This article is mentioned in:

Introduction

The placenta is the connection point between the mother's and fetal blood flow, effectively transferring essential nutrients and oxygen from the mother to the fetus for normal fetal development (1). Abnormal placental growth is the root cause of various pregnancy issues, such as fetal growth restriction (FGR), also known as intrauterine growth restriction (IUGR) (1). Placentae with FGR are typically ~50% smaller than normal placentae, and exhibit structural abnormalities in the villous tree and placental vascular networks (2). Currently, there is no universally accepted method for the diagnosis of FGR. A statistical difference in fetal size typically identifies it compared with the reference population using percentile thresholds of 10, 5, or 3(3). The current obstacle lies in distinguishing pregnancies affected by genuine FGR from those where the infant is small for gestational age due to natural reasons and those where the baby's weight exceeds percentile limits but suffers from compromised growth and health due to underlying pathology. The past decade has witnessed significant progress in our comprehension of placental disorders linked to FGR. In high-income countries, placental insufficiency is the main cause of FGR, while in low-income countries, FGR is primarily attributed to inadequate maternal nutrition (4,5). FGR significantly contributes to adverse outcomes during the perinatal period and is associated with a higher likelihood of long-term neurological and neurodevelopmental issues (6,7). Furthermore, infants affected by FGR have an elevated risk of developing cardiovascular disease later in life (8). Therefore, the timely diagnosis and management of FGR during pregnancy holds significant implications for the healthy development of the entire society. Additionally, immune cells are essential for the development and operation of the placenta, and insufficient control of the maternal immune system is related to placental issues and complications during pregnancy (9). However, the immunological background of FGR has received limited attention.

Notch proteins were first identified in Drosophila as a family of transmembrane receptors that exhibit both functional and structural conservation across various species (10). Notch signaling constitutes a crucial developmental pathway that plays a vital role in maintaining tissue homeostasis and facilitating stem cell differentiation (11). The activation of Notch signaling relies on the direct interaction between cells mediated by membrane-bound ligands and receptors (12). The cell that sends the signal expresses Serrate-like ligands Jagged 1/2 or Delta-like ligands, which engage with the extracellular domain of Notch receptors (Notch1-4) through their epidermal growth factor repeats. This group of receptors is currently understood to regulate the fate decisions of developing cells across various tissues during placental development, embryogenesis and postnatal stages. For example, Afshar et al (13) posited that Notch1 may mediate a survival signal in the uterine endometrium, enabling a rapid response to chorionic gonadotropin and ultimately preventing menstrual sloughing. In the progression of preeclampsia, fetal growth may be impaired, and the expression of Notch1 and its ligand Jagged1 is found to be absent in patients with pre-eclampsia. Furthermore, inhibition of Notch signaling results in a reduction in the invasion of placental trophoblasts (14). More importantly, Sahin et al (15) indicated that the expression of Notch1 protein is diminished in placental tissue from pregnancies affected by IUGR. However, the precise mechanism underlying this action remains unspecified.

In the present study, the expression and distribution of Notch1 and its ligand Jagged was investigated. Furthermore, the levels of inflammatory cytokines and immune-related factors in both serum and placental tissues from pregnancies with FGR were measured. These findings may elucidate the pathogenesis of FGR and offer a technically efficient, safe and economically viable diagnostic modality for FGR pregnancies.

Materials and methods

Patients

A total of 50 patients (age: 30-39 years) diagnosed with FGR were enrolled at Jinhua Maternal and Child Health Hospital (Jinhua, China) from January 2021 to December 2021. FGR pregnancies were identified through ultrasonographic monitoring during the second/third trimester, which revealed biometry measurements below the 10th percentile and birth weights also below the 10th percentile. The inclusion criteria were: i) singleton pregnancy; ii) term delivery (37-41 weeks gestation). Patients presenting with any complications associated with FGR such as multiple pregnancies, fetal malformations, preeclampsia, chronic maternal diseases, intrauterine infections, hypertension, or diabetes were excluded. Concurrently, 50 normal pregnancies matched the gestational weeks, and birth weights between 10 and 90th percentiles were recruited as the controls. All participants had been informed the study details and given their written consent in advance. Ethical approval was obtained from the Ethics Committee of Jinhua Maternal and Child Health Hospital (approval no. 2021-KY-009; Jinhua, China) and this research adheres to the principles outlined in the Declaration of Helsinki.

