Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Biomedical Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9434 Online ISSN: 2049-9442
Journal Cover
September-2015 Volume 3 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2015 Volume 3 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Beneficial effects of protease preparations derived from Aspergillus on the colonic luminal environment in rats consuming a high-fat diet

  • Authors:
    • Yongshou Yang
    • Novita Vivi Sitanggang
    • Norihisa Kato
    • Junji Inoue
    • Takayuki Murakami
    • Toshiro Watanabe
    • Takafumi Iguchi
    • Yukako Okazaki
  • View Affiliations / Copyright

    Affiliations: Graduate School of Biosphere Science, Hiroshima University, Higashi‑Hiroshima 739‑8528, Japan, Ahjikan Co., Ltd., Hiroshima 733‑8677, Japan, Technology Development Laboratory, Yaegaki Bio‑Industry Incorporated, Himeji 679‑4298, Japan, Faculty of Human Life Sciences, Fuji Women's University, Ishikari, Hokkaido 061‑3204, Japan
  • Pages: 715-720
    |
    Published online on: July 15, 2015
       https://doi.org/10.3892/br.2015.490
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The present study investigated the effects of the dietary addition of the protease preparations derived from Aspergillus on the colonic luminal environment. Rats were fed a 30% beef tallow diet with or without the protease preparations, including Amano protease (protease A ‘Amano SD’, neutral proteases from Aspergillus spp.) or orientase (orientase AY, acid proteases from Aspergillus niger) at the dose of 0.2% for 3 weeks. Cecal Bifidobacterium was significantly elevated in the dietary Amano protease group (194‑fold, P<0.05), but not in the orientase group. Lactobacillus was elevated in the two groups (P<0.05). Cecal n‑butyrate, propionate and lactate were higher in the Amano protease and orientase groups compared with the controls (P<0.05). Fecal immunoglobulin A and mucins were elevated in the Amano protease group (P<0.05). These results suggest the potential effect of the consumption of Aspergillus‑derived protease preparations that are favorable for the colonic luminal environment in rats fed a high-fat diet.

Introduction

Prebiotics, such as dietary fiber and oligosaccharides, contribute to the improvement of human health. Numerous attempts to promote health by prebiotics aim to selectively increase colonic bacterial groups, mainly Bifidobacterium. Increasing evidence indicates that Bifidobacterium improve the colonic luminal environment. Elevated levels of colonic Bifidobacterium are associated with increased colonic production of organic acids, such as butyrate and propionate (1); butyrate is an important energy source in the colonic epithelium that regulates cell growth and differentiation in healthy colon cells, and increases mucin production, which contributes to intestinal barrier function and induces apoptosis in tumor cells (2,3). Furthermore, the administration of certain Bifidobacterium species, such as Bifidobacterium bifidum (B. bifidum), can enhance intestinal immunoglobulin A (IgA), which is an indicator of intestinal immune function (4).

Our previous study developed a method for producing Aspergillus awamori-fermented burdock. Burdock is traditionally consumed as a root vegetable or herbal medicine in Asia, Europe and North America. It is rich in dietary fibers and has been studied extensively due to its prebiotic effects (5). A high-fat (HF) diet decreases the levels of colonic probiotics and organic acids, and it is believed to elevate the risk of colon cancer (6). Notably, our previous study reported that the consumption of dietary Aspergillus awamori-fermented burdock markedly increased the levels of cecal Bifidobacterium and organic acids, including lactate, propionate, acetate and butyrate, and fecal IgA and mucins (index of colonic barrier function) compared to burdock powder in rats fed an HF diet (7). Our previous study indicated that consumption of the water-soluble fraction of Aspergillus awamori-fermented burdock markedly increases cecal Bifidobacterium levels (unpublished data); this fraction of Aspergillus awamori-fermented burdock contains extracellular neutral and acid proteases of Aspergillus awamori. Accordingly, we hypothesize that the beneficial effect of Aspergillus awamori-fermented burdock on colonic health is derived from the proteases of Aspergillus per se. This hypothesis will aid in the clarification of the possible mechanism by which Aspergillus awamori-fermented burdock increased the cecal Bifidobacterium and organic acids, and fecal IgA and mucins. Our preliminary study investigated the effect of the consumption of several food-processing proteases derived from Aspergillus on colonic luminal microflora. Among them, two enzyme preparations, protease A ‘Amano SD’ and orientase AY, were notably identified to cause a marked increase in the colonic levels of Bifidobacterium and Lactobacillus in rats fed an HF diet. Accordingly, the present study analyzed the effects of these enzyme preparations on colonic variables, including microflora, fermentation, IgA, mucins and gene expression in rats fed an HF diet.

