Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Biomedical Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9434 Online ISSN: 2049-9442
Journal Cover
February-2021 Volume 14 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
February-2021 Volume 14 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Luteolin alters MUC1 extracellular domain, sT antigen, ADAM‑17, IL‑8, IL‑10 and NF‑κB expression in Helicobacter pylori‑infected gastric cancer CRL‑1739 cells: A preliminary study

  • Authors:
    • Iwona Radziejewska
    • Małgorzata Borzym‑Κluczyk
    • Katarzyna Leszczyńska
  • View Affiliations / Copyright

    Affiliations: Department of Medical Chemistry, Medical University of Białystok, Białystok, 15‑222 Podlaskie Voivodeship, Poland, Department of Pharmaceutical Biochemistry, Medical University of Białystok, Białystok, 15‑222 Podlaskie Voivodeship, Poland, Department of Microbiology, Medical University of Białystok, Białystok, 15‑222 Podlaskie Voivodeship, Poland
    Copyright: © Radziejewska et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 19
    |
    Published online on: November 25, 2020
       https://doi.org/10.3892/br.2020.1395
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Luteolin is a natural flavonoid possessing certain beneficial pharmacological properties, including anti‑oxidant, anti‑inflammatory, anti‑microbial and anti‑cancer properties. The majority of types of gastric cancer with chronic gastritis are caused by infection with Helicobacter pylori (H. pylori). The present study evaluated the effect of luteolin on a number of selected factors that are potentially involved in gastric cancer development. The study was performed using gastric cancer CRL‑1739 cells treated with 30 µM luteolin and H. pylori alone or combined. ELISA and reverse transcription PCR were used to assess the expression levels of MUC1, GalNAcα‑R (Tn antigen) and NeuAcα2‑3Galβ1‑3GalNAc‑R (sT antigen), ADAM‑17, IL‑8, IL‑10 and NF‑κB. H. pylori and luteolin independently and in combination significantly reduced the expression levels of the extracellular domain of MUC1 in gastric cancer cells compared with the untreated control cells. ADAM‑17 expression was reduced by treatment with the pathogen and luteolin. Additionally, both factors reduced sT antigen expression. Treatment with 30 ≤M luteolin significantly induced IL‑8 expression at the mRNA and protein level, and the mRNA expression levels of IL‑10 and NF‑κB compared with the control. Both H. pylori and luteolin induced IL‑8 protein expression. The present preliminary results suggest that luteolin may be used to treat patients with gastric cancer.

Introduction

Luteolin (3',4',5,7-tetrahydroxyflavone; Fig. 1), is a natural, dietary flavonoid commonly present at high concentrations in several types of fruits, vegetables and medicinal herbs (1,2). Flavonoids are polyphenols that serve an important role in defending plant cells against microorganisms, insects and UV irradiation (3). A number of previous studies have demonstrated that luteolin possesses beneficial pharmacological properties, including anti-oxidant, anti-inflammatory, anti-microbial and anti-cancer properties (4,5). Some of these properties could be functionally associated with each other. For example, the anti-inflammatory effects of luteolin may also be associated to its anti-cancer properties (6).

Figure 1

Structure of luteolin.

Infection with Helicobacter pylori (H. pylori), a bacterial carcinogen, is the greatest risk factor for development of gastric cancer, which is the fifth most common malignant disease and the third most common cause of cancer-associated mortality worldwide (7). It has been reported that ~75% of global cases of gastric cancer and 5.5% of malignancies worldwide may be attributed to H. pylori-induced inflammation and injury (8,9). However, the mechanisms that regulate cancer development in response to this organism are not well defined.

Altered glycosylation is considered to be one of the most common characteristic features of cancer, and is the most common post-translational modification of proteins occurring during neoplastic transformation (10). MUC1 mucin, transmembrane glycoprotein is expressed on the apical surfaces of most epithelia, including the stomach, and is the primary O-glycosylated protein of epithelial tissues. Generally, MUC1 is composed of two subunits, a long N-terminal extracellular domain and a short C-terminal tail, which remain associated through hydrogen bonds (11). The extracellular domain can be released from the cell surface by an additional proteolytic cleavage event, which has been implicated in the pathogenesis of inflammatory conditions and cancer (12,13). Release of the N-terminal domain can be induced via activation of specific enzymes, including the matrix metalloprotease a disintegrase and metalloprotease (ADAM) metallopeptidase domain 17 (ADAM-17) (14,15).

In cancer, the O-glycan chains attached to glycoproteins are often truncated and they commonly contain Tn (GalNAcα1-O-Ser/Thr) and T (Galβ1-3GalNAcα1-O-Ser/Thr) antigens and their sialylated forms (sTn and sT) (16). The aforementioned antigens are often markers of poorly differentiated adenocarcinomas and mucinous carcinoma, and their increased occurrence is associated with highly proliferative tumors, metastasis, and poor clinical outcomes (11).

The majority of types of gastric cancer are end products of an inflammatory process. Chronic H. pylori infection is characterized by inflammation of the gastric mucosa and is the major cause of chronic gastritis (9,17,18). IL-8 serves an important role in the response of epithelial cells to H. pylori infection, as well as in the pathological processes which ultimately result in gastric diseases. IL-8 is a chemokine that is specific to neutrophil granulocyte chemotaxis, and has been shown to be associated with the histological severity of gastritis. IL-8 secretion is typically regulated by the transcription factor NF-κB, and H. pylori can induce IL-8 expression by activating the NF-κB signaling pathway in gastric epithelial cells (19). IL-10 represents anti-inflammatory cytokines in general; there are several studies regarding the multifunctional roles of IL-10, including both its immunosuppressive and anti-angiogenic effects, and its varied roles in the pathogenesis, progression, metastasis, and development of several types of cancer (20,21).

The primary purpose of the present study was to determine the influence of luteolin on cancer-associated MUC1 (together with Tn and sT antigens), ADAM-17, the metalloprotease involved in the release the extracellular domain of MUC1, IL-8 and IL-10, which are associated with inflammation, and NF-κB, a transcription factor regulating the expression levels of a number of human genes. All these factors are potentially involved in cancer development. The present experiments were performed on H. pylori infected, gastric cancer CRL-1739 cells.

Materials and methods

Ethical approval and consent

The research protocol used in the present study was approved by the Ethics Committee of Medical University of Białystok (Białystok, Poland) and was performed in accordance with the 2008 Declaration of Helsinki (22). Written informed consent was obtained from the patient.

