work.

Funding

The present study was supported by Sichuan Province Science and Technology Support Program (nos. 2014SZ0206 and 2014SZ0001).

Availability of data and materials

The datasets used during the study are available from the corresponding author upon reasonable request.

Authors' contributions

WW carried out fluorescence detection, statistical analysis and drafted the manuscript. LL was responsible for completing all the cell related experiments. FC carried out PCR experiments and western blot analysis. YY conceived of the study and participated in its design and coordination and helped to draft the manuscript. All authors read and approved the manuscript and agree to be accountable for all aspects of the research in ensuring that the accuracy or integrity of any part of the work are appropriately investigated and resolved.

Ethics approval and consent to participate

All experimental protocols have been approved by the Ethics Committee of West China Hospital, Sichuan University (Chengdu, China).

Consent for publication

Not applicable.

Competing interests

The authors state that they have no competing interests.

Authors' information

WW is a professor of the Department of Pathology, West China Second University Hospital, Chengdu. LL is a laboratory director at the Laboratory of Pathology, West China Hospital, Sichuan University, Chengdu. FC is an assistant laboratory director at the Laboratory of Pathology, West China Hospital, Sichuan University, Chengdu. YY is a professor of the Department of Medical Oncology, Cancer Center of West China Hospital, Sichuan University, Chengdu, P.R. China.

References

1 

Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, Moorman MA, Simonetti DW, Craig S and Marshak DR: Multilineage potential of adult human mesenchymal stem cells. Science. 284:142–147. 1999. View Article : Google Scholar

2 

Phinney DG and Prockop DJ: Concise review: Mesenchymal stem/multipotent stromal cells: The state of transdifferentiation and modes of tissue repair-current views. Stem Cells. 25:2896–2902. 2007. View Article : Google Scholar : PubMed/NCBI

3 

Bassi EJ, Aita CA and Camara NO: Immune regulatory properties of multipotent mesenchymal stromal cells: Where do we stand? World J Stem Cell. 3:1–8. 2011. View Article : Google Scholar

4 

Shi M, Liu ZW and Wang FS: Immunomodulatory properties and therapeutic application of mesenchymal stem cells. Clin Exp Immunol. 164:1–8. 2011. View Article : Google Scholar : PubMed/NCBI

5 

Sensebe L, Krampera M, Schrezenmeier H, Bourin P and Giordano R: Mesenchymal stem cells for clinical application. Vox Sang. 98:93–107. 2010. View Article : Google Scholar : PubMed/NCBI

6 

Sun L, Wang D, Liang J, Zhang H, Feng X, Wang H, Hua B, Liu B, Ye S, Hu X, et al: Umbilical cord mesenchymal stem cell transplantation in severe and refractory systemic lupus erythematosus. Arthritis Rheum. 62:2467–2475. 2010. View Article : Google Scholar : PubMed/NCBI

7 

Wang HS, Shu JF, Shen WS, Hsu HC, Chi TC, Chen CP, Huang SW, Shyr YM, Tang KT and Chen TH: Transplantation of insulin-producing cells derived from umbilical cord stromal mesenchymal stem cells to treat NOD mice. Cell Trnsplant. 20:455–466. 2011. View Article : Google Scholar

8 

Zhang Z, Lin H, Shi M, Xu R, Fu J, Lv J, Chen L, Lv S, Li Y, Yu S, et al: Human umbilical cord mesenchymal stem cells improve liver function and ascites in decompensated liver cirrhosis patients. J Gastroenterol Hepaol. 27 Suppl 2:S112–S120. 2012. View Article : Google Scholar

9 

Wang J, Yin Z, Wen H, Wang L and Chen Z: Application of umbilical cord mesenchymal stem cells in cerebral palsy treatment: Report of 51 cases. Chinse Gen Pract. 14:2446–2447. 2011.

10 

Liu Y, Mu R, Wang S, Long L, Liu X, Li R, Sun J, Guo J, Zhang X, Guo J, et al: Therapeutic potential of human umbilical cord mesenchymal stem cells in the treatment of rheumatoid arthritis. Arthritis Res Ther. 12:R2102010. View Article : Google Scholar : PubMed/NCBI

11 

Ma Y, Hao X, Zhang S and Zhang J: The in vitro and in vivo effects of human umbilical cord mesenchymal stem cells on the growth of breast cancer cells. Breast Cancer Res Treat. 133:473–485. 2012. View Article : Google Scholar : PubMed/NCBI