Materials and methods

Animals and diets

A total of 27 male Sprague-Dawley rats (4-week-old) were purchased from the Hiroshima Laboratory Animal Center (Hiroshima, Japan) and were maintained according to the ‘Guide for the Care and Use of Laboratory Animals’ established by Hiroshima University. The study was approved by the Ethics Committee of Hiroshima University. The rats were housed individually in an air-conditioned room at 23–24°C under a 12-h light/dark cycle (lights on from 08:00 a.m. to 20:00 p.m.). Following acclimatization with a non-purified commercial rodent diet (moderate fat diet; Oriental Yeast Co., Tokyo, Japan) for 7 days, the rats (mean body weight, 108 g) were divided into 3 groups with 9 rats in each.

The composition of the experimental diets (Table I) was based on an HF diet (30% beef tallow). The group of rats were randomly assigned to 1 of 3 diets: A control diet and experimental diets containing protease A ‘Amano SD’ [neutral proteases and peptidase from Aspergillus spp., containing 70% (w/w) dextrin, protease activity at pH 6.0; 50,000 U/g; Amano Enzyme Co., Ltd., Nagoya, Japan], or orientase AY [acid proteases from Aspergillus niger, containing 20% (w/w) dextrin, protease activity at pH 4.0; 200,000 U/g; HBI Enzymes Inc., Shisou, Japan]. Amano protease (protease A ‘Amano SD’) or orientase (orientase AY) was added to the experimental diet at 0.2% (w/w) (Table I). Equal amounts of the experimental diets were incorporated daily into food cups at 19:00 p.m. (9, 10, 12, 14 and 15 g on days 1, 2–4, 5–7, 8–13 and 14–21, respectively) to prevent differences in food intake. All the food was consumed each day until the food was served on the following day. The weight of any spilled food was recorded daily and was accounted for in the calculation of food intake. Feces were collected during the last 3 days, stored at −30°C, freeze-dried and milled. At the end of the feeding period, the rats were sacrificed by decapitation under diethyl ether anesthesia. Blood was collected and serum was separated by centrifugation at 2,000 × g for 20 min and stored at −80°C. The cecum was excised and its contents were immediately collected, weighed and stored at −80°C until subsequent analysis. The colonic mucosa was scraped with a sterilized glass slide and used for RNA extraction.

Table I.

Composition of experimental diets.

Table I.

Composition of experimental diets.

CharacteristicsControl (%, w/w)Amano protease (%, w/w)Orientase (%, w/w)
Beef tallow30.0030.0030.00
Caseina20.0020.0020.00
L-cystine   0.30   0.30   0.30
Vitamin mixtureb   1.00   1.00   1.00
Mineral mixtureb   3.50   3.50   3.50
Cellulose   5.00   5.00   5.00
Sucrose20.0020.0020.00
Corn starch20.2019.5319.95
Amano proteasec   0.67
Orientased   0.25

a Casein: Net protein content, 87% (w/w).

b American Institute for Nutrition (AIN-93).

c Protease A ‘Amano SD’: This powder contains 70% (w/w) dextrin.

d Orientase AY: This powder contains 20% (w/w) dextrin.

Measurements

Bacterial genomic DNA was isolated from the cecal digesta using the UltraClean™ Fecal DNA extraction kit (MO BIO Laboratories, Inc., Carlsbad, CA, USA) according to the manufacturer's instructions. Bacterial groups were quantified by quantitative polymerase chain reaction (qPCR) using a LightCycler 480 System II (Roche Applied Science, Indianapolis, IN, USA). The group-specific primers for qPCR are shown in Table II. qPCR was performed in a reaction volume of 20 µl containing 10 µl SYBR qPCR mix (Toyobo Co., Ltd., Osaka, Japan), 200 nM each of the forward and reverse primers (8–13), and 2 µl cecal DNA samples. The reaction conditions were 95°C for 30 sec followed by 40 cycles at 95°C for 5 sec, 55°C for 15 sec and 72°C for 30 sec. The fluorescent products were detected at the last step of each cycle. Melting curve analysis was performed following amplification to distinguish the targeted PCR product from the non-targeted PCR product. Data were analyzed by the second derivative maximum method of the LightCycler 480 Basic Software. The relative abundances of the microbial populations are expressed as the proportions of total bacterial 16S rDNA gene.

Table II.

Target bacteria group, primers sequence and product size for quantitative PCR.

