Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Biomedical Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9434 Online ISSN: 2049-9442
Journal Cover
May-2018 Volume 8 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2018 Volume 8 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Suppression of osteoclastogenesis via α2‑adrenergic receptors

  • Authors:
    • Kosuke Hamajima
    • Kazunori Hamamura
    • Andy Chen
    • Hiroki Yokota
    • Hironori Mori
    • Shoyoku Yo
    • Hisataka Kondo
    • Kenjiro Tanaka
    • Kyoko Ishizuka
    • Daisuke Kodama
    • Takao Hirai
    • Ken Miyazawa
    • Shigemi Goto
    • Akifumi Togari
  • View Affiliations / Copyright

    Affiliations: Department of Pharmacology, School of Dentistry, Aichi‑Gakuin University, Nagoya, Aichi 464‑8650, Japan, Department of Biomedical Engineering, Indiana University ‑ Purdue University Indianapolis, Indianapolis, ΙΝ 46202, USA, Laboratory of Neuropharmacology, School of Pharmacy, Aichi‑Gakuin University, Nagoya, Aichi 464‑8650, Japan, Laboratory of Medical Resources, School of Pharmacy, Aichi‑Gakuin University, Nagoya, Aichi 464‑8650, Japan, Department of Orthodontics, School of Dentistry, Aichi‑Gakuin University, Nagoya, Aichi 464‑8650, Japan
    Copyright: © Hamajima et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 407-416
    |
    Published online on: March 9, 2018
       https://doi.org/10.3892/br.2018.1075
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The sympathetic nervous system is known to regulate osteoclast development. However, the involvement of α2‑adrenergic receptors (α2‑ARs) in osteoclastogenesis is not well understood. In the present study, their potential role in osteoclastogenesis was investigated. Guanabenz, clonidine and xylazine were used as agonists of α2‑ARs, while yohimbine and idazoxan were employed as antagonists. Using RAW264.7 pre‑osteoclast and primary bone marrow cells, the mRNA expression of the osteoclast‑related genes nuclear factor of activated T‑cells, cytoplasmic 1 (NFATc1), tartrate‑resistant acid phosphatase (TRAP) and cathepsin K was evaluated following induction with receptor activator of nuclear factor κB ligand (RANKL). TRAP staining was also conducted to assess effects on osteoclastogenesis in mouse bone marrow cells in vitro. Administration of 5‑20 µM guanabenz (P<0.01, for RANKL‑only treatment), 20 µM clonidine (P<0.05, for RANKL‑only treatment) and 20 µM xylazine (P<0.05, for RANKL‑only treatment) attenuated RANKL‑induced upregulation of NFATc1, TRAP and cathepsin K mRNA. Furthermore, the reductions in these mRNAs by 10 µM guanabenz and 20 µM clonidine in the presence of RANKL were attenuated by 20 µM yohimbine or idazoxan (P<0.05). The administration of 5‑20 µM guanabenz (P<0.01, for RANKL‑only treatment) and 10‑20 µM clonidine (P<0.05, for RANKL‑only treatment) also decreased the number of TRAP‑positive multi‑nucleated osteoclasts. Collectively, the present study demonstrates that α2‑ARs may be involved in the regulation of osteoclastogenesis.

Introduction

Numerous studies have reported that the central and peripheral sympathetic nervous systems serve important roles in bone remodeling and bone fracture healing (1–4). Particularly, bone-forming osteoblasts and bone-resorbing osteoclasts are established to express α- and β-adrenergic receptors (α- and β-ARs) (5–7). In osteoblastogenesis, it has been documented that α1-ARs promote cell proliferation through the suppression of potassium channels (8). Additionally, α1B-AR signaling may stimulate bone formation through the promotion of proliferation via upregulation of CCAAT/enhancer-binding protein δ in osteoblasts (9). Furthermore, it has been reported that leptin binding to hypothalamic receptors contributed to the regulation of bone homeostasis via β2-ARs (1), and that these β2-ARs inhibited cyclic-adenosine monophosphate (c-AMP)-responsive element-binding protein phosphorylation, leading to a decrease in osteoblast proliferation (10). α1-AR agonist but not β2-AR agonist may also induce fracture callus contraction via promotion of osteogenesis (11).

In osteoclastogenesis, it has been documented that an agonist to β-AR (isoprenaline) could promote bone-resorbing activity in human osteoclast-like cells (6). Furthermore, β2-ARs have been reported to stimulate osteoclastogenesis via reactive oxygen species generation (12). A key feature of ARs in bone remodeling is their ability to mediate interactions of osteoblasts with osteoclasts, since activation of α1- and β-ARs induces expression of receptor activator of nuclear factor κB (NF-κB) ligand (RANKL) in osteoblasts, resulting in RANKL-driven promotion of osteoclastogenesis (13–15). To the best of our knowledge, however, little is known of the role of agonists to α-ARs in the development of osteoclast precursors.

α2-ARs, the prime focus in the present study, belong to the G-protein-coupled receptor (GPCR) family. There are three α2-AR subtypes (α2A, α2B and α2C), which are established to regulate various physiological functions via suppression of adenylyl cyclase and reduction of c-AMP (16–21). For instance, α2-ARs on presynaptic membranes may inhibit norepinephrine secretion from sympathetic nerves (16). It has also been reported that α2A-AR serves a principal role in the hypotensive response (17), and that it is a primary mediator of sedative, analgesic and anesthetic-sparing responses (18). Furthermore, α2A-AR on pancreatic β-cells has been documented to inhibit insulin secretion (19). Although α2-ARs have been established to serve various roles in homeostasis, little is understood of their direct involvement in osteoclastogenesis.