Sample collection

Within 4 h of venous blood collection, peripheral blood mononuclear cells (PBMCs) were isolated from a 10 ml heparinized sample using a human peripheral blood monocyte isolation solution kit (Beijing Solarbio Science & Technology Co., Ltd.). Concurrently, 5 ml of venous blood samples were obtained via vein puncture and subsequently subjected to centrifugation at 1,000 x g for 10 min to collect serum samples. Placentae were collected from women post-delivery. Immediately, 1 cm3 of tissue block was dissected from the lobule of the maternal surface of the placenta and divided into two parts, followed by washing with PBS. Subsequently, one part of the samples was stored in cryotubes at liquid nitrogen and used for reverse transcription-quantitative PCR (RT-qPCR), western blotting and ELISA, while the other part was subjected to fixation using 10% formaldehyde and used for the subsequent hematoxylin & eosin (H&E) staining, immunofluorescence (IF) staining, immunohistochemistry (IHC) and TUNEL assays.

H&E staining

Placenta histopathology was examined using a H&E staining Kit (Abcam). The fixed placentae were subjected to dehydration followed by embedding in paraffin. After cutting into 4-µm thickness slices, dewaxing and rehydration, the sections were executed for H&E staining. Images were captured under a BX53 microscope from Olympus Corporation (Scale bar, 100 µm).

TUNEL assay

In accordance with the experimental protocol in the manufacturer's specifications of the Kit (Beijing Solarbio Science & Technology Co., Ltd.), apoptosis was evaluated in placental tissues. Briefly, the placental tissues were fixed using 4% paraformaldehyde at 4˚C for 48 h, and then embedded in paraffin and cut into 5-µm sections. The tissue sections, after deparaffinization, were treated with 3% hydrogen peroxide in methanol for 10 min at 25˚C under dark conditions. They were subsequently rinsed three times using PBS and then exposed to a solution of 0.1% Triton X-100 in freshly prepared 0.01% sodium citrate for 8 min at the same temperature. Following this, the sections underwent incubation with a proteinase K working solution for 25 min at 37˚C, followed by three washes with PBS, each lasting 5 min. Each sample received 50 µl of TUNEL reagent and was incubated at 37˚C for 1 h. Afterward, the sections were washed three more times with PBS, and the cell nuclei were stained with a 2 µg/ml DAPI solution for 10 min in the dark at room temperature. Finally, the samples were mounted using 50 µl of an anti-fade mounting medium. TUNEL-positive cells were observed in five randomly-selected fields using a fluorescence microscope (Olympus Corporation; Scale bar, 100 µm).

Total RNA isolation and RT-qPCR

The total RNA was isolated from PBMCs or placental tissues using a Total RNA Extraction Kit (Promega Corporation). Subsequently, cDNA synthesis was performed utilizing a First Strand cDNA Synthesis Kit (Vazyme Biotech Co., Ltd.) according to the manufacturer's instructions. Following the manufacturer's instructions, RT-qPCR analysis was conducted employing the Hieff® qPCR SYBR Green Master Mix (Shanghai Yeasen Biotechnology Co., Ltd.). The thermocycling conditions were as follows: 95˚C for 5 min, 40 cycles of denaturation at 95˚C for 10 sec, annealing at 50˚C for 1 min and extension at 72˚C for 30 sec. To assess gene expression levels, the 2-ΔΔCq method was applied (16). Normalization of data was performed using GAPDH as a reference gene. The primers used are included in Table I.

Table I Primer sequences used for reverse transcription-quantitative PCR.

Table I

Primer sequences used for reverse transcription-quantitative PCR.

Gene name	Primer sequence (5'-3')
Notch1	F: CACGTGGTGGACCGCAGA
	R: CACAGTTCTGGCCGGTGAA
Jagged1	F: AGCTATTTGCCGACAAGGCT
	R: CACTGCCAGGGCTCATTACA
GAPDH	F: AAGCCTGCCGGTGACTAAC
	R: GCATCACCCGGAGGAGAAAT

[i] F, forward; R, reverse.

