Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Biomedical Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9434 Online ISSN: 2049-9442
Journal Cover
April-2026 Volume 24 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2026 Volume 24 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML

  • Supplementary Files
    • Supplementary_Data1.pdf
    • Supplementary_Data2.xlsx
    • Supplementary_Data3.xlsx
    • Supplementary_Data4.xlsx
    • Supplementary_Data5.xlsx
Article Open Access

Differentially expressed circular RNA profile in hemorrhagic and ischemic moyamoya disease

  • Authors:
    • Meng Zhao
    • Wenjie Li
    • Xun Ye
    • Qian Zhang
    • Yan Zhang
    • Jizong Zhao
  • View Affiliations / Copyright

    Affiliations: Department of Neurosurgery, Beijing Tiantan Hospital, Capital Medical University, Beijing 100070, P.R. China, Department of Neurosurgery, Beijing Tiantan Hospital, Capital Medical University, Beijing 100070, P.R. China
    Copyright: © Zhao et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 45
    |
    Published online on: February 10, 2026
       https://doi.org/10.3892/br.2026.2118
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Hemorrhage is a frequent manifestation in patients with moyamoya disease (MMD). Compared with MMD patients with other subtypes, patients with hemorrhagic MMD (hMMD) are at higher risk of poor prognostic outcomes, Circular RNAs (circRNAs) frequently display dysregulated expression in several human diseases. In the present study, the role of circRNAs in the pathogenesis of hemorrhage in MMD was investigated. Microarray profiling on 12 moyamoya disease samples, consisting of six hMMD and six matching ischemic MMD (iMMD) samples, was performed. Reverse transcription‑quantitative PCR was then used to confirm the microarray analysis findings. Bioinformatics tools, including Gene Ontology analysis and Kyoto Encyclopedia of Genes and Genomes pathway analysis, were used for further assessment. A network map of circRNA‑microRNA‑gene interactions was also constructed. In total, 3,607 differentially expressed circRNAs, in which 1,940 circRNAs were upregulated and 1,967 circRNAs were downregulated, were identified in hMMD (fold change ≥2.0 and P<0.05) samples. Gene Ontology revealed that the differentially expressed circRNAs were mainly involved in ‘cell cycle phase transition’ and ‘mitotic cell cycle phase transition’. In addition, the ubiquitin mediated proteolysis pathway was found to be the most significantly enriched pathway in hMMD samples. The results of the present study suggested that clusters of circRNAs were differently expressed in hMMD compared with those in iMMD samples, which provides novel insights into hemorrhage in moyamoya disease pathophysiology and potential targets for future therapy.

Introduction

Moyamoya disease (MMD) is characterized by the progressive occlusion of bilateral carotid forks, which are associated with moyamoya vessels formation at the base of the brain (1,2). MMD tends to be more prevalent in Asian countries. Since the etiology of MMD remains poorly understood, the criteria for the diagnosis of MMD are mainly based on characteristic angiographic findings. Ischemic attack and hemorrhage are two of the most common presentations of MMD. In particular, the hemorrhagic subtype is associated with a poor clinical course, which is found in 20% patients with MMD (3), but only 50% patients experience adequate recovery after the first hemorrhagic event (4). There is no clinical scale for stratifying the occurrence of ischemic MMD (iMMD) and hemorrhagic MMD (hMMD), nor is there a tool for the prediction of rebleeding or hemorrhagic transformation. Previous studies have suggested that different molecular mechanisms underlie the two subtypes.

RNA expression studies offer unique opportunities for understanding the pathogenesis of a wide variety of neurological diseases (5,6). Several studies suggest that non-coding RNA, including microRNAs (miRNAs) and long non-coding RNAs (lncRNAs), are associated with hemorrhagic neurological diseases (7-10). However, it remains unclear whether altered expression of such non-coding RNAs directly results in hemorrhage in cerebrovascular diseases. Circular RNAs (circRNAs) form another class of stable, single-stranded, non-coding RNAs that are formed by back-splicing events through exon or intron circularization (11-13). Previous studies have reported that circRNAs can regulate gene expression on transcriptional or post-transcriptional levels by functioning as miRNA sponges (11,14). In addition, stroke has been reported to alter the expression of circRNAs with possible functional implications in poststroke pathophysiology (15). Since circRNA-based research is an emerging area of investigation, to the best of our knowledge, circRNA expression is abnormally expressed in MMD (16). No study to date has investigated the circRNA expression profile in hMMD.

Therefore, the present study focused on the potential differences in the circRNA expression profile between hMMD and iMMD. circRNA dysregulation may serve a role in the hemorrhage of MMD. CircRNAs may become potential future biological targets and prognostic indicators for hemorrhage in MMD.