Bacteria and cell culture

One laboratory H. pylori strain from the Department of Microbiology of the Medical University of Białystok (Białystok, Poland) was used in the present study. It was isolated from gastric epithelial cells of a patient with gastritis. Prior to the beginning of treatment, the scrapings were collected from the prepyloric area and the body of the stomach under endoscopic examination. Immediately afterwards, the scrapings were transferred to the transport medium Portagerm pylori (bioMerieux SA) and homogenized. Subsequently, the bacteria were cultured on Pylori Agar and Columbia Agar supplemented with 5% sheep blood (bioMerieux SA) for 7 days at 37˚C under microaerophilic conditions using a Genbag microaer (bioMerieux SA). Bacteria were identified based on the colony morphology, using the Gram method (23). Additionally, the activities of bacterial urease, catalase and oxidase were determined as described previously (24,25). To determine the H. pylori species, an ELISA test (cat. no. HpAg48; EQUIPAR) was used. Subsequently the bacteria were sub-cultured under the same conditions, suspended at 1.2x109 bacteria/ml in PBS and added to growing gastric cancer cells at a multiplicity of infection of 10 for 24 h.

Gastric adenocarcinoma cells (CRL-1739; American Type Culture Collection) were cultured in F-12 medium containing 10% heat inactivated FBS (Thermo Fisher Scientific, Inc), 100 U/ml penicillin and 100 µg/ml streptomycin (Sigma-Aldrich; Merck KGaA) at 37˚C with 5% CO2. Cells were seeded in 6-well plates. A total of 24 h prior to H. pylori treatment, the cell medium was changed to antibiotic-free F-12 medium. Subsequently, media were supplemented with 30 µM luteolin alone or with bacteria, and cultured for 24 h. The cells were washed with PBS and lysed at 4˚C using RIPA buffer (Sigma-Aldrich; Merck KGaA) supplemented with protease inhibitors (1:200; Sigma-Aldrich; Merck KGaA). Culture media and lysates were centrifuged at 1,000 x g for 5 min at 4˚C, and supernatants were aliquoted, stored at -70˚C and used for ELISA. For reverse transcription-quantitative PCR (RT-qPCR), the monolayers were washed three times with sterile 10 mM PBS, and cell membranes were disrupted using a sonicator (Sonics Vibra Cell; Sonics & Materials, Inc). Aliquots of the homogenate were used for RNA isolation. Cells not treated with either luteolin or H. pylori addition were used as a control.

Cell viability assay

Cell viability assessment was performed as previously described by Carmichael et al (26), using MTT (Sigma-Aldrich; Merck KGaA). Confluent cells were cultured for 24 h with various concentrations of luteolin (20-100 µM; Sigma-Aldrich; Merck KGaA) in six-well plates, washed in PBS and incubated for 4 h in 1 ml MTT solution (0.5 mg/ml PBS) at 37˚C with 5% CO2. Absorbance of the converted dye in living cells was measured at a wavelength of 570 nm. Cell viability of gastric cancer cells in the presence of luteolin was calculated as a percentage of the control cells.

ELISA for MUC1, and the Tn and sT antigens

To assess the expression levels of MUC1 mucin, an ELISA with an anti-MUC1 monoclonal antibody (BC2; Abcam; cat. no. ab89492) was used according to the manufacturer's protocol. A total of 50 µl cell lysates (100 µg protein/ml) or 50 µl media (1:100) were coated on microtiter plates (NUNC F96; Maxisorp; Thermo Fisher Scientific, Inc.) at room temperature overnight. Following blocking with 100 µl 1% blocking reagent for ELISA, (Roche Diagnostics) and three washes with 100 µl PBS with 0.05% Tween-20 (Sigma-Aldrich; Merck KGaA), the plates were incubated with 100 µl anti-MUC1 antibody (1:600) for 2 h and horseradish peroxidase conjugated rabbit anti-mouse IgG (Sigma-Aldrich; Merck KGaA) for 1 h at room temperature. The colored reaction was developed by incubation with 100 µl 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (Sigma-Aldrich; Merck KGaA) liquid substrate for horseradish peroxidase. Absorbance at 405 nm was measured after 30-45 min. Wells treated with BSA (Sigma-Aldrich; Merck KGaA) were used as negative controls.

To assess the expression levels of GalNAc-R (Tn antigen) and NeuAcα2-3Gal (sT antigen), an ELISA-like test with biotinylated lectins (Vector Laboratories, Inc.; VVA lectin cat. no. B-1235; MAA II lectin cat. no. B-1265) at a concentration of 5 µg/ml was performed. VVA lectin (from Vicia villosa with binding preference to GalNAc) (27) and MAA II lectin (from Maackia amurensis with binding preference to NeuAcα2-3Gal) (28) were used. A total of 50 μl medium (dilution 1:100) was used to coat microtiter plates at room temperature overnight. Blocking and washing steps were performed as mentioned above. Subsequently, the plates were incubated with 100 µl proper lectins (2 h) and 100 µl horseradish peroxidase avidin D (Vector Laboratories) for 1 h at room temperature. The colored reaction was developed as described above. All samples were analyzed in triplicate in three independent experiments.

ELISA for IL-8

IL-8 expression was quantitatively determined using a commercially available ELISA capture and detection antibody kit (BD OptEIATM Set Human IL-8; BD Biosciences; cat. no. 2654KI) according to the manufacturer's protocol. Briefly, microwells of a 96-well plate were coated with 100 µl capture antibody (1:250) in bicarbonate buffer (pH 9.5; 0.1 M) and incubated overnight at 4˚C. The plates were washed three times with 200 µl PBS with Tween-20 (0.05%) between all the steps. Unbound sites were blocked with 200 µl PBS with 10% FBS (Sigma-Aldrich; Merck KGaA). Subsequently the cell culture media (50 µl; 1:100) were added and plates were incubated for 2 h at room temperature, followed by incubation with biotinylated detection antibody (1:250), peroxidase-labeled streptavidin and tetramethylbenzidine substrate (Sigma-Aldrich; Merck KGaA). Absorbance at 450 nm was measured after 30 min and IL-8 levels were determined from a standard curve prepared with serial dilutions of purified chemokines. All samples were analyzed in triplicate or quadruplicate, in three independent tests, and standard curves were plotted for each plate.

