Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Biomedical Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9434 Online ISSN: 2049-9442
Journal Cover
March-2017 Volume 6 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
March-2017 Volume 6 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Association of COL4A3 (rs55703767), MMP-9 (rs17576)and TIMP-1 (rs6609533) gene polymorphisms with susceptibility to type 2 diabetes

  • Authors:
    • Samira Saravani
    • Davood Yari
    • Ramin Saravani
    • Changiz Azadi Ahmadabadi
  • View Affiliations / Copyright

    Affiliations: Department of Biology, Zabol University, Zabol 98615‑538, Iran, Department of Clinical Biochemistry, School of Medicine, Zahedan University of Medical Sciences, Zahedan 98167‑43463, Iran, Department of Cardiovascular Surgery, Zahedan University of Medical Sciences, Zahedan 98167‑43463, Iran
  • Pages: 329-334
    |
    Published online on: February 9, 2017
       https://doi.org/10.3892/br.2017.856
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Type 2 diabetes (T2D) is defined by high levels of glucose in the blood. The collagen IV level is associated with conditions of hyperglycemia and insulin resistance. Collagen type IV α3 chain (COL4A3) is a structural protein of the extracellular matrix (ECM). Matrix metallopeptidase 9 (MMP‑9) is an enzyme that degrades the extracellular matrix and its activity is moderated by TIMP metallopeptidase inhibitor 1 (TIMP‑1). The aim of the current study was to examine the association between genetic polymorphisms of COL4A3 (rs55703767), MMP‑9 (rs17576) and TIMP‑1 (rs6609533) in patients with T2D. This case‑control study was performed on 120 Iranian patients with T2D and 120 healthy individuals. Genotypes were analyzed using the amplification refractory mutation system‑polymerase chain reaction technique. The findings demonstrated significant differences between genotypic and allelic distributions of COL4A3 (G/T) and MMP-9 (A/G) polymorphisms as follows: COL4A3 (G/T); TT vs. GG, odds ratio (OR)=0.235, 95% confidence interval (CI)=0.063‑0.0802 (P=0.013) and T vs. G, OR=0.592, 95% CI=0.371‑0.943 (P=0.026); MMP‑9 (A/G); AG vs. GG, OR=2.429, 95% CI=1.232‑4.820 (P=0.008) and A vs. G, OR=2.176, 95% CI=1.155‑4.130 (P=0.013). No significant association was identified between TIMP-1 (A/G) polymorphism and T2D in females and males. Thus, the genotypic and allelic distributions of COL4A3 (G/T) and MMP‑9 (A/G) polymorphisms were associated with T2D. In addition, no significant association was identified in the genotypic distribution of the TIMP‑1 (A/G) gene in females and in males. Further studies in other ethnic groups are required to confirm these findings.

Introduction

Type 2 diabetes (T2D) is a metabolic disease, which is distinguished by high levels of blood sugar and occurs when the pancreas is unable to produce enough insulin or the body is unable to use the insulin that is produced (insulin resistance) (1,2). The signs and symptoms of T2D include excessive urination, polydipsia, polyphagia, weight loss, blurry vision and fatigue (3,4). The prevalence of diabetes has been estimated to increase from 171 million in 2000 to 366 million by 2030 and is associated with macro- and microvascular disorders (3,5,6). T2D has numerous risk factors, including ageing, genetics, family history, previous gestational diabetes, ethnicity, nourishment and poverty (3,7). As one of the most well-known polygenic diseases, certain candidate genes have been detected for the risks and complex traits of T2D (8). The extracellular matrix is important to the structure and function of various cell types; furthermore, it contributes to processes, such as cell adhesion, cellular proliferation, differentiation, migration and apoptosis (9). Type IV collagen is a structural glycoprotein and the primary component of basement membranes (BMs). Each collagen molecule comprises three chains (10,11). In diabetes mellitus, marked alterations in the synthesis and structure of the extracellular matrix have been detected. A previous study has shown that collagen IV levels are associated with hyperglycemia and insulin resistance (12). Collagen type IV α3 chain (COL4A3) is expressed in the alveolar BM (13). It is located at position 2q35-q37 and contains 51 exons (14). Matrix metalloproteinases (MMP) are zinc-dependent endopeptidases that degrade matrix and non-matrix proteins (15). MMPs regulate numerous normal and pathological activities (16). The MMP-9 gene is located on chromosome 20q12.2–13.1 and contains 13 exons and 12 introns (17). The activities of MMPs are regulated by tissue inhibitors of metalloproteinases (TIMPs) (18). TIMP-1 is a secreted glycoprotein, which binds to active MMPs and inhibits their proteolytic activity (19,20). In addition, TIMP-1 was mapped to X11p11.23–11.4 (21). The purpose of the current study was to investigate the possible association between T2D and COL4A3 (rs55703767, G/T), MMP-9 (rs17576, A/G) and TIMP-1 (rs6609533, A/G) gene polymorphisms in an Iranian population.