Western blotting

The placentae were subjected to lysis using RIPA buffer (Boster Biological Technology), followed by the determination of protein concentrations utilizing a BCA Protein Kit (Beyotime Institute of Biotechnology). Subsequently, the protein samples (30 µg per lane) were separated through 10% SDS polyacrylamide gel electrophoresis and transferred onto PVDF membranes. To block the membranes, a solution containing 5% non-fat milk was employed for 2 h at 25˚C. Following this step, primary antibodies including Notch1 (1:750; cat. no. 20687-1-AP), Jagged1 (1:20,000; cat. no. 66890-1-Ig), β-actin (1:20,000; cat. no. 66009-1-Ig), TNF-α (1:2,000; cat. no. 60291-1-Ig), vascular endothelial growth factor (VEGF; (1:8,000; cat. no. 19003-1-AP), GAPDH (1:50,000; cat. no. 60004-1-Ig; all from Proteintech Group, Inc.), IL-6 (1:1,000; cat. no. bs-0782R), placental growth factor (PLGF; 1:1,000; cat. no. bsm-54066R; both from BIOSS), C-X-C motif chemokine ligand 1 (CXCL1; 1:100; cat. no. ab206411), soluble fms-like tyrosine kinase-1 (sFlt-1; 1:1,000; cat. no. ab32152) and placental protein 13 (PP13; 1:1,000; cat. no. ab218411; all from Abcam) were introduced to the membranes for overnight incubation at 4˚C. The HRP-conjugated secondary antibodies (1:1,000; cat. nos. A21010 & A21020; Abbkine Scientific Co., Ltd.) were then added and allowed to incubate for 1 h at room temperature. Visualization of immunoblotting was achieved using an ECL detection Kit (Thermo Fisher Scientific, Inc.) and brand intensity was measured by densitometry using Quantity One software version 4.6 (Bio-Rad Laboratories, Inc.).

IF staining

Placenta slices were deparaffinized in xylene and rehydrated through a graded series of ethanol, followed by antigen retrieval in 10 mM Citrate buffer at 95˚C for 20 min. Subsequently, the sections (5 µm) were permeabilized with 0.5% TritonX-100 in PBS at room temperature for 1 h after being rinsed three times in PBS. Following blocking with 5% bovine serum albumin (Beijing Solarbio Science & Technology Co., Ltd.) at room temperature for 1 h, the sections were incubated overnight at 4˚C with primary antibodies Notch1 (1:200; cat. no. ab52627) and Jagged1 (1:200; cat. no. ab300561; both from Abcam). This was followed by incubation with corresponding secondary antibodies conjugated to fluorescent dyes (1:200; cat. no. ab150115; Abcam) at 37˚C for 30 min. After staining with DAPI (Beyotime Institute of Biotechnology; 1 µg/ml) at 37˚C for 15 min, images were captured using a fluorescence microscope (Olympus Corporation; Scale bar, 100 µm).

IHC

The fixed placenta samples were subsequently embedded in paraffin, followed by deparaffinization in xylene and rehydration through a graded series of ethanol. After antigen retrieval, the samples were incubated overnight at 4˚C with primary antibodies against Notch1 (1:200), Jagged1 (1:200), CD3 (1:200; cat. no. 17617-1-AP), CD86 (1:200; cat. no. 26903-1-AP), CD206 (1:200; cat. no. 18704-1-AP; last 3 obtained from Proteintech Group, Inc.) and Forkhead Box protein 3 (Foxp3; 1:200; cat. no. ab36607; Abcam). Subsequently, secondary antibodies conjugated with HRP (1:3,000; cat. no. ab205719; Abcam) were applied for 1 h at 37˚C. DAB staining (Beijing Solarbio Science & Technology Co., Ltd.) was then performed on each slice, followed by image capture using a light microscope (Scale bar, 100 µm).

ELISA

According to the manufacturer's protocols provided for the human IL-10 (cat. no. KTE6019), IL-17 (cat. no. KTE6022), TNF-α (cat. no. KTE6032), IL-6 (cat. no. KTE6017), CXCL1 (cat. no. KTE3051), sFlt-1 (cat. no. KTE3117), VEGF (cat. no. KTE6033) and PLGF (cat. no. KTE3057) ELISA Kits (Abbkine Scientific Co., Ltd.), as well as the IL-35 ELISA Kit (cat. no. ED-10371; LunChangShuo Biotech) and PP13 (cat. no. CSB-E12733h; Cusabio Technology, LLC), the levels of these cytokines in serum and/or placental samples were assessed.