RT-qPCR

Total RNA was isolated using Total RNA Mini Plus Concentrator (A&A Biotechnology) according to the manufacturer's protocol. The concentration and purity of RNA was determined by spectrophotometry using a Nanodrop 2000 (Thermo Fisher Scientific, Inc.). First-strand cDNA was synthesized from 1 µg total RNA using a Tetro cDNA Synthesis kit (Bioline; Meridian Bioscience). The reaction mixture (volume, 20 µl) containing 1 µl oligo(dT)18 primer, 1 µl dNTP mixture (10 mM each), 5 µl 5X RT Buffer, 1 µl RiboSafe RNase Inhibitor (10 U/µl), 1 µl Tetro Reverse Transcriptase (200 U/µl) and diethylpyrocarbonate-treated water was incubated for 30 min at 45˚C and then inactivated at 85˚C for 5 min. qPCR assay was performed using a CFX96 Real-time system (Bio-Rad Laboratories, Inc.) and a SensiFASTTM SYBR kit (Bioline; Meridian Bioscience). The reaction mixtures contained 2 µl twice diluted cDNA template, 0.8 µl of each primer (10 µmol/l), 10 µl 2X SensiFAST SYBR mix and nuclease-free water to a final volume of 20 µl. Forward and reverse primer sequences are listed in Table I. The primers were synthesized by Genomed. GAPDH was used as the housekeeping gene. The thermocycling conditions were: 95˚C for 1 min to activate the DNA polymerase, followed by 40 cycles of denaturation for 10 sec at 95˚C, annealing for 15 sec at 60˚C and extension for 20 sec at 72˚C. The reaction was then subjected to a melting protocol from 55 to 95˚C in 0.2˚C increments and 1 sec holding at each increment to assess the specificity of the amplified products. Single product formation was confirmed by melting point analysis and agarose gel electrophoresis. As a negative control, water was used instead of mRNA samples. Samples were run in triplicate and the 2-ΔΔCq method was used to calculate the relative expression (29). The relative gene expression levels were standardized to those measured for the untreated control.

Table I

Sequences of primers used in the present study.

Table I

Sequences of primers used in the present study.

GeneForward primer, 5'-3'Reverse primer, 5'-3'
MUC1 TGCCTTGGCTGTCTGTCAGT GTAGGTATCCCGGGCTGGAA
NF-κB TACTCTGGCGCAGAAATTAGGTC CTGTCTCGGAGCTCGTCTATTTG
IL-8 TAGCAAAATTGAGGCCAAGG AAACCAAGGCACAGTGGAAC
IL-10 TGGTGAAACCCCGTCTCTAC CTGGAGTACAGGGGCAGTAT
ADAM-17 ACCTGAAGAGCTTGTTCATCGAG CCATGAAGTGTTCCGATAGATGTC
GAPDH GTGAACCATGAGAAGTATGACAA CATGAGTCCTTCCACGATAC
Statistical analysis

Experimental data are presented as the mean ± standard deviation of three experimental repeats. A one-way ANOVA followed by a Duncan's post hox test was used to analyze differences between the control and specific treatment groups. Statistica version 10.0 (StatSoft, Inc.) was used to statistically analyze the data. P<0.05 was considered to indicate a statistically significant difference.

Results

Cell viability

The effect of luteolin on a number of selected biochemical factors was examined in H. pylori infected gastric cancer CRL-1739 cells. In all experiments, 30 µM luteolin was used as a concentration, which was below the IC50 (Fig. 2).

Figure 2

Viability of the gastric cancer CRL-1739 cells treated with different concentrations of luteolin (20, 40, 60 and 100 µM). Cell viability was assessed using an MTT assay and results are presented as a percentage of the control. Data are presented as the mean ± standard deviation of three experimental repeats. ***P<0.001.

Determination of MUC1

MUC1 is the primary epithelial glycoprotein present in the gastric epithelium (11). As shown in Fig. 3A, H. pylori, luteolin and H. pylori combined with luteolin did not have significant effects on MUC1 mRNA expression compared with the untreated control. There was no significant change in MUC1 expression in the cell lysates (Fig. 3B). However, the examined factors notably reduced MUC1 extracellular domain expression in culture medium (Fig. 3C).

Figure 3

Effect of luteolin on MUC1 expression in gastric cancer CRL-1739 cells. Effect of (A) luteolin on MUC1 mRNA expression, MUC1 glycoproteins in (B) cell lysates and (C) culture supernatants. Cells were treated with 30 µM luteolin and H. pylori for 24 h. mRNA expression is expressed as the relative fold-change in MUC1 mRNA levels compared with the control, the expression of which was set as 1. For the ELISA of cell lysates, equivalent amounts of protein (5 µg/50 µl) was applied to each well. For culture supernatant, equivalent volumes (50 µl; 1:100) of sample was used. The results are presented as the absorbance at 405 nm after incubation with an anti-MUC1 monoclonal antibody. Data are presented as the mean ± standard deviation of three experimental repeats. *P<0.05, **P<0.01, ***P<0.001. MUC1, mucin 1; A, absorbance; H. pylori, Helicobacter pylori.

Determination of Tn and sT antigens

GalNAcα-R (Tn antigen) and NeuAcα2-3Galβ1-3GalNAc-R (sT antigen) are amongst the core sugar structures that are present on the extracellular domain of MUC1 mucin (11). The expression levels of Tn antigen (based on reactivity with VVA lectin) were not significantly affected by bacteria or luteolin (Fig. 4A). Sialylation of T antigen (detected by MAAII lectin) was significantly inhibited by flavonoid and H. pylori addition separately and by both agents combined, compared with the control (Fig. 4B).

Figure 4

Effect of luteolin on Tn and sT antigen expression. Effect of luteolin on (A) Tn and (B) sT antigen expression in the culture medium of gastric cancer CRL-1739 cells examined using ELISA. The cells were subjected to 30 µM luteolin and H. pylori for 24 h. The same aliquots of culture supernatants (50 µl; 1:100) were applied. The results are presented as the absorbance at 405 nm following incubation with biotinylated VVA (with specificity to T antigen) and MAAII (with specificity to sTn antigen) lectin. Data are presented as the mean ± standard deviation of three experimental repeats. **P<0.01, ***P<0.001. VVA lectin, lectin from Vicia villosa; MAAII lectin, lectin from Maackia amurensis; A, absorbance; H. pylori, Helicobacter pylori; Tn antigen, GalNAcα-R; sT antigen, NeuAcα2-3Galβ1-3GalNAc-R.