In the current study, RAW264.7 pre-osteoclast cells and primary bone marrow cells were used to evaluate the role of α2-ARs in osteoclastogenesis. In the presence and absence of α2-AR agonists (guanabenz, clonidine and xylazine) and α2-AR antagonists (yohimbine and idazoxan), these cells were cultured in an osteoclast differentiation medium. Real-time quantitative polymerase chain reaction (qPCR) and tartrate-resistant acid phosphatase (TRAP) staining, as well as western blot analysis, were then conducted to determine the effects of these agonists and antagonists in osteoclastogenesis.

Materials and methods

Animals

To harvest bone marrow cells, C57BL/6J mice were purchased from Chubu Kagaku Shizai Co., Ltd. (Nagoya, Japan). A total of 35 female mice (8–10 weeks old) were used in the current study. The mice were housed under a 12-h light/dark cycle, and water and food were provided ad libitum. The protocols for animal experiments were approved by the Aichi-Gakuin University Animal Research Committee (Nagoya, Japan).

Cell culture

After the female mice were scarified by cervical dislocation, mouse bone marrow cells were isolated from long bones (femur and tibia). For isolation of the bone marrow cells, the distal and proximal ends of the long bone were removed. Using a needle (25G), the bone marrow cavity was flushed out with phosphate-buffered saline. The buffer was then filtered with a cell strainer (100 µm; BD Falcon™; BD Biosciences, Durham, NC, USA) and the filtered solution consisting of bone marrow derived cells was used (22). The mouse bone marrow cells as well as murine RAW264.7 pre-osteoclast cells obtained from American Type Culture Collection (Manassas, VA, USA) were cultured in α-Minimum Essential Media containing 10% fetal bovine serum and antibiotics (100 U/ml penicillin, 100 µg/ml streptomycin; Wako Pure Chemical Industries, Ltd., Osaka, Japan). The cells were maintained at 37°C with 5% CO2 in a humidified incubator.

In vitro osteoclast formation and TRAP staining

Mouse bone marrow cells were plated at densities of 1.2×105 and 1.0×106 cells into 12-well and 60-mm dishes, respectively, and cultured with 10 ng/ml macrophage colony-stimulating factor (M-CSF; PeproTech, Inc., Rocky Hill, NJ, USA) at 37°C for 3 days. The surface-attached cells were used as osteoclast precursors (22). These cells were cultured with 10 ng/ml M-CSF and 50 ng/ml RANKL (PeproTech, Inc.). A total of 5–20 µM guanabenz (R&D Systems, Inc., Minneapolis, MN, USA) or 10–20 µM xylazine (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) was applied at the same time point as RANKL; 10–20 µM clonidine (Sigma-Aldrich; Merck KGaA) was administered with RANKL or 1 day after RANKL administration. After a 60-h treatment with RANKL at 37°C, cells were fixed in 10% formalin neutral buffer solution at room temperature and stained with TRAP for 1 h at 37°C. The number of TRAP-positive cells containing three or more nuclei was determined. All positive cells in each well were counted using a light microscope (magnification, ×100; Zeiss AG, Oberkochen, Germany).

RAW264.7 cells were plated at 1.0×105 cells into 60-mm dishes and cultured with 25 ng/ml RANKL in the presence or absence of 5–20 µM guanabenz, 10–20 µM clonidine or 10–20 µM xylazine with or without 10–20 µM yohimbine or 10–20 µM idazoxan (Sigma-Aldrich; Merck KGaA) at 37°C for 2–4 days for qPCR analysis.

Reverse transcription-qPCR

Mouse bone marrow cells and RAW264.7 cells were treated with RANKL and α2 agonists/antagonists at 37°C for 2–4 days prior to qPCR analysis. Total RNA was extracted using an RNeasy Plus Mini kit (Qiagen Sciences, Inc., Gaithersburg, MD, USA). Reverse transcription was conducted with a High-Capacity cDNA Reverse Transcription kit (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA), and real-time qPCR was performed using a Takara Thermal Cycler Dice Real Time System III (Takara Bio, Inc., Otsu, Japan) with Thunderbird SYBR qPCR mix (Toyobo Life Science, Osaka, Japan). The PCR cycling conditions were 95°C for 10 min (pre-denaturation), 40 cycles at 95°C for 15 sec (denaturation) and 60°C for 1 min (extension). The mRNA levels of α2A-, α2B-, and α2C-ARs, nuclear factor of activated T-cells, cytoplasmic 1 (NFATc1), TRAP and cathepsin K were evaluated with the PCR primers listed in Table I. The expression of GAPDH was used as the internal control. The PCR results were interpreted using the 2−ΔΔCq method (23).

Table I.

Real-time polymerase chain reaction primers used in the present study.

Table I.

Real-time polymerase chain reaction primers used in the present study.