Table II.

Target bacteria group, primers sequence and product size for quantitative PCR.

Target bacteria groupSequence (5′-3′)Product size, bpReference
Total bacteriaF: ACTCCTACGGGAGGCAG200   (8)
R: GTATTACCGCGGCTGCTG
Bifidobacterium spp.F: CGCGTCYGGTGTGAAAG244   (9)
R: CCCCACATCCAGCATCCA
Lactobacillus spp.F: GAGGCAGCAGTAGGGAATCTTC126   (9)
R: GGCCAGTTACTACCTCTATCCTTCTTC
Clostridium coccoides groupF: AAATGACGGTACCTGACTAA440(10)
R: CTTTGAGTTTCATTCTTGCGAA
Clostridium leptum subgroupF: GCACAAGCAGTGGAGT239(10)
R: CTTCCTCCGTTTTGTCAA
Akkermansia muciniphilaF: CAGCACGTGAAGGTGGGGAC327(11)
R: CCTTGCGGTTGGCTTCAGAT
EnterobacteriaceaeF: CATTGACGTTACCCGCAGAAGAAGC195(12)
R: CTCTACGAGACTCAAGCTTGC
BacteroidesF: GTCAGTTGTGAAAGTTTGC127(13)
R: CAATCGGAGTTCTTCGTG

[i] PCR, polymerase chain reaction; bp, base pairs; F, forward; R, reverse.

The pH of cecal digesta was measured directly by a compact pH meter (B-212; Horiba, Ltd., Kyoto, Japan). Cecal organic acids were measured according to the internal standard method using high-performance liquid chromatography (HPLC) (L-2130; Hitachi, Tokyo, Japan) equipped with an Aminex HPX-87H ion exclusion column (7.8 mm i.d. × 30 cm; Bio-Rad, Richmond, CA, USA) (14). Briefly, 500 mg of cecal digesta was homogenized in 5 ml 50 mmol/l H2SO4 containing 10 mmol/l 2,2-dimethyl butyric acid as an internal standard and subsequently centrifuged at 17,000 × g at 2°C for 20 min. The supernatant was ultrafiltered and the filtrate was applied to the HPLC. Cecal ammonia levels were measured according to the method of Lin and Visek (15).

Total IgA concentrations in feces were measured by using an ELISA quantitation kit (Bethyl Laboratories, Montgomery, TX, USA). Mucins were extracted as described by Bovee-Oudenhoven et al (16) and quantitated by a fluorometric assay (17).

Total RNA was extracted from colonic mucus using QIAzol lysis reagent (Qiagen, Hilden, Germany) according to the manufacturer's instructions. Isolated RNA was purified using the RNeasy® Lipid Tissue Mini kit (Qiagen). cDNA was synthesized from total RNA using the Revertrace reverse transcription-PCR kit (Toyobo Co., Ltd.). qPCR was performed on an Opticon 2 system (Bio-Rad) using the SYBR qPCR mix (Toyobo Co., Ltd.) and the following primers: Fasting-induced adipose factor (FIAF) forward, GACTGCCAGGAACTCTTTCA and reverse, TGTGATGCTGTGCATCTTCT; proglucagon forward, GGTTGATGAACACCAAGAGG and reverse, GAAGGATCCATCAGCATGTC; GAPDH forward, TGACAACTCCCTCAAGATTGTCA and reverse, GGCATGGACTGTGGTCATGA. The expression of the target genes, FIAF and proglucagon, was normalized to that of GAPDH, the endogenous control gene (18).

Statistical analysis

Data are expressed as mean ± standard error. Statistical analysis was performed by one-way analysis of variance and Tukey's post hoc test (Excel Statistics 2010 for Windows; Social Survey Research Information, Tokyo, Japan). P<0.05 was considered to indicate a statisically significant difference.

Results

Characteristics of the groups

The final body weights of the control, Amano protease and orientase groups were 254±2, 246±2 and 252±2 g, respectively (P>0.05). In addition, food intake, epididymal and perirenal adipose tissue weight did not differ significantly among the groups (data not shown).