Materials and methods

Subjects

This case-control study was performed on 120 patients with T2D and 120 healthy individuals. The mean ages were 56.34±10.8 years. Approval was obtained from the ethics committee of Zahedan University of Medical Sciences (Zahedan, Iran) and written informed consent was obtained from all participants. T2D was diagnosed according to medical records and fasting blood glucose (FBG) levels using the American Diabetic association (ADA) criteria (22); our studies have been described previously (23,24) and confirmed by at least two endocrinologists from the Diabetic Clinic at the Ali-Asghar Hospital (Zahedan, Iran). Healthy subjects were in good health and free of any comorbidity. Blood samples (5 ml) were collected from all patients and controls after a 12-h fast (between 7:00 and 9:00 am), and stored in ethylenediaminetetraacetic acid-containing tubes for DNA extraction and measurement of clinical characteristics. The FBG, cholesterol, triglyceride (TG), high-density lipoprotein-cholesterol (HDL-C), low-density lipoprotein-cholesterol (LDL-C), creatinine, and urea are presented in Table I.

Table I.

Demographic characteristics of T2D patients.

Table I.

Demographic characteristics of T2D patients.

CharacteristicT2D (n=120)Controls (n=120)P-value
Age (years)56.57±10.60256.11±11.0750.744
Gender (f/m)91/2988/320.767
Duration of illness (years)9.91±6.90––
Fasted blood sugar (mg/dl)172.51±77.3275.53±12.040.001
TG (mg/dl)152.47±73.50120.25±10.120.001
TC (mg/dl)175.79±38.29190.09±15.040.001
HDL-C (mg/dl)59.02±6.7460.36±4.530.116
LDL-C (mg/dl)89.82±13.0090.22±6.030.878
Urea (mg/dl)31.33±10.9530.23±6.120.185
Creatinine (mg/dl)1.02±0.2641.01±0.2330.352

[i] T2D, type 2 diabetes; TG, triglyceride; TC, total cholesterol; HDL-C, high-density lipoprotein-cholesterol; LDL-C, low-density lipoprotein-cholesterol; f, female; m, male.

COL4A3, MMP-9 and TIMP-1 polymorphism genotyping

Genomic DNA was extracted from peripheral blood according to the salting-out method (25). The quality of the extracted DNA was confirmed using electrophoresis (at 80 V for ~30–40 min) on 2% agarose gel and the quantity of DNA by spectrophotometry (ratio, 260/280 nm; absorption, 1.7–1.9), the isolated DNA was stored at −20°C until further use. The COL4A3 (rs55703767), MMP-9 (rs17576) and TIMP-1 (rs6609533) polymorphisms were genotyped using the amplification refractory mutation system polymerase chain reaction (ARMS-PCR) method.

Genotyping the rs55703767 polymorphism of the COL4A3 (G/T) gene

Evaluation of the polymorphism, COL4A3 (rs55703767) was performed using ARMS-PCR (the primers)(Pishgam Biotech Co., Tehran, Iran) are presented in Table II. For this purpose, two tubes were used to define the variant as follows: Tube 1 contained wild-allele-specific reverse primer G and a common forward primer; tube 2 contained mutant-allele-specific reverse primer T and a common forward primer. PCR was performed in a final volume of 20 µl using 2 µl genomic DNA, 7 DNase-free water (SinaClon BioScience Co., Tehran, Iran), 0.5 µl each primer and 10 µl Master Mix (Ampliqon A/S, Odense, Denmark). The amplification was performed with a primary denaturation step at 95°C for 5 min, followed by 33 cycles at 95°C for 30 sec, 54°C for 35 sec, and 72°C for 30 sec with a final extension at 72°C for 10 min. The PCR products were assayed by electrophoresis (at 50 V for ~30–40 min) on a 2% agarose gel and the product size was 216 bp.

Table II.