Determination of ADAM-17 levels

ADAM-17 is one of the sheddases that is responsible for the release of MUC1 extracellular domain. In all conditioned cultures, sheddase was markedly inhibited by the examined factors at the mRNA level (by 29, 78 and 68% for gastric cancer cells treated with H. pylori, luteolin independently and combined, respectively) compared with the untreated control (Fig. 5).

Figure 5

Effect of luteolin on ADAM-17 mRNA expression in gastric cancer CRL-1739 cells. Cells were treated with 30 µM luteolin and H. pylori for 24 h. Results are expressed as the relative fold-change in MUC1 mRNA expression compared with the control, the expression of which was set as 1. Data are presented as the mean ± standard deviation of three experimental repeats. ***P<0.001. ADAM-17, ADAM metallopeptidase domain 17; MUC1, mucin 1; H. pylori, Helicobacter pylori.

Determination of IL-8 and IL-10

IL-8 is a proinflammatory chemokine that is considered to be an important regulatory factor in the tumor environment. Fig. 6 shows a marked stimulatory effect of luteolin on IL-8 expression at both the mRNA (Fig. 6A) and protein (Fig. 6B) levels compared with the untreated control. The protein expression levels of IL-8 were also stimulated by the simultaneous action of both examined factors compared with the control. IL-10 is an inhibitory cytokine which can help tumor cells evade the immune system to avoid destruction by cell-mediated immune mechanisms. A marked increase in IL-10 mRNA expression following luteolin treatment was observed (Fig. 7).

Figure 6

Effect of luteolin on IL-8 expression in gastric cancer CRL-1739 cells. Effect of luteolin on (A) IL-8 mRNA and (B) IL-8 expression in cell culture supernatants were determined. Cells were treated with 30 µM luteolin and H. pylori for 24 h. For mRNA expression analysis, the results are expressed as the relative fold-change in MUC1 mRNA expression compared with the control, the expression of which was set as 1. For ELISA of culture supernatants, equivalent volumes (50 µl; 1:100) of samples were used. Results are expressed as ng of IL-8 per ml of culture medium. Data are presented as the mean ± standard deviation of three experimental repeats. *P<0.05, ***P<0.001. MUC1, mucin 1; H. pylori, Helicobacter pylori.

Figure 7

Effect of luteolin on IL-10 mRNA expression in gastric cancer CRL-1739 cells. Cells were treated with 30 µM luteolin and H. pylori for 24 h. Results are expressed as the relative fold-change in IL-10 mRNA expression compared with the control, the expression of which was set as 1. Data are presented as the mean ± standard deviation of three experimental repeats. **P<0.01; H. pylori, Helicobacter pylori.

Determination of NF-κB expression

NF-κB is a transcription factor modulated by numerous stimuli, and is able to regulate the expression levels of several human genes. As shown in Fig. 8, NF-κB mRNA expression was significantly increased by luteolin treatment by 87% compared with the untreated control.

Figure 8

Effect of luteolin on NF-κB mRNA expression in gastric cancer CRL-1739 cells. Cells were treated with 30 µM luteolin and H. pylori for 24 h. Results are presented as the relative fold-change in NF-κB mRNA expression compared with the control, expression of which was set as 1. Data are presented as the mean ± standard deviation of three experimental repeats. **P<0.01; H. pylori, Helicobacter pylori.

Discussion

Gastric cancer is one of the most common malignances worldwide, and is a serious risk to human health due to its asymptomatic course of development, nonspecific symptoms during the early stages and the high mortality rates associated with advanced stages (7,9). Furthermore, there are limited efficacious therapeutic strategies for treating advanced gastric cancer (30,31). Therefore, it remains a priority to develop novel therapeutic reagents for treatment of gastric cancer. Long-term consumption of fruit and vegetables reduces the risk of cancer (32). Therefore, identification of natural phytochemicals as potential anticancer agents may improve treatment as they are typically less toxic than chemotherapeutic agents, and thus, this approach has gained increasing attention (3,33,34).

Luteolin is a dietary flavonoid that has been reported to inhibit the development and progression of several different types of tumors (35,36). Pu et al (36) reported that luteolin reduced cell viability, induced cell cycle arrest, colony formation, proliferation and migration, and promoted apoptosis of gastric cancer MKN45 and BGC823 cells. According to Zang et al (37) luteolin inhibited gastric cancer progression via suppression of Notch 1 signaling and reversal of epithelial-mesenchymal transition in gastric cancer Hs-746T and MKN28 cells. Due to these promising results regarding the use of luteolin as an anti-cancer agent, the present study attempted to examine its effect on a number of other factors potentially involved in gastric cancer development. Since H. pylori is considered to be a causative agent of gastric cancer (8) H. pylori-infected gastric cancer cells were used, as well as the cells not treated with these bacteria.

Cancers are diverse and complex diseases based on multiple etiologies and various cell targets. A number of these targets are associated with cancer development, however, not all the relations have been identified. A possible target for cancer cells is MUC1 mucin with truncated O-glycans (11,38). The present study examined the effects of luteolin on a number of selected factors, which were all cancer-related; however not all of these appeared to be associated with cancer development or progression in the present study.

MUC1 mucin is considered to be an oncoprotein based on evidence which suggests its cancer-promoting function. MUC1 can activate anti-apoptotic proteins (Bcl-xL) (39), attenuate apoptosis execution pathways (40,41) and may contribute to metastasis (42). Furthermore, MUC1 is involved in H. pylori infection development via direct interaction with bacterial adhesins (17,43). To the best of our knowledge, there are no studies assessing the effects of luteolin on MUC1 mucin. The present study showed the inhibitory effects of bacteria and luteolin on the expression levels of the extracellular domain of MUC1 mucin, with a more potent effect being observed following luteolin treatment. Notably, this effect was not observed at the mRNA level. It has been suggested that ADAM-17 is involved in the release of MUC1 extracellular domain into the culture medium (14,15). The results of the present study appear to support this hypothesis, since ADAM-17 mRNA expression was associated increased MUC1 release into the culture medium. Additionally, ADAM-17 (also known as TNF-α-converting enzyme) has been identified to function as a signaling scissor in the tumor microenvironment, and thus contributes to tumorigenesis and tumor progression (44). Upregulation of ADAM-17 is associated with the progression of non-small cell lung cancer (45) or the promotion of breast cancer tumorigenesis by regulating cell proliferation, angiogenesis, invasion and apoptosis (46). Upregulation of ADAM-17 contributes to the progression of gastric cancer and is associated with a poor prognosis (47,48). Therefore, the enzyme is considered to be a potential target for treatment of cancer, as well as an indicator for predicting therapeutic outcomes. The present study revealed the inhibitory effect of luteolin on ADAM-17 gene expression, which appears to support the hypothesis regarding the potential anti-cancer effects of the examined flavonoids. Thus, it is hypothesized that luteolin is involved in the inhibition of degradation of ECM components by decreasing ADAM-17 expression.