Determination of T helper 17 cell (Th17) and regulatory T cells (Treg) cell frequencies

To determine the frequencies of Th17 cells, PBMCs were incubated with APC-conjugated anti-CD4 antibodies (1:200; cat. no. 980812; BioLegend, Inc.) for 15 min at 4˚C. Following this incubation, the cells were stained with PE-conjugated anti-IL-17A antibodies (1:200; cat. no. 512305; BioLegend, Inc.). For the detection of Treg, cultured PBMCs were treated with PE-labeled anti-human CD25 (1:200; cat. no. 302605), PE-conjugated anti-human Foxp3 (1:200; cat. no. 320107) and FITC-labeled anti-human CD4 (1:200; cat. no. 344604; all from BioLegend, Inc.) at 4˚C for 15 min. After staining, the cells were washed and subsequently resuspended in a solution containing 1% formaldehyde. The analysis of all stained cells was conducted using a BD FACSCalibur flow cytometer (BD Biosciences), operated with BD CellQuest software version 3.5.1.

Statistical analysis

All experiments were conducted in triplicate in at least three independent experiments. The differences among the data were evaluated using Student's t-tests (unpaired). Data analysis was conducted using SPSS software version 22.0 (IBM Corp.), and the results were presented as the mean ± standard deviation. P<0.05 was considered to indicate a statistically significant difference.

Results

Placenta histopathology and trophoblast cell apoptosis in patients with FGR

The histopathological changes in the placental tissues of patients with FGR were initially examined. As illustrated in Fig. 1A, the control group exhibited a normal placental tissue structure and well-formed blood vessels, with scattered calcifications and fibrin deposits observed between the villi. By contrast, the FGR group displayed extensive infarction and a reduction in villous vascularization. Additionally, the apoptosis of trophoblast cells was also assessed. It was demonstrated that the percentage of TUNEL-positive trophoblast cells was significantly elevated in the FGR group when compared with the control group (Fig. 1B, P<0.001), suggesting pronounced apoptosis of trophoblast cells within the placental tissues of individuals affected by FGR.

Figure 1 Placenta histopathology and trophoblast cell apoptosis in patients with FGR. (A) Placenta histopathology of patients with FGR were examined through H&E staining. Scale bar, 100 µm. (B) Trophoblast cell apoptosis was determined using TUNEL assay. ***P<0.001 vs. control. Scale bar, 100 µm. FGR, fetal growth restriction.

The expression and distribution of Notch1 and Jagged1 is decreased in PBMCs and placenta

PBMCs were isolated from both healthy pregnancies and FGR pregnancies. The mRNA expression levels of Notch1 and Jagged1 in PBMCs were preliminarily assessed. As shown in Fig. 2A, both Notch1 and Jagged1 mRNA expression were significantly reduced in PBMCs from FGR pregnancies compared with those from control pregnancies (P<0.01). In placental tissues, the mRNA expression of Notch1 and Jagged1 was also evaluated. Low expression levels of Notch1 and Jagged1 were observed in the FGR group by contrast to the control group (Fig. 2B, P<0.001). Furthermore, 3 healthy pregnancies and 3 FGR pregnancies were randomly selected for protein level analysis of Notch1 and Jagged1 in placental tissues. Western blotting demonstrated a significant decrease in the protein levels of Notch1 and Jagged1 within placental tissues from FGR pregnancies in contrast to those control pregnancies (Fig. 2C, P<0.01). IF assays were performed to assess the distribution and expression patterns of Notch1 and Jagged1 within placental tissues. A significantly reduced distribution and expression of Notch1 and Jagged1 was observed in placental tissues from FGR pregnancies compared with those from control pregnancies (Fig. 2D, P<0.01). Additionally, IHC further validated that the relative expression of Notch1 and Jagged1 was significantly inhibited in the FGR group relative to the control group (Fig. 2E, P<0.01).

Figure 2 The expression and distribution of Notch1 and Jagged1 is decreased in PBMCs and placenta. (A-E) The expression of Notch1 and Jagged1 in PBMCs and placenta was detected by (A and B) reverse transcription-quantitative PCR, (C) western blotting, (D) immunofluorescence and (E) immunohistochemistry, respectively. **P<0.01 and ***P<0.001 vs. control. Scale bar, 100 µm. PBMCs, peripheral blood mononuclear cells; FGR, fetal growth restriction.

Inflammation- and angiogenesis-factors in serum and placental tissue of FGR pregnancies

The occurrence of FGR is associated with numerous critical physiological mechanisms, such as inflammation and angiogenesis (17,18). Consequently, the expression of relevant factors was investigated. In contrast to the control group, the concentrations of inflammatory cytokines (TNF-α, CXCL1 and IL-6) and antiangiogenic protein sFlt-1 were significantly increased in the FGR group (Fig. 3A, P<0.01). By contrast, the levels of pro-angiogenic proteins including PLGF, VEGF and PP13 were significantly decreased (P<0.05). Furthermore, similar results were observed in placental tissues from 3 randomly selected patients with FGR (Fig. 3B, P<0.05).