Primers used for the identification of SNPs.

Table II.

Primers used for the identification of SNPs.

SNPOrientationSequence (5′-3′)Amplicon size (bp)
COL4A3 (rs55703767) G/TR (G allele) AGGATTACCTTAATGCCACC
R (T allele) AGGATTACCTTAATGCCACA216
F (universal) CTGCATTTGGGAATCATAGT
MMP-9 (rs17576) A/GF (A allele) CCCAGGACTCTACACCAA
F (G allele) CCCAGGACTCTACACCAG275
R (universal) GTGGAAAGACAAACTGATGG
TIMP-1 (rs6609533) A/GF (A allele) CTGTGTCCAATACCGTGTGATAA
F (G allele) CTGTGTCCAATACCGTGTGATAG   306
R (universal) GGCTTCAAGATAGTCACTGG

[i] SNP, single nucleotide polymorphism; COL4A3, collagen type IV α3 chain; MMP-9, matrix metallopeptidase 9; TIMP-1, TIMP metallopeptidase inhibitor 1; F, forward; R, reverse.

Genotyping the rs17576 polymorphism of the MMP-9 (A/G) gene

To detect the MMP-9 (rs17576) variant, two tubes were used as follows: Tube 1 contained wild-allele-specific forward primer G and a common reverse primer, and tube 2 contained mutant-allele-specific forward primer A and a common reverse primer. PCR was performed in a final volume of 20 µl using 1 µl each primer, 10 µl Master Mix, 2 µl genomic DNA and 6 µ DNase-free water and the PCR cycling condition were as follows: Primary denaturation at 95°C for 5 min, followed by 30 cycles at 95°C for 30 sec, 53°C for 25 sec, and 72°C for 30 sec with a final extension at 72°C for 5 min. The PCR products were assayed by electrophoresis (at 50 V for ~30–40 min) on a 2% agarose gel and the product size was 275 bp.

Genotyping the rs6609533 polymorphism of the TIMP-1 (A/G) gene

DNA amplification was performed using two tubes. Tube 1 contained wild-allele-specific forward primer A and a common reverse primer, and tube 2 contained mutant-allele-specific forward primer G and a common reverse primer. PCR was performed in a final volume of 20 µl using 0.5 µl each primer, 10 µl Master Mix, 2 µl genomic DNA and 7 µl DNase-free water. The PCR cycling conditions were as follows: Primary denaturation at 95°C for 5 min, followed by 32 cycles at 95°C for 30 sec, 61°C for 25 sec, and 72°C for 35 sec with a final extension at 72°C for 5 min. The PCR products were assayed by electrophoresis (at 50 V for ~ 30–40 min) on a 2% agarose gel and the product size was 306 bp.

Statistical analysis

The statistical analysis of the data was calculated using the SPSS version 19.0 software (IBM SPSS, Armonk, NY, USA). The association between genotypes and T2D was assayed by calculating the OR and 95% CI using the χ2 test. P<0.05 was considered to indicate a statistically significant difference. In addition, Hardy Weinberg equilibrium (HWE) was calculated through comparison between observed and expected frequencies of genotypes associated with the investigated polymorphisms.

Results

Study population

The case and control groups were matched regarding age (patient group: 56.57±10.602 years; control group: 56.11±11.075; P=0.744) and gender [patient group (female/male)=91/29 and control group (female/male)=88/32; P=0.767] (Table I).

Frequency of the COL4A3 (rs55703767) genetic polymorphism

Table III presents the allelic and genotypic distributions of the COL4A3 (rs55703767), MMP-9 (rs17576) and TIMP-1 (rs6609533) polymorphisms in the patients and control subjects. The frequency distribution of the COL4A3 (G/T) genotypes in T2D patients were as follows: GG, 69.2%; GT, 27.5%; and TT, 3.3% and the distribution in the controls were: GG, 60.8%; GT, 26.7%; and TT, 12.5%. Statistically significant differences concerning the genotypic distribution of the COL4A3 polymorphism (rs55703767) were identified. The frequency of the TT genotype was significantly different between the patients and the control subjects (OR=0.235, 95% CI=0.063–0.0802; P=0.013). In addition, a statistically significant difference in the T allele frequency was observed between patients with T2D and the control subjects (OR=0.592, 95% CI=0.371–0.943; P=0.026). These results demonstrated that the COL4A3 (rs55703767) polymorphism was associated with T2D.