Proportions of bacteria

The proportions of Bifidobacterium, Lactobacillus, Clostridium, Akkermansia muciniphila, Enterobacteriaceae, and Bacteroides in cecal digesta are shown in Table III. The proportions of cecal microflora were markedly different in the Amano protease and orientase groups compared to those in the control group. The proportion of Bifidobacterium spp. was significantly higher in the Amano protease group compared to the control group (194-fold greater, P<0.05). The proportions of Lactobacillus spp. were also markedly higher in the Amano protease and orientase groups compared to the control group (7.6- and 3.9-fold, respectively, P<0.05). There were no significant changes in the proportion of Clostridium cocoides with protease supplementation. However, the proportion of Clostridium cocoides was significantly higher in the orientase group compared to the Amano protease group (P<0.05). The proportions of Clostridium leptum were significantly lower in the protease groups compared to the control group. The proportion of Akkermansia muciniphila was markedly lower in the Amano protease group compared to the control group (P<0.05). The proportions of Enterobacteriaceae were significantly higher in the two protease groups compared to the control group (P<0.05). The proportions of Bacteroides were significantly lower in the two protease groups compared to the control group (P<0.05).

Table III.

Effects of Amano protease and orientase on the profile of microflora in the cecal digesta of rats fed an HF dieta.

Table III.

Effects of Amano protease and orientase on the profile of microflora in the cecal digesta of rats fed an HF dieta.

BacteriaControl (% of total bacteria)Amano protease (% of total bacteria)Orientase (% of total bacteria)
Bifidobacterium spp. 0.016±0.002b 3.105±0.758c 0.882±0.203b,c
Lactobacillus spp. 3.5±0.5b 26.7±3.0d 13.7±2.1c
Clostridium
  Clostridium coccoides group 6.60±0.07b,c 3.88±0.85b 9.48±1.32c
  Clostridium leptum group 0.263±0.071b 0.004±0.001c 0.034±0.006c
Akkermansia muciniphila 1.332±0.512b 0.0009±0.0004c 0.601±0.278b
Enterobacteriaceae 0.21±0.09b 8.24±0.84c 6.57±1.70c
Bacteroides 14.0±1.79b 1.10±0.69c 3.57±1.65c

a Mean ± standard error (n=9).

b-d Significantly different by Tukey's multiple-range test (P<0.05). HF, high-fat.

Cecal organic acids

Compared to the control group, the cecal digesta weights were significantly greater in the Amano protease and orientase groups (3.2- and 1.9-fold greater, respectively, P<0.05) (Table IV). The pH of the cecal digesta was significantly lower in the two protease-treated groups compared to the control group (P<0.05). Total organic acid concentration was significantly higher in the Amano protease group compared to the control group; compared to the control group, n-butyrate, propionate and lactate concentrations were 4.2-, 3.3- and 8.2-fold greater (P<0.05), respectively, whereas acetate concentration was significantly lower (P<0.05). Similarly, total organic acid concentrations were also significantly higher in the orientase group, and compared to the control group, n-butyrate, propionate and lactate concentrations were 3.2-, 2.6- and 6.8-fold greater (P<0.05), respectively, whereas succinate concentration was significantly lower (P<0.05). Cecal ammonia content did not differ significantly among the 3 groups.

Table IV.

Effects of Amano protease and orientase on the cecal organic acids in rats fed an HF dieta.

Table IV.

Effects of Amano protease and orientase on the cecal organic acids in rats fed an HF dieta.

VariablesControlAmano proteaseOrientase
Cecal digesta, g 2.21±0.10b 7.02±0.29d 4.10±0.33c
pH of cecal digesta 7.16±0.10b 5.32±0.12c 5.46±0.11c
Organic acids, µmol/g wet cecal digesta
  n-Butyrate 18.6±1.8b 78.9±7.9c 58.9±7.2c
  Propionate 10.9±0.9b 35.5±4.2c 28.7±3.6c
  Lactate 4.7±0.6b 38.7±3.5c 31.9±6.2c
  Acetate 31.2±3.8b 19.4±1.7c 24.2±3.9b,c
  Succinate 18.3±3.5b 13.6±2.6b,c 7.9±1.5c
Total organic acids 84±7b 186±12d 152±14c
Ammonia, µmol/g wet cecal digesta 3.84±0.28 3.38±0.21 4.25±0.36

a Mean ± standard error (n=9).

b-d Significantly different by Tukey's multiple-range test (P<0.05). HF, high-fat.

Fecal IgA and mucins

Fecal dry weight was significantly greater in the Amano protease-treated group compared to the other groups (P<0.05; Table V). IgA and mucins were measured in the fecal samples as indices of colonic immune and barrier functions. As a result, fecal IgA and mucin levels were also significantly higher in the Amano protease-treated group compared to the other groups (P<0.05). The proportion of Akkermansia muciniphila, a mucin-degrading commensal bacterium, was inversely correlated with mucin release (r=-0.466, P<0.05).

Table V.