In several types of cancer, O-glycan chains attached to glycoproteins, including MUC1 mucin, the primary O-glycoprotein of gastric epithelium, commonly contain short carbohydrate forms, Tn and T antigens and their sialylated derivatives. Their increased occurrence is associated with highly proliferative tumors, metastasis, and poor clinical outcomes (11,16). Loss or acquisition of glycans affects interactions of MUC1 and other cellular proteins implicated in the migratory and metastatic activities of cancer cells. Santos-Silva et al (49) showed that 53.2% of gastric carcinomas express the sT antigen, indicating that sialylation may contribute to the low frequency of cases observed with T antigen expression. The synthesis of the sT structure stops further processing and elongation of the carbohydrate chain (16). Yu et al (50) showed that the cancer-associated T antigen on MUC1 is the natural ligand of galectin-3, a galactose binding protein, which after connecting to MUC1, initiates MUC1-dependent intracellular signaling in cancer cells and facilitates adhesion of cancer cells to each other and to endothelial cells (51). Therefore, inhibition of sT structure expression by luteolin, which was observed in the present study, may be associated with its possible anti-cancer activity.

It has been stated that the interaction between H. pylori with the gastric epithelium induces the production of IL-8, which is a proinflammatory cytokine and chemotaxin for neutrophils and mononuclear cells, and this can lead to chronically activated gastritis (19). The majority of gastric cancer cases are the end products of an inflammatory process (19,20,52). A significant association between high expression levels of IL-8 in the gastric mucosa and the risk of gastric cancer has been reported previously (19,53). Furthermore, H. pylori can stimulate the secretion of IL-10, which has been recently recognized as the most potent anti-inflammatory cytokine, and also as the agent enabling cancer immune surveillance and tumor rejection (54). The results of the present study were not consistent with the aforementioned results, as H. pylori reduced IL-8 and IL-10 expression, in contrast to the previous studies. One possible explanation for this result could be that the action of the pathogen on gastric cancer cells was too short (24 h). Notably, in the present study, luteolin clearly increased expression of both cytokines at the mRNA level and IL-8 at the protein level as well. These results are not consistent with those reported in other studies which demonstrated the inhibition of IL-8 upregulation by the examined flavonoid (55,56). However, there is also at least one report regarding the stimulating effects of luteolin on IL-8 expression. Lee et al (57) showed that relatively low concentrations of luteolin (20 and 40 µM) increased the IL-8 levels, and only a high concentration of flavonoid (80 µM) was shown to decrease the expression levels of IL-8 in lung cancer cells.

It has been reported that direct contact of H. pylori and gastric cancer cells induces NF-κB activation (58). However, this result was not observed in the present study, and it was suggested that this could be due to the exposure of gastric cells to the pathogen being too short as mentioned above. Notably, luteolin induced NF-κB mRNA expression, which is not consistent with the general tendency of anti-inflammatory actions of the flavonoid via the NF-κB signaling pathway (58). At the current stage of the present study, this discrepancy cannot be explained. However, an association between the effect of luteolin on nuclear factor and IL-8 expression was revealed, in agreement with the general tendency of NF-κB to stimulate chemokine production (58).

Based on the preliminary results of the present study, it may be assumed that luteolin may be used as an adjuvant for treatment of gastric cancer. This hypothesis is particularly based on the outcomes concerning MUC1 extracellular domain, mRNA ADAM-17 and sT antigen expression. There are some discrepancies between the results of the present study and the results of previous studies, for example regarding IL-8, IL-10 and NF-κB levels. This requires further exploration in future experiments. There were also some shortcomings of the present study. The limitations include using only one cancer cell line and the lack of a normal cell line. However, it has been shown in other studies that the effects of luteolin are specific to cancer cells at the concentrations used in the present study (59). Additional experiments, such as apoptosis assays and cell cycle analysis, combined with the use of additional experimental methods, such as western blotting and immunofluorescence analysis should be performed to determine how luteolin regulates the changes in the examined factors and to identify the targets of the flavonoid. In future experiments, how H. pylori affects cells growth at different multiplicities of infection will be assessed. Other experiments where MUC1 or ADAM-17 are knocked down will also be performed.

Experimental and clinical data suggest that pharmacological regulation of various factors participating in cancer development exerts several beneficial effects improving the outcomes of different anti-cancer therapies. Dysregulation of cancer cells results from a number of genetic alterations, which impacts the signaling network and the control of numerous cellular processes. Thus, therapeutic targeting of specific factors may also elicit opposing, often unwanted effects. Therefore, extensive investigations are required to understand the molecular signaling pathway network for the development of synergistic complex therapies for cancer treatments.

Acknowledgements

The authors would like to thank Ms. Joanna Wosek (Department of Medical Chemistry, Medical University of Białystok (Białystok, Poland) for her technical support.

Funding

The present study was supported by the Medical University of Białystok (Białystok, Poland) (grant no. N/ST/15/004/2203).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

IR designed the study, interpreted the data and drafted the manuscript. MBK performed some of the experiments, assisted in interpretation of the data and performed the statistical analysis. KL performed some of the experiments and assisted in interpretation of the data. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The research protocol was approved by the Ethics Committee of Medical University of Białystok (Białystok, Poland) and was performed in accordance with the 2008 Declaration of Helsinki. Written informed consent was obtained the patient.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they no competing interests.