Materials and methods

Patient selection and sample collection

In total, adult patients diagnosed with MMD presenting with hemorrhage or transient ischemic attack were recruited from Beijing Tiantan Hospital (Beijing, China) between March and July 2016. The diagnosis of MMD adhered to the guidelines established by the Research Committee on Moyamoya Disease of the Ministry of Health, Labor, and Welfare of Japan (17). Inclusion criteria were: Age ≥18 years; diagnosis of definite MMD per Research Committee guidelines; presenting with either hemorrhage or transient ischemic attack; no prior surgical revascularization; no other cerebrovascular conditions; no systemic diseases that could affect RNA expression; informed consent provided. Exclusion criteria encompassed pediatric patients, those with quasi-MMD (moyamoya syndrome) and individuals with history of other cerebrovascular conditions, hypertension or diabetes to mitigate potential confounding factors. Patients with conditions known to influence RNA expression were excluded, including autoimmune diseases, chronic infections, malignancies, chronic inflammatory conditions, recent major surgeries, and any use of immunosuppressive or anti-inflammatory medications. Finally, 12 patients (5 males and 7 females, age 22-50 years old) were included in microarray analysis.

Whole venous blood samples (12 patients with MMD for microarray and 22 patients for validation, 3 ml each) were obtained from the patients with MMD 2 weeks post-symptom onset, prior to any revascularization procedures. Blood samples were collected between March and July 2016 with patients' written informed consent for biobanking and future research use. The specific circRNA analysis protocol was reviewed and approved by the Ethics Committee Review Board of Beijing Tiantan Hospital (approval no. KYSQ2020-161-01) prior to conducting the molecular studies.

RNA extraction and microarray analysis

Total RNA was isolated from blood samples using TRIzol® reagent (Thermo Fisher Scientific, Inc.) following the manufacturer's protocol. RNA quantity and integrity were assessed using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Inc.) and agarose gel electrophoresis, respectively. Sample labeling and circRNA array hybridization were performed according to the manufacturer's protocol (Arraystar, Inc.). CircRNA enrichment, amplification and fluorophore-labeled cRNA synthesis were performed using the Super RNA Labeling kit (Arraystar, Inc.), followed by purification with the RNeasy Mini kit (Qiagen GmbH). The labeled cRNAs were hybridized onto the Arraystar Human circRNA Array (6x7K; Arraystar, Inc.) for 17 h at 65˚C in an Agilent Hybridization Oven (Agilent Technologies, Inc.). Post-hybridization, arrays were washed, fixed and scanned using a G2505C scanner (Agilent Technologies, Inc.). Raw data extraction was conducted using Feature Extraction v.11.0.1.1 software (Agilent Technologies, Inc.). Subsequent data processing, including quantile normalization, was performed using R v.3.3 software (R Foundation for Statistical Computing; https://www.r-project.org). Differentially expressed circRNAs were defined as those with fold changes ≥2.00 and P<0.05. Hierarchical clustering was employed to visualize distinct circRNA expression patterns among samples.

Reverse transcription-quantitative (RT-q) PCR

To validate the microarray data, RT-qPCR was conducted. Cells were harvested at approximately 80% confluence (approximately 1x106 cells/ml) for RNA extraction. Total RNA was reverse transcribed into cDNA using Superscript III reverse transcriptase (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. CircRNA expression levels were quantified using a ViiA 7 real-time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) with SYBR Green Master Mix (Applied Biosystems; Thermo Fisher Scientific, Inc.) following the manufacturer's protocol. Divergent primers were designed to specifically amplify circRNAs and differentiate them from their linear isoforms (Table I). The PCR cycling conditions were as follows: initial denaturation at 95˚C for 10 min, followed by 40 cycles of denaturation at 95˚C for 15 sec, annealing at 60˚C for 30 sec, and extension at 72˚C for 30 sec. β-actin served as the internal control. The expression level of each circRNA was calculated as a fold change using the 2-ΔΔCq method (18).

Table I

Primers used for reverse transcription-quantitative PCR.

Table I

Primers used for reverse transcription-quantitative PCR.

GenePrimer
β-actinForward: 5' GTGGCCGAGGACTTTGATTG3'
 Reverse: 5' CCTGTAACAACGCATCTCATATT3'
hsa_circRNA_103572Forward: 5' ATGTGGAAAATTTCCTAGAAGC 3'
 Reverse: 5' AGGTCTGTCATCACTCTGAGGT 3'
hsa_circRNA_103574Forward: 5' GTACCTAAATTAACAATGGCGA 3'
 Reverse: 5' AAGGGGTGAAGCATGACCT 3'
hsa_circRNA_029937Forward: 5' GGCCATAGGAAAAGGATACAG 3'
 Reverse: 5' CTCTAGGTCCCAAGAATTTACC 3'
hsa_circRNA_104293Forward: 5' GCACAGATCTGATTCTGAACGT 3'
 Reverse: 5' TCATTGGATATGTCCTGATAGTCC 3'
hsa_circRNA_025016Forward: 5' TATTCCCTTTCCAGAAGATGAT 3'
 Reverse: 5' CATAGTTGGAACCAGGTTGG 3'
hsa_circRNA_091419Forward: 5' CGTGTTTTCCTCTCTGAATCTG 3'
 Reverse: 5' TCGCTTAATCCTGAAAGTCTTG 3'
hsa_circRNA_060184Forward: 5' ACCCGCCATGGGAGTGTG 3'
 Reverse: 5' GGGGCTTCCAGCAGTGCT 3'