Effects of Amano protease and orientase on the fecal parameters of rats fed an HF dieta.

Table V.

Effects of Amano protease and orientase on the fecal parameters of rats fed an HF dieta.

VariablesControlAmano proteaseOrientase
Dry wt, g/3 daysb 3.39±0.07c 4.13±0.26d 2.91±0.17c
IgA, mg/g dry wt 0.267±0.025c 0.634±0.057d 0.500±0.092c
IgA, mg/3 daysb 0.90±0.09c 2.37±0.15d 1.21±0.19c
Mucins, mg/g dry wt 0.44±0.03c 4.55±0.45d 1.11±0.23c
Mucins, mg/3 daysb 1.48±0.09c 18.85±2.26d 3.35±0.85c

a Mean ± standard error (n=9).

b Fecal collection for final 3 days.

c,d Significantly different by Tukey's multiple-range test (P<0.05). HF, high-fat; IgA, immunoglobulin A.

Colonic gene expression

Compared to the control group, colonic proglucagon gene expression was 3.8- and 2.2-fold higher in the Amano protease and orientase groups, respectively (P<0.05; Table VI). FIAF expression did not differ among the 3 groups.

Table VI.

Effects of Amano protease and orientase on the colonic gene expression in rats fed an HF dieta.

Table VI.

Effects of Amano protease and orientase on the colonic gene expression in rats fed an HF dieta.

Relative expression

GenesControlAmano proteaseOrientase
FIAF 1.00±0.22 0.96±0.12 0.73±0.14
Proglucagon 1.00±0.18b 3.80±0.43c 2.17±0.45d

a Mean ± standard error (n=9).

b-d Significantly different by Tukey's multiple-range test (P<0.05). HF, high-fat; FIAF, fasting-induced adipose factor.

Discussion

The present results indicate that the consumption of Amano protease, which consists of neutral proteases derived from Aspergillus spp., improves the colonic luminal parameters favorable to colonic health. In general, shifts in colonic microflora composition are one of the numerous factors involved in the development of colonic diseases. In particular, Bifidobacterium and Lactobacillus are considered to have important roles in colonic health (19). In the present study, Amano protease supplementation with an HF diet markedly elevated the proportions of cecal Bifidobacterium and Lactobacillus, as well as concentrations of organic acids such as n-butyrate, propionate and lactate. As lactate is absorbed more slowly in the gut compared to other organic acids (20), the pH of the cecal digesta was considerably lower; such an acidic environment favors acid-resistant bacteria including Bifidobacterium and Lactobacillus. An HF diet causes lower colonic organic acids, and is considered to increase the risk of colon cancer (21). Propionate and n-butyrate are also considered to have important roles in colonic health (22). In particular, butyrate is shown to modulate cell proliferation, apoptosis and activity of immune cells in the gut epithelial layer (23,24). Thus, the present results suggest dietary Amano protease preparation has a favorable effect on cecal fermentation when rats were fed an HF diet.

Some of the end products of protein and amino acids metabolism are considered toxic to the host, such as ammonia and phenolic compounds. However, the present results showed that the cecal ammonia content did not differ significantly among the 3 groups. It has been suggested that elevation in cecal organic acids and a lower pH are associated with suppression of ammonia-producing bacteria (25). Thus, supplementation of 0.2% Amano protease may not alter the ammonia level by modulating the amount of ammonia-producing bacteria in the colon.

Kondo et al (26) recently reported that intake of Bifidobacterium breve B-3 induces proglucagon expression in the mouse colon. Proglucagon is suggested to be a regulatory signal that controls energy homeostasis. Therefore, whether an increased proportion of Bifidobacterium caused by protease treatment increases proglucagon expression was determined in the present study. As expected, the results indicated that Amano protease and orientase treatment significantly increased proglucagon gene expression in the colon.

The high production of intestinal IgA and mucins is associated with a lower risk of colon cancer (27,28). The present study further shows that the consumption of Amano protease increases fecal IgA and mucin levels. The present results suggest that Amano protease may have a favorable effect on colonic immune and barrier functions. The administration of certain Bifidobacterium species, such as B. bifidum, has been reported to enhance intestinal IgA production (4). Elevated IgA levels may be associated with elevated Bifidobacterium levels. The decrease in colonic pH due to increased organic acid production may be responsible for increased mucin production (29). A study using a rat colon model shows that acetate and butyrate stimulate mucin release, although the underlying mechanism remains unknown (30). In the present study, the two proteases decreased pH and increased concentrations of certain organic acids in the cecal digesta. However, only Amano protease significantly increased mucin release; the reason why Orientase did not affect fecal mucin levels is unknown. Notably, Amano protease supplementation markedly decreased the cecal proportion of Akkermansia muciniphila, a mucin-degrading commensal bacterium. Furthermore, the proportion of Akkermansia muciniphila, a mucin-degrading commensal bacterium, was inversely correlated with mucin release. Therefore, the higher mucin level in the Amano protease group may be, at least in part, associated with the reduction in the proportion of Akkermansia muciniphila.