References

1 

Xiong J, Li S, Wang W, Hong Y, Tang K and Luo Q: Screening and identification of the antibacterial bioactive compounds from Lonicera japonica Thunb. leaves. Food Chem. 138:327–333. 2013.PubMed/NCBI View Article : Google Scholar

2 

López-Lázaro M: Distribution and biological activities of the flavonoid luteolin. Mini Rev Med Chem. 9:31–59. 2009.PubMed/NCBI View Article : Google Scholar

3 

Birt DF, Hendrich S and Wang W: Dietary agents in cancer prevention: Flavonoids and isoflavonoids. Pharmacol Ther. 90:157–177. 2001.PubMed/NCBI View Article : Google Scholar

4 

Lin Y, Shi R, Wang X and Shen HM: Luteolin, a flavonoid with potential for cancer prevention and therapy. Curr Cancer Drug Targets. 8:634–646. 2008.PubMed/NCBI View Article : Google Scholar

5 

Nepali S, Son JS, Poudel B, Lee JH, Lee YM and Kim DK: Luteolin is a bioflavonoid that attenuates adipocyte-derived inflammatory responses via suppression of nuclear factor-κB/mitogen-activated protein kinases pathway. Pharmacogn Mag. 11:627–635. 2015.PubMed/NCBI View Article : Google Scholar

6 

Johnson JL and Gonzalez de Mejia E: Interactions between dietary flavonoids apigenin or luteolin and chemotherapeutic drugs to potentiate anti-proliferative effect on human pancreatic cancer cells, in vitro. Food Chem Toxicol. 60:83–91. 2013.PubMed/NCBI View Article : Google Scholar

7 

Siegel R, Ma J, Zou Z and Jemal A: Cancer statistics, 2014. CA Cancer J Clin. 64:9–29. 2014.PubMed/NCBI View Article : Google Scholar

8 

Amieva M and Peek RM Jr: Pathobiology of Helicobacter pylori -induced gastric cancer. Gastroenterology. 150:64–78. 2016.PubMed/NCBI View Article : Google Scholar

9 

Ang TL and Fock KM: Clinical epidemiology of gastric cancer. Singapore Med J. 55:621–628. 2014.PubMed/NCBI View Article : Google Scholar

10 

Christiansen MN, Chik J, Lee L, Anugraham M, Abrahams JL and Packer NH: Cell surface protein glycosylation in cancer. Proteomics. 14:525–546. 2014.PubMed/NCBI View Article : Google Scholar

11 

Cascio S and Finn OJ: Intra- and extra-cellular events related to altered glycosylation of MUC1 promote chronic inflammation, tumor progression, innovation and metastasis. Biomolecules. 6(E39)2016.PubMed/NCBI View Article : Google Scholar

12 

Hollingsworth MA and Swanson BJ: Mucins in cancer: Protection and control of the cell surface. Nat Rev Cancer. 4:45–60. 2004.PubMed/NCBI View Article : Google Scholar

13 

Mukhopadhyay P, Chakraborty S, Ponnusamy MP, Lakshmanan I, Jain M and Batra SK: Mucins in the pathogenesis of breast cancer: Implications in diagnosis, prognosis and therapy. Biochim Biophys Acta. 1815:224–240. 2011.PubMed/NCBI View Article : Google Scholar

14 

Thathiah A, Blobel CP and Carson DD: Tumor necrosis factor-α converting enzyme/ADAM 17 mediates MUC1 shedding. J Biol Chem. 278:3386–3394. 2003.PubMed/NCBI View Article : Google Scholar

15 

Goth CK, Halim A, Khetarpal SA, Rader DJ, Clausen H and Schjoldager KT: A systematic study of modulation of ADAM-mediated ectodomain shedding by site-specific O-glycosylation. Proc Natl Acad Sci USA. 112:14623–14628. 2015.PubMed/NCBI View Article : Google Scholar

16 

Fu C, Zhao H, Wang Y, Cai H, Xiao Y, Zeng Y and Chen H: Tumor-associated antigens: Tn antigen, sTn antigen, and T antigen. HLA. 88:275–286. 2016.PubMed/NCBI View Article : Google Scholar

17 

Lillehoj EP, Guang W, Ding H, Czinn SJ and Blanchard TG: Helicobacter pylori and gastric inflammation: Role of MUC1 mucin. J Pediatr Biochem. 2:125–132. 2012.PubMed/NCBI View Article : Google Scholar

18 

Wang F, Meng W, Wang B and Qiao L: Helicobacter pylori-induced gastric inflammation and gastric cancer. Cancer Lett. 345:196–202. 2014.PubMed/NCBI View Article : Google Scholar

19 

Lee KE, Khoi PN, Xia Y, Park JS, Joo YE, Kim KK, Choi SY and Jung YD: Helicobacter pylori and interleukin-8 in gastric cancer. World J Gastroenterol. 19:8192–8202. 2013.PubMed/NCBI View Article : Google Scholar

20 

Ahmad N, Ammar A, Storr SJ, Green AR, Rakha E, Ellis IO and Martin SG: IL-6 and IL-10 are associated with good prognosis in early stage invasive breast cancer patients. Cancer Immunol Immunother. 67:537–549. 2018.PubMed/NCBI View Article : Google Scholar

21 

Fasoulakis Z, Kolios G, Papamanolis V and Kontomanolis EN: Interleukins associated with breast cancer. Cureus. 10(e.3549)2018.PubMed/NCBI View Article : Google Scholar

22 

Puri KS, Suresh KR, Gogtay NJ and Thatte UM: Declaration of Helsinki, 2008: Implications for stakeholders in research. J Postgrad Med. 55:131–134. 2009.PubMed/NCBI View Article : Google Scholar

23 

Beveridge TJ: Use of the gram stain in microbiology. Biotech Histochem. 76:111–118. 2001.PubMed/NCBI

24 

Uotani T and Graham DY: Diagnosis of Helicobacter pylori using the rapid urease test. Ann Transl Med. 3:9–7. 2015.PubMed/NCBI View Article : Google Scholar

25 

Bai Y, Zhang YL, Jin JF, Wang JD, Zhang ZS and Zhou DY: Recombinant Helicobacter pylori catalase. World J Gastroenterol. 9:1119–1122. 2003.PubMed/NCBI View Article : Google Scholar

26 

Carmichael J, DeGraff WG, Gazdar AF, Minna JD and Mitchell JB: Evaluation of a tetrazolium-based semiautomated colorimetric assay: Assessment of chemosensitivity testing. Cancer Res. 47:936–942. 1987.PubMed/NCBI

27 

Puri KD, Gopalakrishnan B and Surolia A: Carbohydrate binding specificity of the Tn-antigen binding lectin from Vicia villosa seeds (VVLB4). FEBS Lett. 312:208–212. 1992.PubMed/NCBI View Article : Google Scholar

28 

Redelinghuys P, Antonopoulos A, Liu Y, Campanero-Rhodes MA, McKenzie E, Haslam SM, Dell A, Feizi T and Crocker PR: Early murine T-lymphocyte activation is accompanied by a switch from N-Glycolyl- to N-acetyl-neuraminic acid and generation of ligands for siglec-E. J Biol Chem. 286:34522–34532. 2011.PubMed/NCBI View Article : Google Scholar