Primer sequence (5′-3′)

TargetForwardReverse
α2A-AR GGTGTGTTGGTTTCCGTTCT CGGAAGTCGTGGTTGAAGAT
α2B-AR TCGGAGAGGCTAATGGACAC TCTTCAGCTCCCTTCTCTGC
α2C-AR (ref. 7) CATGGGCGTGTTCGTACTGT CAGGCCTCACGGCAGATG
Cathepsin K CAGCTTCCCCAAGATGTGAT AGCACCAACGAGAGGAGAAA
NFATc1 GGTGCTGTCTGGCCATAACT GCGGAAAGGTGGTATCTCAA
TRAP TCCTGGCTCAAAAAGCAGTT ACATAGCCCACACCGTTCTC
GAPDH TGCACCACCAACTGCTTAG GGATGCAGGGATGATGTTC

[i] α2-AR, α2-adrenergic receptors; NFATc1, nuclear factor of activated T-cells, cytoplasmic 1; TRAP, tartrate-resistant acid phosphatase.

Western blot analysis

RAW264.7 cells were lysed in 1X radioimmunoprecipitation assay buffer containing protease inhibitors (Santa Cruz Biotechnology, Inc., Dallas, TX, USA) and phosphatase inhibitors (Merck KGaA). Isolated proteins were quantified using a Pierce bicinchoninic acid protein assay kit (Thermo Fisher Scientific, Inc.). A total of 10 µg protein per lane was fractioned using 10% SDS gels and electro-transferred to Immobilon-P membranes (EMD Millipore, Billerica, MA, USA). The membranes were blocked with 1% nonfat dry milk at 4°C for overnight (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The membranes were then incubated for 1 h at room temperature with primary antibodies followed by a 45-min incubation at room temperature with goat anti-rabbit (2,000-fold dilution) or anti-mouse (2,000-fold dilution) immunoglobulin G conjugated with horseradish peroxidase (cat. nos. 7074 and 7076, respectively; Cell Signaling Technology, Inc., Danvers, MA, USA). The primary antibodies used were against eukaryotic translation initiation factor 2α (eIF2α; 1,000-fold dilution; cat. no. 9722; Cell Signaling Technology, Inc.), phosphorylated (p)-eIF2α (1,000-fold dilution; cat. no. PA1-26686; Thermo Fisher Scientific, Inc.) and β-actin (10,000-fold dilution; cat. no. A5441; Sigma-Aldrich; Merck KGaA). Protein levels were assayed using a SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific, Inc.). To determine band intensities, images were scanned with a luminescent image analyzer (LAS-3000; Fujifilm, Tokyo, Japan) and quantified using Image J v1.48 (National Institutes of Health, Bethesda, MD, USA).

Statistical analysis

Statistical analyses were performed using Microsoft Excel for Mac 2011 (version 14.6.9; Microsoft Corporation, Redmond, WA, USA). Data were expressed as the mean ± standard deviation of three to five independent experiments. Statistical significance was evaluated using Student's t-test at P<0.05.

Results

mRNA expression of α2-ARs

The mRNA levels of α2A-, α2B- and α2C-ARs were determined. All three of the α2-ARs were detectable (Fig. 1). However, the responses to RANKL differed between RAW264.7 and primary bone marrow cells. RANKL administration on days 0, 2 and 4 did not significantly alter the mRNA levels of α2-ARs in RAW264.7 cells (Fig. 1A); while it significantly altered their mRNA levels in primary bone marrow cells when detected after 2 days. Specifically, the mRNA expression of α2A- and α2C-ARs was significantly downregulated by RANKL administration (P<0.01 and P<0.05, respectively), while that of α2B-AR was upregulated (P<0.01; Fig. 1B).

Figure 1.

mRNA expression of α2-ARs. (A) mRNA levels of α2A-, α2B- and α2C-ARs on days 0, 2 and 4 after administration of RANKL in RAW264.7 cells. (B) mRNA levels of α2A-, α2B- and α2C-ARs on days 0 and 2 after administration of RANKL in primary bone marrow cells. *P<0.05 and **P<0.01 vs. day 0. α2-AR, α2-adrenergic receptors; RANKL, receptor activator of nuclear factor κB ligand.

α2-AR agonist-driven reduction in the expression of osteoclast genes

On day 2 following the administration of RANKL, the mRNA levels of NFATc1, TRAP and cathepsin K were significantly reduced by 5–20 µM guanabenz in RAW264.7 and primary bone marrow cells (P<0.01; Fig. 2). Administration of 20 µM clonidine consistently suppressed RANKL-induced upregulation of NFATc1, TRAP and cathepsin K on days 2 and 4 in RAW264.7 cells (P<0.05; Fig. 3A and B). In primary bone marrow cells, administration of 10–20 µM clonidine suppressed the mRNA levels of the osteoclast genes when clonidine was applied alongside RANKL (P<0.01; Fig. 3C). However, when clonidine was administered 1 day after the administration of RANKL, it did not alter the mRNA levels of NFATc1, TRAP or cathepsin K (Fig. 3D). The mRNA levels of these osteoclast genes were also consistently downregulated by 20 µM xylazine in RAW264.7 and primary bone marrow cells on day 2 after administration of RANKL (P<0.05; Fig. 4).

Figure 2.