Mitsuoka (31) reported that bacterial extracellular compounds and the metabolites, which are defined as biogenics, may exert beneficial effects on the balance of colonic microflora by elevating the bifidobacteria and/or reducing the harmful bacteria, resulting in improving colon health. The present results suggest that the extracellular products, including several proteases released by Aspergillus, may have an important potential as biogenics. However, the study did not indicate any information regarding the underlying mechanism of improved colonic microflora, fermentation, immune and barrier functions by supplemental Aspergillus-derived protease preparations. Further study is required to investigate the mechanisms.

In conclusion, the present study suggests that the Aspergillus-derived protease preparations may beneficially modify the composition of cecal microflora, organic acids, IgA and mucins in rats fed an HF diet. The powdered protease preparations used contain several proteases and other factors derived from Aspergillus. Therefore, further study is in progress to investigate the effects of purified Aspergillus proteases on the colonic luminal environment.

Glossary

Abbreviations

Abbreviations:

FIAF

fasting-induced adipose factor

HF

high-fat

References

1 

de Vrese M and Schrezenmeir J: Probiotics, prebiotics and synbiotics. Adv Biochem Eng Biotechnol. 111:1–66. 2008.PubMed/NCBI

2 

Ziegler TR, Evans ME, Fernández-Estívariz C and Jones DP: Trophic and cytoprotective nutrition for intestinal adaptation, mucosal repair, and barrier function. Annu Rev Nutr. 23:229–261. 2003. View Article : Google Scholar : PubMed/NCBI

3 

Shimotoyodome A, Meguro S, Hase T, Tokimitsu I and Sakata T: Short chain fatty acids but not lactate or succinate stimulate mucus release in the rat colon. Comp Biochem Physiol A Mol Integr Physiol. 125:525–531. 2000. View Article : Google Scholar : PubMed/NCBI

4 

Park JH, Um JI, Lee BJ, Goh JS, Park SY, Kim WS and Kim PH: Encapsulated Bifidobacterium bifidum potentiates intestinal IgA production. Cell Immunol. 219:22–27. 2002. View Article : Google Scholar : PubMed/NCBI

5 

Li D, Kim JM, Jin Z and Zhou J: Prebiotic effectiveness of inulin extracted from edible burdock. Anaerobe. 14:29–34. 2008. View Article : Google Scholar : PubMed/NCBI

6 

Reddy BS: Dietary fat and its relationship to large bowel cancer. Cancer Res. 41:3700–3705. 1981.PubMed/NCBI

7 

Okazaki Y, Sitanggang NV, Sato S, Ohnishi N, Inoue J, Iguchi T, Watanabe T, Tomotake H, Harada K and Kato N: Burdock fermented by Aspergillus awamori elevates cecal Bifidobacterium, and reduces fecal deoxycholic acid and adipose tissue weight in rats fed a high-fat diet. Biosci Biotechnol Biochem. 77:53–57. 2013. View Article : Google Scholar : PubMed/NCBI

8 

Parnell JA and Reimer RA: Prebiotic fibres dose-dependently increase satiety hormones and alter Bacteroidetes and Firmicutes in lean and obese JCR:LA-cp rats. Br J Nutr. 107:601–613. 2012. View Article : Google Scholar : PubMed/NCBI

9 

Delroisse JM, Boulvin AL, Parmentier I, Dauphin RD, Vandenbol M and Portetelle D: Quantification of Bifidobacterium spp. and Lactobacillus spp. in rat fecal samples by real-time PCR. Microbiol Res. 163:663–670. 2008. View Article : Google Scholar : PubMed/NCBI

10 

Matsuki T, Watanabe K, Fujimoto J, Takada T and Tanaka R: Use of 16S rRNA gene-targeted group-specific primers for real-time PCR analysis of predominant bacteriain human feces. Appl Environ Microbiol. 70:7220–7228. 2004. View Article : Google Scholar : PubMed/NCBI