29 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar

30 

Zong L, Abe M, Seto Y and Ji J: The challenge of screening for early gastric cancer in China. Lancet. 388(2606)2016.PubMed/NCBI View Article : Google Scholar

31 

Cervantes A, Roda D, Tarazona N, Roselló S and Pérez-Fidalgo JA: Current questions for the treatment of advanced gastric cancer. Cancer Treat Rev. 39:60–67. 2013.PubMed/NCBI View Article : Google Scholar

32 

Wang X, Ouyang Y, Liu J, Zhu M, Zhao G, Bao W and Hu FB: Fruit and vegetable consumption and mortality from all causes, cardiovascular disease, and cancer: Systematic review and dose-response meta-analysis of prospective cohort studies. BMJ. 349(g4490)2014.PubMed/NCBI View Article : Google Scholar

33 

Ranjan A, Ramachandran S, Gupta N, Kaushik I, Wright S, Srivastava S, Das H, Srivastava S, Prasad S and Srivastava SK: Role of phytochemicals in cancer prevention. Int J Mol Sci. 20(4981)2019.PubMed/NCBI View Article : Google Scholar

34 

Chikara S, Nagaprashantha LD, Singhal J, Horne D, Awasthi S and Singhal SS: Oxidative stress and dietary phytochemicals: Role in cancer chemoprevention and treatment. Cancer Lett. 413:122–134. 2018.PubMed/NCBI View Article : Google Scholar

35 

Ma L, Peng H, Li K, Zhao R, Li L, Yu Y, Wang X and Han Z: Luteolin exerts an anticancer effect on NCI-H460 human non-small cell lung cancer cells through the induction of Sirt1-mediated apoptosis. Mol Med Rep. 12:4196–4202. 2015.PubMed/NCBI View Article : Google Scholar

36 

Pu Y, Zhang T, Wang J, Mao Z, Duan B, Long Y, Xue F, Liu D, Liu S and Gao Z: Luteolin exerts an anticancer effect on gastric cancer cells through multiple signaling pathways and regulating miRNAs. J Cancer. 9:3669–3675. 2018.PubMed/NCBI View Article : Google Scholar

37 

Zang MD, Hu L, Fan ZY, Wang HX, Zhu ZL, Cao S, Wu XY, Li JF, Su LP, Li C, et al: Luteolin suppresses gastric cancer progression by reversing epithelial-mesenchymal transition via suppression of the Notch signaling pathway. J Transl Med. 15(52)2017.PubMed/NCBI View Article : Google Scholar

38 

Bhatia R, Gautam SK, Cannon A, Thompson C, Hall BR, Aithal A, Banerjee K, Jain M, Solheim JC, Kumar S, et al: Cancer-associated mucins: Role in immune modulation and metastasis. Cancer Metastasis Rev. 38:223–236. 2019.PubMed/NCBI View Article : Google Scholar

39 

Raina D, Kharbanda S and Kufe D: The MUC1 oncoprotein activates the anti-apoptotic phosphoinositide 3-kinase/Akt and Bcl-xL pathways in rat 3Y1 fibroblasts. J Biol Chem. 279:20607–20612. 2004.PubMed/NCBI View Article : Google Scholar

40 

Raina D, Ahmad R, Kumar S, Ren J, Yoshida K, Kharbanda S and Kufe D: MUC1 oncoprotein blocks nuclear targeting of c-Abl in the apoptotic response to DNA damage. EMBO J. 25:3774–3783. 2006.PubMed/NCBI View Article : Google Scholar

41 

Agata N, Ahmad R, Kawano T, Raina D, Kharbanda S and Kufe D: MUC1 oncoprotein blocks death receptor-mediated apoptosis by inhibiting recruitment of caspase-8. Cancer Res. 68:6136–6144. 2008.PubMed/NCBI View Article : Google Scholar

42 

Rahn JJ, Chow JW, Horne GJ, Mah BK, Emerman JT, Hoffman P and Hugh JC: MUC1 mediates transendothelial migration in vitro by ligating endothelial cell ICAM-1. Clin Exp Metastasis. 22:475–483. 2005.PubMed/NCBI View Article : Google Scholar

43 

Lindén SK, Sheng YH, Every AL, Miles KM, Skoog EC, Florin TH, Sutton P and McGuckin MA: MUC1 limits Helicobacter pylori infection both by steric hindrance and by acting as a releasable decoy. PLoS Pathog. 5(e1000617)2009.PubMed/NCBI View Article : Google Scholar

44 

Murphy G: The ADAMs: Signaling scissors in the tumour microenvironment. Nat Rev Cancer. 8:929–941. 2008.PubMed/NCBI View Article : Google Scholar

45 

Ni SS, Zhang J, Zhao WL, Dong XC and Wang JL: ADAM17 is overexpressed in non small cell lung cancer and its expression correlates with poor patient survival. Tumour Biol. 34:1813–1818. 2013.PubMed/NCBI View Article : Google Scholar

46 

Zhao J and Tang J: The role of ADAM17 in tumorigenesis and progression of breast cancer. Tumour Biol. 37:15359–15370. 2016.PubMed/NCBI View Article : Google Scholar

47 

Fang W, Qian J, Wu Q, Chen Y and Yu G: ADAM 17 expression is enhanced by FoxM1 and is a poor prognostic sign in gastric carcinoma. J Surg Res. 220:223–233. 2017.PubMed/NCBI View Article : Google Scholar

48 

Li W, Wang D, Sun X, Zhang Y, Wang L and Suo J: ADAM17 promotes lymph node metastasis in gastric cancer via activation of the Notch and Wnt signaling pathways. Int J Mol Med. 43:914–926. 2019.PubMed/NCBI View Article : Google Scholar

49 

Santos-Silva F, Fonseca A, Caffrey T, Carvalho F, Mesquita P, Reis C, Almeida R, David L and Hollingsworth MA: Thomsen-Friedenreich antigen expression in gastric carcinomas is associated with MUC1 mucin VNTR polymorphism. Glycobiology. 15:511–517. 2005.PubMed/NCBI View Article : Google Scholar

50 

Yu LG, Andrews N, Zhao Q, McKean D, Williams JF, Connor LJ, Gerasimenko OV, Hilkens J, Hirabayashi J, Kasai K, et al: Galectin-3 interaction with Thomsen-Friedenreich disaccharide on cancer-associated MUC1 causes increased cancer cell endothelial adhesion. J Biol Chem. 282:773–781. 2007.PubMed/NCBI View Article : Google Scholar