Figure 3 Inflammation- and angiogenesis-factors in serum and placental tissue of FGR pregnancies. (A and B) The levels of TNF-α, IL-6, CXCL1, sFlt-1, VEGF, PLGF and PP13 in serum and placenta of FGR pregnancies were determined via (A) ELISA and (B) western blotting. *P<0.05, **P<0.01 and ***P<0.001 vs. control. FGR, fetal growth restriction; CXCL1, C-X-C motif chemokine ligand 1; sFlt-1, soluble fms-like tyrosine kinase-1; VEGF, vascular endothelial growth factor; PLGF, placental growth factor; PP13, placental protein 13.

Immune dysfunction in patients with FGR

It was observed that the frequency of Th17 cells was significantly increased (Fig. 4A, P<0.05), while the frequencies of Treg cells were significantly reduced (P<0.05). Consequently, a significant increase in the Th17/Treg ratio was determined (P<0.001). IHC was employed to assess the involvement of immune cells such as macrophages, Treg and Th17, by employing their corresponding markers. As manifested in Fig. 4B, compared with the control group, the relative expression CD86 (M1 macrophage marker) and CD3 (Th17 marker) was significantly elevated (P<0.001), whereas both CD206 (M1 macrophage marker) and Foxp3 (Treg marker) expression levels were found to be significantly reduced (P<0.001). IL-10, IL-17, and IL-35 are cytokines associated with immune responses. The levels of IL-10, IL-17 and IL-35 were also measured in both serum and placental tissue from FGR pregnancies. The current findings indicated that compared with control pregnancies, serum levels of IL-10 and IL-35 were significantly decreased in FGR pregnancies (Fig. 4C, P<0.01), while serum levels of IL-17 showed a significant increase (P<0.001). Similar patterns were also observed in placental tissues from FGR pregnancies (Fig. 4D, P<0.001).

Figure 4 Immune dysfunction in patients with FGR. (A) Th17 and Treg frequencies were assessed through flow cytometry. (B) The expression of CD86 (M1 macrophage marker), CD206 (M1 macrophage marker), Foxp3 (Treg marker) and CD3 (Th17 marker) was evaluated using immunohistochemistry. Scale bar, 100 µm. (C) Serum and (D) placental levels of IL-10, IL-17, and IL-35 were measured by ELISA. *P<0.05, **P<0.01 and ***P<0.001 vs. control. FGR, fetal growth restriction; Th17, T helper 17 cells; Treg, regulatory T cells; Foxp3, Forkhead Box protein 3.

Discussion

In the present study, a preliminary mechanism underlying the pathogenesis of FGR was uncovered, indicating that the Notch signaling pathway mediates immune dysfunction to regulate FGR development. The Notch signaling is a classical pathway for inducing human trophoblast development and differentiation (19). Research examining the relationship between placental development and trophoblast cells indicates that dysregulation of subcellular levels in trophoblasts, along with increased apoptosis of these cells, are critical factors contributing to impaired placental function in cases of FGR (20). Consequently, it was hypothesized that the Notch signaling pathway plays a pivotal role in the pathogenesis of FGR. Additionally, several studies have shown that vascular defects are observed in mice with a knockout of Jagged1 (21,22). In the human placenta, Notch1 and its ligand Jagged1 are prominently expressed, indicating their involvement in the process of placental angiogenesis (23). In the current study, the expression levels of Notch1 and its ligand Jagged1 was assessed in PBMCs and placenta. As expected, it was found that the expression levels of Notch1 and Jagged1 were downregulated in both PBMCs and placenta, consistent with findings reported by Sahin et al (15). Furthermore, it was validated that the distribution of Notch1 and Jagged1 within the placenta of FGR pregnancy was also significantly reduced. These findings suggested that the downregulation of Notch1 and Jagged1 may play a crucial role in the pathogenesis of FGR.