Table III.

Genotype and allele frequencies of selected polymorphisms in COL4A3, MMP-9 and TIMP-1 genes.

Table III.

Genotype and allele frequencies of selected polymorphisms in COL4A3, MMP-9 and TIMP-1 genes.

SNPPatients, n (%)Controls, n (%)OR (95% CI)P-value
COL4A3 (rs55703767) G/T
  GG83 (69.2)73 (60.8)Ref.–
  GT33 (27.5)32 (26.7)1.1 (0.593–2.05)0.769
  TT4 (3.3)15 (12.5)  0.235 (0.063–0.0802)0.013
Allele frequency
  G199 (82.9)178 (74.1)Ref.–
  T41 (17)62 (25.8)0.592 (0.371–0.943)0.026
MMP-9 (rs17576) A/G
  GG84 (70)102 (85)Ref.–
  AG36 (30)18 (15)2.429 (1.232–4.820)0.008
  AA00–1.000
Allele frequency
  G204 (85)222 (92.5)Ref.–
  A36 (15)18 (7.5)  2.176 (1.155–4.130)0.013
TIMP-1 (rs6609533) A/G in females
  AA27 (29.7)27 (30.7)Ref.–
  AG44 (48.3)25 (28.4)1.760 (0.852–3.634)0.126
  GG20 (22)36 (40.9)0.556 (0.259–1.192)0.131
Allele frequency
  A98 (53.8)79 (44.9)Ref.–
  G84 (46.2)97 (55.1)0.698 (0.461–1.058)0.092
TIMP-1 (rs6609533) A/G in males
  AA17 (58.6)15 (46.9)Ref.–
  GG12 (41.4)17 (53.1)0.62 (0.23–1.72)0.360

[i] P<0.05 was considered to indicate statistically significant differences. SNP, single nucleotide polymorphism; OR, odds ratio; CI, confidence interval; COL4A3, collagen type IV α3 chain; MMP-9, matrix metallopeptidase 9; TIMP-1, TIMP metallopeptidase inhibitor 1.

Frequency of the MMP-9 (rs17576) genetic polymorphism

In the current study, the allelic and genotypic distributions of the MMP-9 (rs17576) polymorphism were significantly different between the T2D patients and control subjects. Significant differences in the distribution of the AG genotype frequency were observed in the patients with T2D and the healthy individuals (OR=2.429, 95% CI=1.232–4.820; P=0.008). The current findings indicated that the AG genotype increased the risk of susceptibility to T2D. The AA genotype was not observed in the current study. Furthermore, a statistically significant difference was identified in the A allele frequency (OR=2.176, 95% CI=1.155–4.130; P=0.013). The A allele was a risk factor for susceptibility to T2D.

Frequency of the TIMP-1 (rs6609533) genetic polymorphism

The TIMP-1 gene is located on the X chromosome; therefore, males and females were analyzed separately. No significant difference in the distribution of the AG genotype frequency was identified between the T2D patients and control subject groups in females. In addition, no significant difference in distribution of the genotype frequency was identified for TIMP-1 (A/G) in males. Furthermore, no statistically significant differences were identified in the allele frequencies in females.

The Hardy-Weinberg equilibrium (HWE) of the COL4A3, MMP-9 and TIMP-1 polymorphism were evaluated using the χ2 test for each of the single nucleotide polymorphisms (SNPs) as follows: COL4A3 (case; P=0.748, χ2=0.1, control; P<0.05, χ2=11.1), MMP-9 (case; P=0.0532, χ2=3.74, control; P=0.374, χ2=0.79), and TIMP-1 (case; P<0.05, χ2=8.52, control; P<0.05, χ2=40.63).

Dominant, recessive and overdominant model analyses were performed (Table IV) for the COL4A3 (rs55703767) G/T and the TIMP-1 (RS6609533) A/G, and the result indicated that, of the COL4A3 (rs55703767) G/T, the TT genotype was associated with T2D in the recessive model (P=0.0068) while, in TIMP-1 (RS6609533) A/G, the AG genotype was associated with T2D in the overdominant model (P=0.062). No significant association with T2D was identified in the other models.

Table IV.

Single nucleotide polymorphism association with T2D patients and control subjects.

Table IV.

Single nucleotide polymorphism association with T2D patients and control subjects.