11 

Sonoyama K, Ogasawara T, Goto H, Yoshida T, Takemura N, Fujiwara R, Watanabe J, Ito H, Morita T, Tokunaga Y, et al: Comparison of gut microbiota and allergic reactions in BALB/c mice fed different cultivars of rice. Br J Nutr. 103:218–226. 2010. View Article : Google Scholar : PubMed/NCBI

12 

Bartosch S, Fite A, Macfarlane GT and McMurdo MET: Characterization of bacterial communities in feces from healthy elderly volunteers and hospitalized elderly patients by using real-time PCR and effects of antibiotic treatment on the fecal microbiota. Appl Environ Microbiol. 70:3575–3581. 2004. View Article : Google Scholar : PubMed/NCBI

13 

Ahmed S, Macfarlane GT, Fite A, McBain AJ, Gilbert P and Macfarlane S: Mucosa-associated bacterial diversity in relation to human terminal ileum and colonic biopsy samples. Appl Environ Microbiol. 73:7435–7442. 2007. View Article : Google Scholar : PubMed/NCBI

14 

Okazaki Y, Tomotake H, Tsujimoto K, Sasaki M and Kato N: Consumption of a resistant protein, sericin, elevates fecal immunoglobulin A, mucins and cecal organic acids in rats fed a high-fat diet. J Nutr. 141:1975–1981. 2011. View Article : Google Scholar : PubMed/NCBI

15 

Lin HC and Visek WJ: Large intestinal pH and ammonia in rats: Dietary fat and protein interactions. J Nutr. 121:832–843. 1991.PubMed/NCBI

16 

Bovee-Oudenhoven IM, Termont DS, Heidt PJ and Van der Meer R: Increasing the intestinal resistance of rats to the invasive pathogen Salmonella enteritidis: Additive effects of dietary lactulose and calcium. Gut. 40:497–504. 1997. View Article : Google Scholar : PubMed/NCBI

17 

Crowther RS and Wetmore RF: Fluorometric assay of O-linked glycoproteins by reaction with 2-cyanoacetamide. Anal Biochem. 163:170–174. 1987. View Article : Google Scholar : PubMed/NCBI

18 

Dharmani P, Strauss J, Ambrose C, Allen-Vercoe E and Chadee K: Fusobacterium nucleatum infection of colonic cells stimulates MUC2 mucin and tumor necrosis factor alpha. Infect Immun. 79:2597–2607. 2011. View Article : Google Scholar : PubMed/NCBI

19 

Brownawell AM, Caers W, Gibson GR, Kendall CWC, Lewis KD, Ringel Y and Slavin JL: Prebiotics and the health benefits of fiber: Current regulatory status, future research and goals. J Nutr. 142:962–974. 2012. View Article : Google Scholar : PubMed/NCBI

20 

Hoshi S, Sakata T, Mikuni K, Hashimoto H and Kimura S: Galactosylsucrose and xylosylfructoside alter digestive tract size and concentrations of cecal organic acids in rats fed diets containing cholesterol and cholic acid. J Nutr. 124:52–60. 1994.PubMed/NCBI

21 

Wu WT and Chen HL: Effects of konjac glucomannan on putative risk factors for colon carcinogenesis in rats fed a high-fat diet. J Agric Food Chem. 59:989–994. 2011. View Article : Google Scholar : PubMed/NCBI

22 

Topping DL and Clifton PM: Short-chain fatty acids and human colonic function: Roles of resistant starch and nonstarch polysaccharides. Physiol Rev. 81:1031–1064. 2001.PubMed/NCBI

23 

Scheppach W: Effects of short chain fatty acids on gut morphology and function. Gut. 35(Suppl 1): S35–S38. 1994. View Article : Google Scholar : PubMed/NCBI

24 

Tang Y, Chen Y, Jiang H, Robbins GT and Nie D: G-protein-coupled receptor for short-chain fatty acids suppresses colon cancer. Int J Cancer. 128:847–856. 2011. View Article : Google Scholar : PubMed/NCBI

25 

Han KH, Azuma S and Fukushima M: In vitro fermentation of spent turmeric powder with a mixed culture of pig faecal bacteria. Food Funct. 5:2446–2452. 2014. View Article : Google Scholar : PubMed/NCBI

26 

Kondo S, Xiao JZ, Satoh T, Odamaki T, Takahashi S, Sugahara H, Yaeshima T, Iwatsuki K, Kamei A and Abe K: Antiobesity effects of Bifidobacterium breve strain B-3 supplementation in a mouse model with high-fat diet-induced obesity. Biosci Biotechnol Biochem. 74:1656–1661. 2010. View Article : Google Scholar : PubMed/NCBI