The etiology of FGR is highly complex, with inflammation reported to be existed throughout the FGR process (17,24). A previous study demonstrated a significant increase in pro-inflammatory cytokines in cases of FGR compared with normal pregnancies (25). Similarly, the present study revealed a significant elevation of IL-6, CXCL1 and TNF-α in both serum and placental tissues from patients with FGR, indicating a more pronounced pro-inflammatory response in pregnancies affected by this condition. Additionally, angiogenic imbalance represents another critical factor contributing to the development of FGR (26). For example, PP13 is a sophisticated protein that exhibits a strong affinity for glycans, predominantly located within syncytiotrophoblasts (27). It is subsequently released into the maternal bloodstream via microvesicles (27). This protein plays a pivotal role in orchestrating implantation and facilitating the complex development of placental blood vessels (28). Both PLGF and VEGF are essential for promoting angiogenesis within the placental tissues, as well as in transforming spiral arteries into vessels characterized by low resistance and capacitance (29). By contrast, sFlt-1 serves an important function in inhibiting angiogenesis by effectively counteracting the influences of PLGF and VEGF (30). The findings of the present study corroborated previous research indicating that elevated levels of sFlt-1 were present in both serum and placental tissues of pregnancies affected by FGR. By stark contrast, the concentrations of PLGF, VEGF and PP13 were found to be significantly diminished. These results suggest a profound dysregulation of the angiogenic process throughout the progression of FGR.

Additionally, the importance of immune mechanisms in the onset and progression of pregnancy-related diseases is increasingly acknowledged (31,32). The phenomenon whereby the fetus is not rejected by the maternal immune system represents a unique form of immune tolerance. Treg cells possess immunosuppressive functions and are capable of expressing various surface molecules, including the key transcription factor Foxp3, which regulates both the development and function of Treg cells while secreting cytokines such as IL-10 and IL-35(33). Numerous studies have highlighted the crucial role of Treg cells in initiating and sustaining maternal fetal tolerance. Deficiencies or dysfunctions in Treg cells are closely associated with recurrent miscarriage, infertility and preeclampsia (34). Th17 is an identified subset of CD4+T cells in 2006, capable of producing the cytokine IL-17. Elevated levels of Th17 and IL-17 have been closely associated with pathological conditions such as recurrent miscarriage and infertility (35). Therefore, preserving the delicate balance between Th17 and Treg cells is an essential prerequisite for ensuring a normal pregnancy. In the present study, a significant increase was confirmed in the frequency of Th17 and a remarkable decrease in Treg cell frequency, indicating an imbalance in the Th17/Treg ratio during the progression of FGR. Additionally, the levels of IL-10, IL-17 and IL-35, which serve as indirect indicators of homeostasis between Th17 and Treg cells, were quantified. The concentrations of IL-10 and IL-35 were found to be significantly reduced in both serum and placental tissues from FGR pregnancies, while the levels of IL-17 were significantly increased. This further underscored the imbalance between Th17 and Treg cells observed in FGR pregnancies. Macrophages display considerable diversity and function as principal antigen-presenting cells at the maternal-fetal interface (36). Aberrant polarization of macrophages has been associated with various pregnancy complications, including preeclampsia, FGR and recurrent pregnancy loss (37,38). In the current study, a shift towards the M1 phenotype was observed in maternal macrophages within pregnancies complicated by FGR, which was consistent with the research undertaken by Berezhna et al (39). Collectively, these findings elucidate the immune dysregulation that occurs throughout the progression of FGR.

The existence of limitations in this research should not be overlooked. First, additional in vitro investigations are necessary to explore the direct interactions among Notch1, Jagged1 and immune cells. Second, confirming these findings through FGR animal models would significantly enhance the robustness of the present study.

In conclusion, the present study provides preliminary evidence for a novel regulatory mechanism in the progression of FGR, pointing out that Notch signaling may mediate immune balance to influence FGR development. These findings offer valuable insights into potential clinical diagnostics and interventions for the management of FGR.

Acknowledgements

Not applicable.

Funding

Funding: No funding was received.

Availability of data and materials

The data generated in the present study may be requested from the corresponding author.

Authors' contributions

YL made substantial contributions to the conception and design of the study. LY, XZ and YY made substantial contributions to the acquisition, analysis and interpretation of the data. LY drafted the manuscript. All authors critically revised the manuscript for intellectual content, and confirm the authenticity of all the raw data. All authors read and approved the final version of the manuscript.

Ethics approval and consent to participate

All the individuals had been informed the study details and given their written consent in advance. Ethical approval (approval no. 2021-KY-009) was obtained from the Ethics Committee of Jinhua Maternal and Child Health Hospital (Jinhua, China) and this research adheres to the principles outlined in the Declaration of Helsinki.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References