SNPT2D, n (%)Control, n (%)P-valueOR (95% CI)
COL4A3 (rs55703767) G/T
Dominant
  GG83 (69.2)73 (60.8)
  GT + TT37 (30.8)47 (39.2)0.180.69 (0.41–1.18)
Recessive
  GG + GT116 (96.7)105 (87.5)
  TT4 (3.3)15 (12.5)0.00680.24 (0.07–0.75)
Overdominant
  GG + TT87 (72.5)88 (73.3)
  GT33 (27.5)32 (26.7)0.881.04 (0.59–1.85)
TIMP-1 (RS6609533) A/G
Dominant
  AA39 (32.5)44 (36.7)
  AG + GG81 (67.5)76 (63.3)0.4981.202 (0.706–2.048)
Recessive
  AA + AG83 (69.2)69 (57.5)
  GG37 (30.8)51 (42.5)0.0620.603 (0.355–1.025)
Overdominant
  AA + GG76 (63.3)95 (79.2)
  AG44 (36.7)25 (20.8)0.0620.603 (0.355–1.025)

[i] P<0.05 was considered to indicate a statistically significant difference. T2D, type 2 diabetes; OR, odds ratio; CI, confidence interval; OR, odds ratio; CI, confidence interval; COL4A3, collagen type IV α3 chain; MMP-9, matrix metallopeptidase 9; TIMP-1, TIMP metallopeptidase inhibitor 1.

Discussion

T2D is a growing health challenge worldwide and is the most widespread form of diabetes (26). T2D is characterized by hyperglycemia and results from a combination of resistance to insulin action and insufficient insulin secretion (27). Previous studies demonstrated that genetic polymorphisms may reveal individual differences in T2D risk (28). Type IV collagen is a major component of the ECM and various different physiological situations, including ageing, diabetes, scarring, and fibrosis are associated with it (29); in T2D, the biosynthesis of type IV collagen is increased (30). The levels of extracellular matrix components are a reflection of the balance between the rate of synthesis and the degradation of matrix proteins. Degradation is attained through MMPs, which are regulated by TIMPs (9). Alterations in connective tissue metabolism may associate with the development of diabetic complications, such as neuropathy, nephropathy and retinopathy (12). Rana et al (31) proposed that thin BM nephropathy (TBMN) results from mutations in COL4A3. Numerous different COL4A3 mutations cause TBMN and the identification of polymorphisms in this gene is particularly important (31). Hou et al (32) identified that a novel mutation (3725G>A, G1242D) of COL4A3 exerted an underlying pathogenic role in the heterozygous form in TBMN (29). Ahluwalia et al (33) demonstrated that MMP-9 polymorphisms were associated with the risk of diabetic nephropathy (DN). Nazir et al (34) found that genetic variants of MMP-9 had a significant positive association with DN and that this gene may contribute to the pathophysiology of DN (34). The results of Pan et al (35) indicated that the TIMP-1 SNPs, rs4898 and rs6609533 were associated with an increased risk of early aseptic loosening susceptibility (35). Kumar et al (36) observed that the SNP rs6609533 of the TIMP-1 gene interacted with pim-3 proto-oncogene, serine/threonine kinase, resulting in a possible risk for the development of chronic obstructive pulmonary disease (36).

In conclusion, the T allele of COL4A3 (G/T) (with a protective role) and the A allele of MMP-9 (A/G) (as a risk factor) were associated with T2D. However, no significant association was identified between the G allele of TIMP-1 (A/G) and the risk/protective characteristics of T2D in females in the evaluated population. However, further studies with larger sample sizes and various ethnic groups are required to confirm these findings.

Acknowledgements

The present study was funded by a dissertation grant (grant no. 7224) from the Deputy for Research, University of Medical Sciences (Zahedan, Iran).

References

1 

Galavi HR, Saravani R, Alamdari AR, Ranjbar N, Damani E and Khodakhier TN: Evaluating the Effect of the rs2229238 and the rs4845625 Interleukin 6 Receptor Gene Polymorphisms on Body Mass Index and the Risk of Type 2 Diabetes in an Iranian Study Population. Int J High Risk Behav Addict. 5:e332892016. View Article : Google Scholar

2 

Matough FA, Budin SB, Hamid ZA, Alwahaibi N and Mohamed J: The role of oxidative stress and antioxidants in diabetic complications. Sultan Qaboos Univ Med J. 12:5–18. 2012. View Article : Google Scholar : PubMed/NCBI