51 

Mori Y, Akita K, Yashiro M, Sawada T, Hirakawa K, Murata T and Nakada H: Binding of galectin-3, a β-galactoside-binding lectin, to MUC1 protein enhances phosphorylation of extracellular signal-regulated kinase 1/2 (ERK1/2) and Akt, promoting tumor cell malignancy. J Biol Chem. 290:26125–26140. 2015.PubMed/NCBI View Article : Google Scholar

52 

Peek RM Jr, Fiske C and Wilson KT: Role of innate immunity in Helicobacter pylori-induced gastric malignancy. Physiol Rev. 90:831–858. 2010.PubMed/NCBI View Article : Google Scholar

53 

Yamada S, Kato S, Matsuhisa T, Makonkawkeyoon L, Yoshida M, Chakrabandhu T, Lertprasertsuk N, Suttharat P, Chakrabandhu B, Nishiumi S, et al: Predominant mucosal IL-8 mRNA expression in non-cagA Thais is risk for gastric cancer. World J Gastroenterol. 19:2941–2949. 2013.PubMed/NCBI View Article : Google Scholar

54 

Mumm JB and Oft M: Pegylated IL-10 induces cancer immunity: The surprising role of IL-10 as a potent inducer of IFN-γ-mediated CD8(+) T cell cytotoxicity. Bioessays. 35:623–631. 2013.PubMed/NCBI View Article : Google Scholar

55 

Kim JA, Kim DK, Kang OH, Choi YA, Park HJ, Choi SC, Kim TH, Yun KJ, Nah YH and Lee YM: Inhibitory effect of luteolin on TNF-alpha-induced IL-8 production in human colon epithelial cells. Int Immunopharmacol. 5:209–217. 2005.PubMed/NCBI View Article : Google Scholar

56 

Nunes C, Almeida L, Barbosa RM and Laranjinha J: Luteolin suppresses the JAK/STAT pathway in a cellular model of intestinal inflammation. Food Funct. 8:387–396. 2017.PubMed/NCBI View Article : Google Scholar

57 

Lee YJ, Lim T, Han MS, Lee SH, Baek SH, Nan HY and Lee C: Anticancer effect of luteolin is mediated by downregulation of TAM receptor tyrosine kinases, but not interleukin-8, in non-small cell lung cancer cells. Oncol Rep. 37:1219–1226. 2017.PubMed/NCBI View Article : Google Scholar

58 

Sokolova O and Naumann M: NF-κB signaling in gastric cancer. Toxins (Basel). 9:1–22. 2017.PubMed/NCBI View Article : Google Scholar

59 

Imran M, Rauf A, Abu-Izneid T, Nadeem M, Shariati MA, Khan IA, Imran A, Orhan IE, Rizwan M, Atif M, et al: Luteolin, a flavonoid, as an anticancer agent: A review. Biomed Pharmacother. 112(108612)2019.PubMed/NCBI View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Radziejewska I, Borzym‑Κluczyk M and Leszczyńska K: Luteolin alters MUC1 extracellular domain, sT antigen, ADAM‑17, IL‑8, IL‑10 and NF‑κB expression in <em>Helicobacter</em> <em>pylori</em>‑infected gastric cancer CRL‑1739 cells: A preliminary study. Biomed Rep 14: 19, 2021.
APA
Radziejewska, I., Borzym‑Κluczyk, M., & Leszczyńska, K. (2021). Luteolin alters MUC1 extracellular domain, sT antigen, ADAM‑17, IL‑8, IL‑10 and NF‑κB expression in <em>Helicobacter</em> <em>pylori</em>‑infected gastric cancer CRL‑1739 cells: A preliminary study. Biomedical Reports, 14, 19. https://doi.org/10.3892/br.2020.1395
MLA
Radziejewska, I., Borzym‑Κluczyk, M., Leszczyńska, K."Luteolin alters MUC1 extracellular domain, sT antigen, ADAM‑17, IL‑8, IL‑10 and NF‑κB expression in <em>Helicobacter</em> <em>pylori</em>‑infected gastric cancer CRL‑1739 cells: A preliminary study". Biomedical Reports 14.2 (2021): 19.
Chicago
Radziejewska, I., Borzym‑Κluczyk, M., Leszczyńska, K."Luteolin alters MUC1 extracellular domain, sT antigen, ADAM‑17, IL‑8, IL‑10 and NF‑κB expression in <em>Helicobacter</em> <em>pylori</em>‑infected gastric cancer CRL‑1739 cells: A preliminary study". Biomedical Reports 14, no. 2 (2021): 19. https://doi.org/10.3892/br.2020.1395
Copy and paste a formatted citation
x
Spandidos Publications style
Radziejewska I, Borzym‑Κluczyk M and Leszczyńska K: Luteolin alters MUC1 extracellular domain, sT antigen, ADAM‑17, IL‑8, IL‑10 and NF‑κB expression in <em>Helicobacter</em> <em>pylori</em>‑infected gastric cancer CRL‑1739 cells: A preliminary study. Biomed Rep 14: 19, 2021.
APA
Radziejewska, I., Borzym‑Κluczyk, M., & Leszczyńska, K. (2021). Luteolin alters MUC1 extracellular domain, sT antigen, ADAM‑17, IL‑8, IL‑10 and NF‑κB expression in <em>Helicobacter</em> <em>pylori</em>‑infected gastric cancer CRL‑1739 cells: A preliminary study. Biomedical Reports, 14, 19. https://doi.org/10.3892/br.2020.1395
MLA
Radziejewska, I., Borzym‑Κluczyk, M., Leszczyńska, K."Luteolin alters MUC1 extracellular domain, sT antigen, ADAM‑17, IL‑8, IL‑10 and NF‑κB expression in <em>Helicobacter</em> <em>pylori</em>‑infected gastric cancer CRL‑1739 cells: A preliminary study". Biomedical Reports 14.2 (2021): 19.
Chicago
Radziejewska, I., Borzym‑Κluczyk, M., Leszczyńska, K."Luteolin alters MUC1 extracellular domain, sT antigen, ADAM‑17, IL‑8, IL‑10 and NF‑κB expression in <em>Helicobacter</em> <em>pylori</em>‑infected gastric cancer CRL‑1739 cells: A preliminary study". Biomedical Reports 14, no. 2 (2021): 19. https://doi.org/10.3892/br.2020.1395
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team