Suppression of RANKL-induced osteoclast gene expression in response to guanabenz in RAW264.7 and primary bone marrow cells. (A) Guanabenz-induced inhibition of NFATc1, TRAP and cathepsin K on day 2 after administration of RANKL in RAW264.7 cells. (B) Guanabenz-induced inhibition of NFATc1, TRAP and cathepsin K on day 2 after administration of RANKL in primary bone marrow cells. **P<0.01 vs. RANKL-only treatment. NFATc1, nuclear factor of activated T-cells, cytoplasmic 1; TRAP, tartrate-resistant acid phosphatase; RANKL, receptor activator of nuclear factor κB ligand.

Figure 3.

Suppression of RANKL-induced osteoclast genes in response to clonidine in RAW264.7 and primary bone marrow cells. (A) Clonidine-induced inhibition of NFATc1, TRAP and cathepsin K on day 2 after administration of RANKL in RAW264.7 cells. (B) Clonidine-induced inhibition of NFATc1, TRAP and cathepsin K on day 4 after administration of RANKL in RAW264.7 cells. (C) Clonidine-induced inhibition of NFATc1, TRAP and cathepsin K on day 2 after administration of RANKL in primary bone marrow cells. (D) Undetectable alteration in the mRNA levels of NFATc1, TRAP and cathepsin K on day 2 by clonidine in primary bone marrow cells. Clonidine was applied at the same time point with RANKL in the experiment for (A-C) but was applied 1 day after administration of RANKL in the experiment for (D). *P<0.05 and **P<0.01 vs. RANKL-only treatment. NFATc1, nuclear factor of activated T-cells, cytoplasmic 1; TRAP, tartrate-resistant acid phosphatase; RANKL, receptor activator of nuclear factor κB ligand.

Figure 4.

Suppression of RANKL-driven osteoclast genes in response to xylazine in RAW264.7 and primary bone marrow cells. (A) Xylazine-induced inhibition of NFATc1, TRAP and cathepsin K on day 2 after administration of RANKL in RAW264.7 cells. (B) Xylazine-induced inhibition of NFATc1, TRAP and cathepsin K on day 2 after administration of RANKL in primary bone marrow cells. *P<0.05 and **P<0.01 vs. RANKL-only treatment. NFATc1, nuclear factor of activated T-cells, cytoplasmic 1; TRAP, tartrate-resistant acid phosphatase; RANKL, receptor activator of nuclear factor κB ligand.

Suppression of α2-AR agonist-driven reduction of osteoclast gene expression by yohimbine or idazoxan

The reduction in the mRNA levels of NFATc1, TRAP and cathepsin K in response to guanabenz and clonidine was consistently suppressed by 20 µM yohimbine (P<0.05; Fig. 5A and B) or 20 µM idazoxan (P<0.05; Fig. 6). This result indicates that α2-AR antagonists inhibit the action of α2-AR agonists, and also supports the notion that α2-ARs may be involved in regulation of osteoclast gene expression. Of note, administration of yohimbine alone upregulated the expression of the osteoclast genes at concentrations of 10 (P<0.05) and 20 (P<0.01) µM (Fig. 5C).

Figure 5.

Reduction in guanabenz and clonidine-induced suppression of osteoclast genes by yohimbine in RAW264.7 cells. (A) Reduction in guanabenz-induced suppression of NFATc1, TRAP and cathepsin K by yohimbine on day 2 after administration of RANKL in RAW264.7 cells. Note that the asterisks denote the comparison of RANKL with guanabenz. (B) Reduction in clonidine-induced suppression of NFATc1, TRAP and cathepsin K by yohimbine on day 2 after administration of RANKL in RAW264.7 cells. Note that the asterisks are to compare RANKL with clonidine. (C) Upregulation of NFATc1, TRAP and cathepsin K by yohimbine on day 2 after administration of RANKL in RAW264.7 cells. *P<0.05 and **P<0.01 vs. RANKL with guanabenz treatment; #P<0.05 and ##P<0.01 vs. RANKL with clonidine treatment; $P<0.05 and $$P<0.01 vs. RANKL-only treatment. NFATc1, nuclear factor of activated T-cells, cytoplasmic 1; TRAP, tartrate-resistant acid phosphatase; RANKL, receptor activator of nuclear factor κB ligand.

Figure 6.

Reduction in guanabenz-induced suppression of osteoclast genes by idazoxan in RAW264.7 cells. Reduction in guanabenz-induced suppression of NFATc1, TRAP and cathepsin K by idazoxan on day 2 after administration of RANKL in RAW264.7 cells. *P<0.05 and **P<0.01 vs. RANKL with guanabenz treatment. NFATc1, nuclear factor of activated T-cells, cytoplasmic 1; TRAP, tartrate-resistant acid phosphatase; RANKL, receptor activator of nuclear factor κB ligand.

Inhibitory effects of α2-AR agonist on osteoclastogenesis

In RANKL-induced primary bone marrow cells, guanabenz and clonidine suppressed osteoclastogenesis in a dose-dependent manner (Fig. 7). The number of TRAP-positive multi-nucleated osteoclasts was significantly reduced by 5, 10 and 20 µM guanabenz (P<0.01) and 10 and 20 µM clonidine (P<0.05 and P<0.01, respectively).

Figure 7.

Inhibitory effects of α2-adrenergic receptor agonist on the development of osteoclasts in the presence of 50 ng/ml RANKL. (A) Dose-dependent suppression of TRAP-positive multi-nucleated osteoclasts by guanabenz in bone marrow cells. (B) Dose-dependent suppression of TRAP-positive multi-nucleated osteoclasts by clonidine in primary bone marrow cells. *P<0.05 and **P<0.01 vs. RANKL-only treatment. RANKL, receptor activator of nuclear factor κB ligand; CN control.