3 

McNaughton D: ‘Diabesity’ down under: Overweight and obesity as cultural signifiers for type 2 diabetes mellitus. Crit Public Health. 23:274–288. 2013. View Article : Google Scholar : PubMed/NCBI

4 

Saravani S, Miri H, Saravani R, Yari D, Nakhaee A and Mahjoubifard M: Association of catalase (rs7943316) and glutathione peroxidase-1 (rs1050450) polymorphisms with the risk of type 2 diabetes (T2DM). Mol Gen Microbiol Virol. 30:216–220. 2015. View Article : Google Scholar

5 

Lakhan SE and Kirchgessner A: The emerging role of dietary fructose in obesity and cognitive decline. Nutr J. 12:1142013. View Article : Google Scholar : PubMed/NCBI

6 

Azmy R, Dawood A, Kilany A, El-Ghobashy Y, Ellakwa AF and El-Daly M: Association analysis of genetic variations of eNOS and α2β1 integrin genes with type 2 diabetic retinopathy. Appl Clin Genet. 5:55–65. 2012.PubMed/NCBI

7 

Saravani R, Esmaeeli E, Tamendani MK and Nejad MN: Oxytocin Receptor Gene Polymorphisms in Patients With Diabetes. Gene, Cell and Tissue. 2:e279042015. View Article : Google Scholar

8 

Tang L, Wang L, Liao Q, Wang Q, Xu L, Bu S, Huang Y, Zhang C, Ye H, Xu X, et al: Genetic associations with diabetes: Meta-analyses of 10 candidate polymorphisms. PLoS One. 8:e703012013. View Article : Google Scholar : PubMed/NCBI

9 

Khan T, Muise ES, Iyengar P, Wang ZV, Chandalia M, Abate N, Zhang BB, Bonaldo P, Chua S and Scherer PE: Metabolic dysregulation and adipose tissue fibrosis: Role of collagen VI. Mol Cell Biol. 29:1575–1591. 2009. View Article : Google Scholar : PubMed/NCBI

10 

Heidet L, Arrondel C, Forestier L, Cohen-Solal L, Mollet G, Gutierrez B, Stavrou C, Gubler MC and Antignac C: Structure of the human type IV collagen gene COL4A3 and mutations in autosomal Alport syndrome. J Am Soc Nephrol. 12:97–106. 2001.PubMed/NCBI

11 

Saravani R, Hasanian-Langroudi F, Validad MH, Yari D, Bahari G, Faramarzi M, Khateri M and Bahadoram S: Evaluation of possible relationship between COL4A4 gene polymorphisms and risk of keratoconus. Cornea. 34:318–322. 2015. View Article : Google Scholar : PubMed/NCBI

12 

Muona P, Jaakkola S, Zhang RZ, Pan TC, Pelliniemi L, Risteli L, Chu ML, Uitto J and Peltonen J: Hyperglycemic glucose concentrations up-regulate the expression of type VI collagen in vitro. Relevance to alterations of peripheral nerves in diabetes mellitus. Am J Pathol. 142:1586–1597. 1993.PubMed/NCBI

13 

Kim KM, Park SH, Kim JS, Lee WK, Cha SI, Kim CH, Kang YM, Jung TH, Kim IS and Park JY: Polymorphisms in the type IV collagen α3 gene and the risk of COPD. Eur Respir J. 32:35–41. 2008. View Article : Google Scholar : PubMed/NCBI

14 

Štabuc-Šilih M, Ravnik-Glavač M, Glavač D, Hawlina M and Stražišar M: Polymorphisms in COL4A3 and COL4A4 genes associated with keratoconus. Mol Vis. 15:2848–2860. 2009.PubMed/NCBI

15 

Marson BP, Lacchini R, Belo V, Mattos SG, da Costa BP, Poli-de-Figueiredo CE and Tanus-Santos JE: Functional matrix metalloproteinase (MMP)-9 genetic variants modify the effects of hemodialysis on circulating MMP-9 levels. Clin Chim Acta. 414:46–51. 2012. View Article : Google Scholar : PubMed/NCBI

16 

Kowluru RA, Zhong Q and Santos JM: Matrix metalloproteinases in diabetic retinopathy: Potential role of MMP-9. Expert Opin Investig Drugs. 21:797–805. 2012. View Article : Google Scholar : PubMed/NCBI