12 

Matsuzuka T, Rachakatla RS, Doi C, Maurya DK, Ohta N, Kawabata A, Pyle MM, Pickel L, Reischman J, Marini F, et al: Human umbilical cord matrix-derived stem cells expressing interferon-beta gene significantly attenuate bronchioloalveolar carcinoma xenografts in SCID mice. Lung Cancer. 70:28–36. 2010. View Article : Google Scholar : PubMed/NCBI

13 

Kabashima-Niibe A, Higuchi H, Takaishi H, Masugi Y, Matsuzaki Y, Mabuchi Y, Funakoshi S, Adachi M, Hamamoto Y, Kawachi S, et al: Mesenchymal stem cells regulate epithelial-mesenchymal transition and tumor progression of pancreatic cancer cells. Cancer Sci. 104:157–164. 2013. View Article : Google Scholar : PubMed/NCBI

14 

Zhang T, Lee YW, Rui YF, Cheng TY, Jiang XH and Li G: Bone marrow-derived mesenchymal stem cells promote growth and angiogenesis of breast and prostate tumors. Stem Cell Res Ther. 4:702013. View Article : Google Scholar : PubMed/NCBI

15 

Yang Y, Wang Y, Li L, Chen F and Zhang P: Activation of the Toll-like receptor 8 pathway increases the immunogenicity of mesenchymal stem cells from umbilical cord. Mol Med Rep. 16:2061–2068. 2017. View Article : Google Scholar : PubMed/NCBI

16 

Thiery JP: Epithelial-mesenchymal transition in tumor progression. Nat Rev Cancer. 2:442–454. 2002. View Article : Google Scholar : PubMed/NCBI

17 

Kalluri R and Weinberg RA: The basics of epithelial-mesenchymal transition. J Clin Invest. 119:1420–1428. 2009. View Article : Google Scholar : PubMed/NCBI

18 

Liu J, Han GQ, Liu H and Qin C: Suppression of cholangiocarcinoma cell growth by human umbilical cord mesenchyaml stem cells: A possible role of wnt and Akt signaling. PLoS One. 8:e628442013. View Article : Google Scholar : PubMed/NCBI

19 

Wang Y, Fan H, Zhou B, Ju Z, Yu L, Guo L, Han J and Lu S: Fusion of human umbilical cord mesenchymal stem cells with esophageal carcinoma cells inhibits the tumorigenecity of esophageal carcinoma cells. Int J Oncol. 40:370–377. 2012.PubMed/NCBI

20 

Sun XY, Nong J, Qin K, Lu H, Moniri MR, Dai LJ and Warnock GL: MSC (TRAIL)-mediated HepG2 cell death in direct and indirect co-culture. Anticancer Res. 31:3705–3712. 2011.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang W, Li L, Chen F and Yang Y: Umbilical cord‑derived mesenchymal stem cells can inhibit the biological functions of melanoma A375 cells. Oncol Rep 40: 511-517, 2018.
APA
Wang, W., Li, L., Chen, F., & Yang, Y. (2018). Umbilical cord‑derived mesenchymal stem cells can inhibit the biological functions of melanoma A375 cells. Oncology Reports, 40, 511-517. https://doi.org/10.3892/or.2018.6446
MLA
Wang, W., Li, L., Chen, F., Yang, Y."Umbilical cord‑derived mesenchymal stem cells can inhibit the biological functions of melanoma A375 cells". Oncology Reports 40.1 (2018): 511-517.
Chicago
Wang, W., Li, L., Chen, F., Yang, Y."Umbilical cord‑derived mesenchymal stem cells can inhibit the biological functions of melanoma A375 cells". Oncology Reports 40, no. 1 (2018): 511-517. https://doi.org/10.3892/or.2018.6446
Copy and paste a formatted citation
x
Spandidos Publications style
Wang W, Li L, Chen F and Yang Y: Umbilical cord‑derived mesenchymal stem cells can inhibit the biological functions of melanoma A375 cells. Oncol Rep 40: 511-517, 2018.
APA
Wang, W., Li, L., Chen, F., & Yang, Y. (2018). Umbilical cord‑derived mesenchymal stem cells can inhibit the biological functions of melanoma A375 cells. Oncology Reports, 40, 511-517. https://doi.org/10.3892/or.2018.6446
MLA
Wang, W., Li, L., Chen, F., Yang, Y."Umbilical cord‑derived mesenchymal stem cells can inhibit the biological functions of melanoma A375 cells". Oncology Reports 40.1 (2018): 511-517.
Chicago
Wang, W., Li, L., Chen, F., Yang, Y."Umbilical cord‑derived mesenchymal stem cells can inhibit the biological functions of melanoma A375 cells". Oncology Reports 40, no. 1 (2018): 511-517. https://doi.org/10.3892/or.2018.6446
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team