Increase in eIF2α phosphorylation by guanabenz

Guanabenz is established to suppress osteoclastogenesis by inhibiting dephosphorylation of eIF2α (24–26). To determine whether clonidine and xylazine also inhibit dephosphorylation of eIF2α, the level of p-eIF2α was assessed in RAW264.7 cells. Western blot analysis demonstrated that administration of 20 µM guanabenz increased the phosphorylation of eIF2α (P<0.05), while treatment with 20 µM clonidine or xylazine did not significantly affect the phosphorylation level (Fig. 8).

Figure 8.

Inhibition of eIF2α dephosphorylation by guanabenz. (A) Elevated level of p-eIF2α in RAW264.7 cells following treatment with 20 µM guanabenz for 24 h. Notably, 20 µM clonidine and xylazine did not significantly alter phosphorylation level. (B) Relative intensities of (p-eIF2α)/(total eIF2α). *P<0.05 vs. RANKL-only treatment. eIF2α, eukaryotic translation initiation factor 2α; RANKL, receptor activator of nuclear factor κB ligand; p-, phosphorylated.

Discussion

The current study demonstrated that three chemical agents, guanabenz, clonidine and xylazine, which serve as α2-AR agonists, suppressed the mRNA expression of three osteoclast genes (NFATc1, TRAP and cathepsin K) in RAW264.7 and primary bone marrow cells, and reduced the number of TRAP-positive multi-nucleated osteoclasts in mouse bone marrow cells. Consistent with the observed involvement of α2-ARs in response to guanabenz and clonidine, administration of yohimbine and idazoxan, as α2-AR antagonists, suppressed the α2-AR agonist-induced reduction in the mRNA levels of the target genes. Compared with clonidine and xylazine, the results also indicated that the greater inhibitory effect of guanabenz in osteoclastogenesis may be associated with a guanabenz-driven elevation in p-eIF2α. Furthermore, the findings suggest that the responses to agents including clonidine may differ depending on the administration window during osteoclastogenesis.

Since yohimbine and idazoxan are established to serve as α2-AR antagonists (27), it was determined whether yohimbine and idazoxan could suppress the effect of α2-AR agonists including guanabenz and clonidine. The results demonstrated that administration of yohimbine or idazoxan suppressed α2-AR agonist-driven reduction in the expression of osteoclast genes. This indicates that the selected antagonists may block binding of agonists to α2-ARs. Notably, administration of yohimbine alone increased mRNA expression of the osteoclast genes. It has been reported that certain ionotropic receptors, including the γ-aminobutyric acid A receptors, as well as GPCRs, including adrenergic, histamine and adenosine receptors, are constitutively activated even in the absence of agonists, and this constitutive activity may be inhibited by so-called inverse agonists (28–32). For instance, adenosine A1 receptor is constitutively activated in osteoclast precursors and rolofylline, a receptor antagonist, has been reported to inhibit osteoclast differentiation as an inverse agonist (32). Yohimbine may also serve as an inverse agonist of α2-ARs, resulting in increased expression of osteoclast genes.

Although guanabenz, clonidine and xylazine are α2-AR agonists, there are differences in specificity among these agents. Guanabenz is known to inhibit dephosphorylation of eIF2α and attenuate endoplasmic reticulum stress, leading to downregulation of osteoclast genes and attenuation of osteoclastogenesis (24–26). Consistent with the action of guanabenz, western blot analysis revealed that administration of guanabenz to RAW264.7 cells elevated the level of p-eIF2α, while administration of clonidine or xylazine did not significantly alter the phosphorylation level. This result indicates that guanabenz serves as an inhibitor of eIF2α dephosphorylation, as well as an α2-AR agonist, and induces stronger suppression of osteoclast genes and attenuation of osteoclastogenesis compared with clonidine and xylazine.

The action of clonidine and guanabenz via α2-ARs is possibly mediated by c-AMP, since RANKL has been reported to increase the level of c-AMP in osteoclast precursors (33). Elevation of c-AMP may activate exchange protein directly activated by c-AMP (34,35), which has been documented to promote osteoclast differentiation via nuclear translocation of NF-κB (33). Furthermore, activation of an adenylyl cyclase followed by elevation of c-AMP upregulated c-Fos, which is established to promote osteoclast development (36,37). Since α2-ARs are known to suppress adenylyl cyclase and reduce c-AMP (21), and clonidine and guanabenz have been reported to reduce c-Fos expression (25,38), it is possible that the α2 agonists in the current study reduce RANKL-induced c-AMP, resulting in the suppression of osteoclastogenesis.

While clonidine served as an inhibitor of osteoclastogenesis in the current study, its effect during the course of osteoclastogenesis is not completely understood. A previous report identified that clonidine increased the number of TRAP-positive osteoclasts in mouse bone marrow cells, and that its administration did not alter the number of TRAP-positive osteoclasts in α2A and α2C double knockout mice (7). It has also been reported that the number of TRAP-positive osteoclasts was not affected by clonidine in cluster of differentiation 14+ osteoclast precursors (39). A major difference among these studies appears to be the timing of clonidine administration. In the current study, clonidine was applied on day 0 together with RANKL or 1 day after administration of RANKL, while it was administered on days 2 and 11 in the previous reports (7,39). The present study revealed that when clonidine was applied alongside RANKL in primary bone marrow cells, it suppressed the mRNA levels of NFATc1, TRAP and cathepsin K; however, when clonidine was administered 1 day after the administration of RANKL, it did not alter mRNA levels. Therefore, as the mRNA levels of α2A- and α2C-ARs in primary bone marrow cells were downregulated on day 2, it is possible that the efficacy of clonidine as an inhibitor may depend on the timing of its administration as well as the expression profiles of α2A and α2C receptors.