17 

Wu HD, Bai X, Chen DM, Cao HY and Qin L: Association of Genetic Polymorphisms in Matrix Metalloproteinase-9 and Coronary Artery Disease in the Chinese Han Population: A Case-Control Study. Genet Test Mol Biomarkers. 17:707–712. 2013. View Article : Google Scholar : PubMed/NCBI

18 

Nagase H, Visse R, Murphy G, Cao H-y and Qin L: Structure and function of matrix metalloproteinases and TIMPs. Cardiovasc Res. 69:562–573. 2006. View Article : Google Scholar : PubMed/NCBI

19 

Rivera S, Tremblay E, Timsit S, Canals O, Ben-Ari Y and Khrestchatisky M: Tissue inhibitor of metalloproteinases-1 (TIMP-1) is differentially induced in neurons and astrocytes after seizures: Evidence for developmental, immediate early gene, and lesion response. J Neurosci. 17:4223–4235. 1997.PubMed/NCBI

20 

Goldbergova MP, Parenica J, Jarkovsky J, Kala P, Poloczek M, Manousek J, Kluz K, Kubkova L, Littnerova S, Tesak M, et al: The association between levels of tissue inhibitor of metalloproteinase-1 with acute heart failure and left ventricular dysfunction in patients with ST elevation myocardial infarction treated by primary percutaneous coronary intervention. Genet Test Mol Biomarkers. 16:1172–1178. 2012. View Article : Google Scholar : PubMed/NCBI

21 

Brew K and Nagase H: The tissue inhibitors of metalloproteinases (TIMPs): An ancient family with structural and functional diversity. Biochimica et Biophysica Acta (BBA). Mol Cell Res. 1803:55–71. 2010.

22 

Association AD: American Diabetes Association: Standards of medical care in diabetes. Diabetes Care. 27:(Suppl 1). S15–S35. 2004. View Article : Google Scholar : PubMed/NCBI

23 

Saravani R, Irani Z and Galavi HR: Evaluation of transcription factor 7 like 2 polymorphisms and haplotypes in risk of type 2 diabetes. Rev Rom Med Lab. 24:423–430. 2016.

24 

Saravani R, Galavi HR, Ranjbar N and Alamdari A: ATP-binding cassette transporter A1 polymorphisms and haplotypes in risk of type 2 diabetes. Gene, Cell and Tissue. 4:e436772016. View Article : Google Scholar

25 

Mousavi M, Saravani R, Modrek MJ, Shahrakipour M and Sekandarpour S: Detection of Toxoplasma gondii in Diabetic Patients Using the Nested PCR Assay via RE and B1 Genes. Jundishapur Journal of Microbiology. 9:e294932016. View Article : Google Scholar : PubMed/NCBI

26 

Ghoshal K and Bhattacharyya M: Adiponectin: Probe of the molecular paradigm associating diabetes and obesity. World J Diabetes. 6:151–166. 2015. View Article : Google Scholar : PubMed/NCBI

27 

Tripathi BK and Srivastava AK: Diabetes mellitus: Complications and therapeutics. Med Sci Monit. 12:RA130–RA147. 2006.PubMed/NCBI

28 

Staiger H, Machicao F, Stefan N, Tschritter O, Thamer C, Kantartzis K, Schäfer SA, Kirchhoff K, Fritsche A and Häring HU: Polymorphisms within novel risk loci for type 2 diabetes determine β-cell function. PLoS One. 2:e8322007. View Article : Google Scholar : PubMed/NCBI

29 

Osman OS, Selway JL, Harikumar PE, Stocker CJ, Wargent ET, Cawthorne MA, Jassim S and Langlands K: A novel method to assess collagen architecture in skin. BMC Bioinformatics. 14:2602013. View Article : Google Scholar : PubMed/NCBI

30 

Sternberg M, Grigorova-Borsos AM, Guillot R, Kassab JP, Bakillah A, Urios P, Cohen-Forterre L, Mozère G, André J, Leblond V, et al: Changes in collagen type IV metabolism in diabetes. C R Seances Soc Biol Fil. 187:247–257. 1993.(In French). PubMed/NCBI

31 

Rana K, Tonna S, Wang YY, Sin L, Lin T, Shaw E, Mookerjee I and Savige J: Nine novel COL4A3 and COL4A4 mutations and polymorphisms identified in inherited membrane diseases. Pediatr Nephrol. 22:652–657. 2007. View Article : Google Scholar : PubMed/NCBI