27 

Velcich A, Yang W, Heyer J, Fragale A, Nicholas C, Viani S, Kucherlapati R, Lipkin M, Yang K and Augenlicht L: Colorectal cancer in mice genetically deficient in the mucin Muc2. Science. 295:1726–1729. 2002. View Article : Google Scholar : PubMed/NCBI

28 

Ito H, Tanabe H, Kawagishi H, Tadashi W, Yasuhiko T, Sugiyama K, Kiriyama S and Morita T: Short-chain inulin-like fructans reduce endotoxin and bacterial translocations and attenuate development of TNBS-induced colitis in rats. Dig Dis Sci. 54:2100–2108. 2009. View Article : Google Scholar : PubMed/NCBI

29 

Van den Abbeele P, Gérard P, Rabot S, Bruneau A, El Aidy S, Derrien M, Kleerebezem M, Zoetendal EG, Smidt H, Verstraete W, et al: Arabinoxylans and inulin differentially modulate the mucosal and luminal gut microbiota and mucin-degradation in humanized rats. Environ Microbiol. 13:2667–2680. 2011. View Article : Google Scholar : PubMed/NCBI

30 

Barcelo A, Claustre J, Moro F, Chayvialle JA, Cuber JC and Plaisancié P: Mucin secretion is modulated by luminal factors in the isolated vascularly perfused rat colon. Gut. 46:218–224. 2000. View Article : Google Scholar : PubMed/NCBI

31 

Mitsuoka T: Development of functional foods. Biosci Microbiota Food Health. 33:117–128. 2014. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Yang Y, Sitanggang NV, Kato N, Inoue J, Murakami T, Watanabe T, Iguchi T and Okazaki Y: Beneficial effects of protease preparations derived from Aspergillus on the colonic luminal environment in rats consuming a high-fat diet. Biomed Rep 3: 715-720, 2015.
APA
Yang, Y., Sitanggang, N.V., Kato, N., Inoue, J., Murakami, T., Watanabe, T. ... Okazaki, Y. (2015). Beneficial effects of protease preparations derived from Aspergillus on the colonic luminal environment in rats consuming a high-fat diet. Biomedical Reports, 3, 715-720. https://doi.org/10.3892/br.2015.490
MLA
Yang, Y., Sitanggang, N. V., Kato, N., Inoue, J., Murakami, T., Watanabe, T., Iguchi, T., Okazaki, Y."Beneficial effects of protease preparations derived from Aspergillus on the colonic luminal environment in rats consuming a high-fat diet". Biomedical Reports 3.5 (2015): 715-720.
Chicago
Yang, Y., Sitanggang, N. V., Kato, N., Inoue, J., Murakami, T., Watanabe, T., Iguchi, T., Okazaki, Y."Beneficial effects of protease preparations derived from Aspergillus on the colonic luminal environment in rats consuming a high-fat diet". Biomedical Reports 3, no. 5 (2015): 715-720. https://doi.org/10.3892/br.2015.490
Copy and paste a formatted citation
x
Spandidos Publications style
Yang Y, Sitanggang NV, Kato N, Inoue J, Murakami T, Watanabe T, Iguchi T and Okazaki Y: Beneficial effects of protease preparations derived from Aspergillus on the colonic luminal environment in rats consuming a high-fat diet. Biomed Rep 3: 715-720, 2015.
APA
Yang, Y., Sitanggang, N.V., Kato, N., Inoue, J., Murakami, T., Watanabe, T. ... Okazaki, Y. (2015). Beneficial effects of protease preparations derived from Aspergillus on the colonic luminal environment in rats consuming a high-fat diet. Biomedical Reports, 3, 715-720. https://doi.org/10.3892/br.2015.490
MLA
Yang, Y., Sitanggang, N. V., Kato, N., Inoue, J., Murakami, T., Watanabe, T., Iguchi, T., Okazaki, Y."Beneficial effects of protease preparations derived from Aspergillus on the colonic luminal environment in rats consuming a high-fat diet". Biomedical Reports 3.5 (2015): 715-720.
Chicago
Yang, Y., Sitanggang, N. V., Kato, N., Inoue, J., Murakami, T., Watanabe, T., Iguchi, T., Okazaki, Y."Beneficial effects of protease preparations derived from Aspergillus on the colonic luminal environment in rats consuming a high-fat diet". Biomedical Reports 3, no. 5 (2015): 715-720. https://doi.org/10.3892/br.2015.490
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team