While it was demonstrated in the current study that α2-ARs on osteoclast precursors suppressed osteoclastogenesis, pre-clinical studies in laboratory animals are necessary prior to clinical studies and application in patients. As the current study was an in vitro analysis, animal studies using conditional knockout mice or other appropriate models are recommended to verify the present findings. Nonetheless, the results indicated that α2-ARs may be involved in the regulation of osteoclastogenesis in RAW264.7 and primary bone marrow cells in vitro.

Acknowledgements

Not applicable.

Funding

The current study was supported in part by the Grants-in-Aid for Scientific Research project of the Ministry of Education, Culture, Sports, Science and Technology, Japan (grant no. 17K11657, awarded to KaH) and by the National Institutes of Health, Bethesda, MD, USA (grant no. NIH R01AR52144, awarded to HY).

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Authors' contributions

KoH, KaH, HY, HK, KT, KI, DK, TH, KM, SG and AT designed the research. KoH, KaH, AC, HM and SY performed the experiments and analyzed the data. KaH wrote the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The protocols for animal experiments were approved by the Aichi-Gakuin University Animal Research Committee (Nagoya, Japan).

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Karsenty G: Convergence between bone and energy homeostases: Leptin regulation of bone mass. Cell Metab. 4:341–348. 2006. View Article : Google Scholar : PubMed/NCBI

2 

Togari A, Arai M and Kondo A: The role of the sympathetic nervous system in controlling bone metabolism. Expert Opin Ther Targets. 9:931–940. 2005. View Article : Google Scholar : PubMed/NCBI

3 

Elefteriou F, Campbell P and Ma Y: Control of bone remodeling by the peripheral sympathetic nervous system. Calcif Tissue Int. 94:140–151. 2014. View Article : Google Scholar : PubMed/NCBI

4 

Niedermair T, Kuhn V, Doranehgard F, Stange R, Wieskötter B, Beckmann J, Salmen P, Springorum H-R, Straub RH, Zimmer A, et al: Absence of substance P and the sympathetic nervous system impact on bone structure and chondrocyte differentiation in an adult model of endochondral ossification. Matrix Biol. 38:22–35. 2014. View Article : Google Scholar : PubMed/NCBI

5 

Togari A: Adrenergic regulation of bone metabolism: Possible involvement of sympathetic innervation of osteoblastic and osteoclastic cells. Microsc Res Tech. 58:77–84. 2002. View Article : Google Scholar : PubMed/NCBI

6 

Arai M, Nagasawa T, Koshihara Y, Yamamoto S and Togari A: Effects of beta-adrenergic agonists on bone-resorbing activity in human osteoclast-like cells. Biochim Biophys Acta. 1640:137–142. 2003. View Article : Google Scholar : PubMed/NCBI

7 

Fonseca TL, Jorgetti V, Costa CC, Capelo LP, Covarrubias AE, Moulatlet AC, Teixeira MB, Hesse E, Morethson P, Beber EH, et al: Double disruption of α2A- and α2C-adrenoceptors results in sympathetic hyperactivity and high-bone-mass phenotype. J Bone Miner Res. 26:591–603. 2011. View Article : Google Scholar : PubMed/NCBI

8 

Kodama D and Togari A: Noradrenaline stimulates cell proliferation by suppressing potassium channels via G(i/o) -protein-coupled α(1B) -adrenoceptors in human osteoblasts. Br J Pharmacol. 168:1230–1239. 2013. View Article : Google Scholar : PubMed/NCBI

9 

Tanaka K, Hirai T, Kodama D, Kondo H, Hamamura K and Togari A: α1B-Adrenoceptor signalling regulates bone formation through the up-regulation of CCAAT/enhancer-binding protein δ expression in osteoblasts. Br J Pharmacol. 173:1058–1069. 2016. View Article : Google Scholar : PubMed/NCBI

10 

Kajimura D, Hinoi E, Ferron M, Kode A, Riley KJ, Zhou B, Guo XE and Karsenty G: Genetic determination of the cellular basis of the sympathetic regulation of bone mass accrual. J Exp Med. 208:841–851. 2011. View Article : Google Scholar : PubMed/NCBI

11 

McDonald SJ, Dooley PC, McDonald AC, Djouma E, Schuijers JA, Ward AR and Grills BL: α(1) adrenergic receptor agonist, phenylephrine, actively contracts early rat rib fracture callus ex vivo. J Orthop Res. 29:740–745. 2011. View Article : Google Scholar : PubMed/NCBI

12 

Kondo H, Takeuchi S and Togari A: β-Adrenergic signaling stimulates osteoclastogenesis via reactive oxygen species. Am J Physiol Endocrinol Metab. 304:E507–E515. 2013. View Article : Google Scholar : PubMed/NCBI