32 

Hou P, Chen Y, Ding J, Li G and Zhang H: A novel mutation of COL4A3 presents a different contribution to Alport syndrome and thin basement membrane nephropathy. Am J Nephrol. 27:538–544. 2007. View Article : Google Scholar : PubMed/NCBI

33 

Ahluwalia TS, Khullar M, Ahuja M, Kohli HS, Bhansali A, Mohan V, Venkatesan R, Rai TS, Sud K and Singal PK: Common variants of inflammatory cytokine genes are associated with risk of nephropathy in type 2 diabetes among Asian Indians. PLoS One. 4:e51682009. View Article : Google Scholar : PubMed/NCBI

34 

Nazir N, Siddiqui K, Al-Qasim S and Al-Naqeb D: Meta-analysis of diabetic nephropathy associated genetic variants in inflammation and angiogenesis involved in different biochemical pathways. BMC Med Genet. 15:1032014. View Article : Google Scholar : PubMed/NCBI

35 

Pan F, Hua S, Luo Y, Yin D and Ma Z: Genetic susceptibility of early aseptic loosening after total hip arthroplasty: The influence of TIMP-1 gene polymorphism on Chinese Han population. J Orthop Surg. 9:1082014. View Article : Google Scholar

36 

Kumar M, Bhadoria DP, Dutta K, Singh S, Gupta J, Kumar R, Chhillar AK, Yadav V, Singh B and Sharma GL: Combinatorial effect of TIMP-1 and α1AT gene polymorphisms on development of chronic obstructive pulmonary disease. Clin Biochem. 44:1067–1073. 2011. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Saravani S, Yari D, Saravani R and Azadi Ahmadabadi C : Association of COL4A3 (rs55703767), MMP-9 (rs17576)and TIMP-1 (rs6609533) gene polymorphisms with susceptibility to type 2 diabetes. Biomed Rep 6: 329-334, 2017.
APA
Saravani, S., Yari, D., Saravani, R., & Azadi Ahmadabadi, C. . (2017). Association of COL4A3 (rs55703767), MMP-9 (rs17576)and TIMP-1 (rs6609533) gene polymorphisms with susceptibility to type 2 diabetes. Biomedical Reports, 6, 329-334. https://doi.org/10.3892/br.2017.856
MLA
Saravani, S., Yari, D., Saravani, R., Azadi Ahmadabadi, C. ."Association of COL4A3 (rs55703767), MMP-9 (rs17576)and TIMP-1 (rs6609533) gene polymorphisms with susceptibility to type 2 diabetes". Biomedical Reports 6.3 (2017): 329-334.
Chicago
Saravani, S., Yari, D., Saravani, R., Azadi Ahmadabadi, C. ."Association of COL4A3 (rs55703767), MMP-9 (rs17576)and TIMP-1 (rs6609533) gene polymorphisms with susceptibility to type 2 diabetes". Biomedical Reports 6, no. 3 (2017): 329-334. https://doi.org/10.3892/br.2017.856
Copy and paste a formatted citation
x
Spandidos Publications style
Saravani S, Yari D, Saravani R and Azadi Ahmadabadi C : Association of COL4A3 (rs55703767), MMP-9 (rs17576)and TIMP-1 (rs6609533) gene polymorphisms with susceptibility to type 2 diabetes. Biomed Rep 6: 329-334, 2017.
APA
Saravani, S., Yari, D., Saravani, R., & Azadi Ahmadabadi, C. . (2017). Association of COL4A3 (rs55703767), MMP-9 (rs17576)and TIMP-1 (rs6609533) gene polymorphisms with susceptibility to type 2 diabetes. Biomedical Reports, 6, 329-334. https://doi.org/10.3892/br.2017.856
MLA
Saravani, S., Yari, D., Saravani, R., Azadi Ahmadabadi, C. ."Association of COL4A3 (rs55703767), MMP-9 (rs17576)and TIMP-1 (rs6609533) gene polymorphisms with susceptibility to type 2 diabetes". Biomedical Reports 6.3 (2017): 329-334.
Chicago
Saravani, S., Yari, D., Saravani, R., Azadi Ahmadabadi, C. ."Association of COL4A3 (rs55703767), MMP-9 (rs17576)and TIMP-1 (rs6609533) gene polymorphisms with susceptibility to type 2 diabetes". Biomedical Reports 6, no. 3 (2017): 329-334. https://doi.org/10.3892/br.2017.856
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team