13 

Takeuchi T, Tsuboi T, Arai M and Togari A: Adrenergic stimulation of osteoclastogenesis mediated by expression of osteoclast differentiation factor in MC3T3-E1 osteoblast-like cells. Biochem Pharmacol. 61:579–586. 2001. View Article : Google Scholar : PubMed/NCBI

14 

Nishiura T and Abe K: α1-adrenergic receptor stimulation induces the expression of receptor activator of nuclear factor kappaB ligand gene via protein kinase C and extracellular signal-regulated kinase pathways in MC3T3-E1 osteoblast-like cells. Arch Oral Biol. 52:778–785. 2007. View Article : Google Scholar : PubMed/NCBI

15 

Aitken SJ, Landao-Bassonga E, Ralston SH and Idris AI: Beta2-adrenoreceptor ligands regulate osteoclast differentiation in vitro by direct and indirect mechanisms. Arch Biochem Biophys. 482:96–103. 2009. View Article : Google Scholar : PubMed/NCBI

16 

Hein L, Altman JD and Kobilka BK: Two functionally distinct α2-adrenergic receptors regulate sympathetic neurotransmission. Nature. 402:181–184. 1999. View Article : Google Scholar : PubMed/NCBI

17 

MacMillan LB, Hein L, Smith MS, Piascik MT and Limbird LE: Central hypotensive effects of the alpha2a-adrenergic receptor subtype. Science. 273:801–803. 1996. View Article : Google Scholar : PubMed/NCBI

18 

Lakhlani PP, MacMillan LB, Guo TZ, McCool BA, Lovinger DM, Maze M and Limbird LE: Substitution of a mutant α2a-adrenergic receptor via ‘hit and run’ gene targeting reveals the role of this subtype in sedative, analgesic, and anesthetic-sparing responses in vivo. Proc Natl Acad Sci USA. 94:9950–9955. 1997. View Article : Google Scholar : PubMed/NCBI

19 

Fagerholm V, Haaparanta M and Scheinin M: α2-adrenoceptor regulation of blood glucose homeostasis. Basic Clin Pharmacol Toxicol. 108:365–370. 2011. View Article : Google Scholar : PubMed/NCBI

20 

Albarrán-Juárez J, Gilsbach R, Piekorz RP, Pexa K, Beetz N, Schneider J, Nürnberg B, Birnbaumer L and Hein L: Modulation of α2-adrenoceptor functions by heterotrimeric Galphai protein isoforms. J Pharmacol Exp Ther. 331:35–44. 2009. View Article : Google Scholar : PubMed/NCBI

21 

Storch U, Straub J, Erdogmus S, Gudermann T, Mederos Y and Schnitzler M: Dynamic monitoring of Gi/o-protein-mediated decreases of intracellular cAMP by FRET-based Epac sensors. Pflugers Arch. 469:725–737. 2017. View Article : Google Scholar : PubMed/NCBI

22 

Hamamura K, Chen A, Nishimura A, Tanjung N, Sudo A and Yokota H: Predicting and validating the pathway of Wnt3a-driven suppression of osteoclastogenesis. Cell Signal. 26:2358–2369. 2014. View Article : Google Scholar : PubMed/NCBI

23 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

24 

Hamamura K, Tanjung N and Yokota H: Suppression of osteoclastogenesis through phosphorylation of eukaryotic translation initiation factor 2 alpha. J Bone Miner Metab. 31:618–628. 2013. View Article : Google Scholar : PubMed/NCBI

25 

Hamamura K, Chen A, Tanjung N, Takigawa S, Sudo A and Yokota H: In vitro and in silico analysis of an inhibitory mechanism of osteoclastogenesis by salubrinal and guanabenz. Cell Signal. 27:353–362. 2015. View Article : Google Scholar : PubMed/NCBI

26 

Hamamura K, Tanjung N, Chen A, Yokota H and Togari A: Suppression of osteoclastogenesis via upregulation of Zfyve21 and Ddit4 by salubrinal and guanabenz. Oral Therap Pharmacol. 35:127–135. 2016.

27 

Wade SM, Lan K, Moore DJ and Neubig RR: Inverse agonist activity at the alpha(2A)-adrenergic receptor. Mol Pharmacol. 59:532–542. 2001. View Article : Google Scholar : PubMed/NCBI

28 

Strange PG: Mechanisms of inverse agonism at G-protein-coupled receptors. Trends Pharmacol Sci. 23:89–95. 2002. View Article : Google Scholar : PubMed/NCBI

29 

Milligan G: Constitutive activity and inverse agonists of G protein-coupled receptors: A current perspective. Mol Pharmacol. 64:1271–1276. 2003. View Article : Google Scholar : PubMed/NCBI

30 

Soudijn W, van Wijngaarden I and Ijzerman AP: Structure-activity relationships of inverse agonists for G-protein-coupled receptors. Med Res Rev. 25:398–426. 2005. View Article : Google Scholar : PubMed/NCBI

31 

Cotecchia S: Constitutive activity and inverse agonism at the α1adrenoceptors. Biochem Pharmacol. 73:1076–1083. 2007. View Article : Google Scholar : PubMed/NCBI

32 

He W, Wilder T and Cronstein BN: Rolofylline, an adenosine A1 receptor antagonist, inhibits osteoclast differentiation as an inverse agonist. Br J Pharmacol. 170:1167–1176. 2013. View Article : Google Scholar : PubMed/NCBI

33 

Mediero A, Perez-Aso and Cronstein BN: Activation of EPAC1/2 is essential for osteoclast formation by modulating NFκB nuclear translocation and actin cytoskeleton rearrangements. FASEB J. 28:4901–4913. 2014. View Article : Google Scholar : PubMed/NCBI

34 

de Rooij J, Zwartkruis FJ, Verheijen MH, Cool RH, Nijman SM, Wittinghofer A and Bos JL: Epac is a Rap1 guanine-nucleotide-exchange factor directly activated by cyclic AMP. Nature. 396:474–477. 1998. View Article : Google Scholar : PubMed/NCBI

35 

Ferrero JJ, Alvarez AM, Ramírez-Franco J, Godino MC, Bartolomé-Martín D, Aguado C, Torres M, Luján R, Ciruela F and Sánchez-Prieto J: β-Adrenergic receptors activate exchange protein directly activated by cAMP (Epac), translocate Munc13-1, and enhance the Rab3A-RIM1α interaction to potentiate glutamate release at cerebrocortical nerve terminals. J Biol Chem. 288:31370–31385. 2013. View Article : Google Scholar : PubMed/NCBI

36 

Aerts I, Grobben B, Van Ostade X and Slegers H: Cyclic AMP-dependent down regulation of ecto-nucleotide pyrophosphatase/phosphodiesterase 1 (NPP1) in rat C6 glioma. Eur J Pharmacol. 654:1–9. 2011. View Article : Google Scholar : PubMed/NCBI

37 

Inda C, Bonfiglio JJ, Dos Santos Claro PA, Senin SA, Armando NG, Deussing JM and Silberstein S: cAMP-dependent cell differentiation triggered by activated CRHR1 in hippocampal neuronal cells. Sci Rep. 7:19442017. View Article : Google Scholar : PubMed/NCBI

38 

El-Mas MM and Abdel-Rahman AA: Clonidine diminishes c-jun gene expression in the cardiovascular sensitive areas of the rat brainstem. Brain Res. 856:245–249. 2000. View Article : Google Scholar : PubMed/NCBI

39 

Limonard EJ, Schoenmaker T, de Vries TJ, Tanck MW, Heijboer AC, Endert E, Fliers E, Everts V and Bisschop PH: Clonidine increases bone resorption in humans. Osteoporos Int. 27:1063–1071. 2016. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Hamajima K, Hamamura K, Chen A, Yokota H, Mori H, Yo S, Kondo H, Tanaka K, Ishizuka K, Kodama D, Kodama D, et al: Suppression of osteoclastogenesis via α2‑adrenergic receptors. Biomed Rep 8: 407-416, 2018.
APA
Hamajima, K., Hamamura, K., Chen, A., Yokota, H., Mori, H., Yo, S. ... Togari, A. (2018). Suppression of osteoclastogenesis via α2‑adrenergic receptors. Biomedical Reports, 8, 407-416. https://doi.org/10.3892/br.2018.1075
MLA
Hamajima, K., Hamamura, K., Chen, A., Yokota, H., Mori, H., Yo, S., Kondo, H., Tanaka, K., Ishizuka, K., Kodama, D., Hirai, T., Miyazawa, K., Goto, S., Togari, A."Suppression of osteoclastogenesis via α2‑adrenergic receptors". Biomedical Reports 8.5 (2018): 407-416.
Chicago
Hamajima, K., Hamamura, K., Chen, A., Yokota, H., Mori, H., Yo, S., Kondo, H., Tanaka, K., Ishizuka, K., Kodama, D., Hirai, T., Miyazawa, K., Goto, S., Togari, A."Suppression of osteoclastogenesis via α2‑adrenergic receptors". Biomedical Reports 8, no. 5 (2018): 407-416. https://doi.org/10.3892/br.2018.1075
Copy and paste a formatted citation
x
Spandidos Publications style
Hamajima K, Hamamura K, Chen A, Yokota H, Mori H, Yo S, Kondo H, Tanaka K, Ishizuka K, Kodama D, Kodama D, et al: Suppression of osteoclastogenesis via α2‑adrenergic receptors. Biomed Rep 8: 407-416, 2018.
APA
Hamajima, K., Hamamura, K., Chen, A., Yokota, H., Mori, H., Yo, S. ... Togari, A. (2018). Suppression of osteoclastogenesis via α2‑adrenergic receptors. Biomedical Reports, 8, 407-416. https://doi.org/10.3892/br.2018.1075
MLA
Hamajima, K., Hamamura, K., Chen, A., Yokota, H., Mori, H., Yo, S., Kondo, H., Tanaka, K., Ishizuka, K., Kodama, D., Hirai, T., Miyazawa, K., Goto, S., Togari, A."Suppression of osteoclastogenesis via α2‑adrenergic receptors". Biomedical Reports 8.5 (2018): 407-416.
Chicago
Hamajima, K., Hamamura, K., Chen, A., Yokota, H., Mori, H., Yo, S., Kondo, H., Tanaka, K., Ishizuka, K., Kodama, D., Hirai, T., Miyazawa, K., Goto, S., Togari, A."Suppression of osteoclastogenesis via α2‑adrenergic receptors". Biomedical Reports 8, no. 5 (2018): 407-416. https://doi.org/10.3892/br.2018.1075
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team