[i] circRNA, circular RNA.

Bioinformatics analysis and circRNA/miRNA gene network construction

The microarray data are in the supplementary tables. All raw relevant datasets are in the supplementary materials. The parent linear mRNAs of differentially expressed circRNAs were subjected to Gene Ontology (GO) analysis (http://www.geneontology.org) to elucidate the functional enrichment of these coding genes. Pathway analyses were conducted based on the Kyoto Encyclopedia of Genes and Genomes (KEGG; http://www.genome.ad.jp/kegg/).

A circRNA/miRNA gene network was constructed for the differentially expressed circRNAs identified from microarray and RT-qPCR validation experiments. CircRNA/miRNA interactions were predicted using the Arraystar miRNA target prediction software (version 1.0, Arraystar, Inc.; https://www.arraystar.com), which integrates TargetScan and miRanda algorithms (19). miRNA target gene analysis was performed using miRTarBase (20). All miRNA gene targets were experimentally validated with strong evidence (western blotting or Reporter assay). The circRNA/miRNA gene network was visualized using Cytoscape 2.8.2 (https://cytoscape.org).

Statistical analysis

All data are presented as the mean ± standard error. Statistical comparisons were performed using paired t-tests or independent t-tests as appropriate. All statistical analyses were conducted using R v.3.3 software (R Foundation for Statistical Computing; https://www.r-project.org). P<0.05 was considered to indicate a statistically significant difference.

Results

Overview of circRNA profiles

A total of 12 patients with MMD, namely 6 hMMD and 6 age and sex matched patients with iMMD, were enrolled into the present study (Table SI). The expression profiles of human circRNAs were obtained by microarray analysis (Table SII). Differentially expressed circRNAs with statistical significance (fold changes ≥2.0 and P<0.05) between hMMD and iMMD groups were identified using a volcano plot (Fig. 1A) and scatter plot (Fig. 1B). A total of 3,607 circRNAs with expression change >2x were identified (Table SIII). Compared with iMMD, 1,940 circRNAs were upregulated and 1,967 circRNAs were downregulated in hMMD samples. Hierarchical clustering revealed the circRNA expression patterns between hMMD and iMMD were significantly different (Fig. 2). The complete dataset from the present study is available in the supplementary materials, including all raw microarray data files and associated documentation.

Differential expression and
correlation analysis of circRNA in MMD. (A) Volcano plots and (B)
scatter plots of circRNA expression profiles in MMD and control
groups. Red dots represent differentially expressed circRNAs
(P<0.05 and fold change ≥2.0). circRNAs, circular RNAs; MMD,
moyamoya disease.

Figure 1

Differential expression and correlation analysis of circRNA in MMD. (A) Volcano plots and (B) scatter plots of circRNA expression profiles in MMD and control groups. Red dots represent differentially expressed circRNAs (P<0.05 and fold change ≥2.0). circRNAs, circular RNAs; MMD, moyamoya disease.

Heat map of differentially expressed
circRNAs between MMD and control groups. circRNAs, circular RNAs;
MMD, moyamoya disease; h, hemorrhagic; i, ischemic.

Figure 2

Heat map of differentially expressed circRNAs between MMD and control groups. circRNAs, circular RNAs; MMD, moyamoya disease; h, hemorrhagic; i, ischemic.

RT-qPCR validation of the microarray data

RT-qPCR was conducted in a group of 11 hMMD and 11 iMMD samples to verify the differential expression of the candidate circRNAs. A total of seven circRNAs were selected for RT-qPCR validation based on: i) Magnitude of differential expression (fold change >2), ii) statistical significance (P<0.05), and iii) predicted interactions with MMD-relevant pathways. A total of seven circRNAs, including four upregulated circRNAs (circRNA-025016, circRNA-104293, circRNA-060184 and circRNA-091419) and three downregulated circRNAs (circRNA-029937, circRNA-103574 and circRNA-103572), were selected for further assessment. The results obtained from RT-qPCR were consistent with the RNA sequencing data (Fig. 3), RT-qPCR validation confirmed significant upregulation of circRNA-025016, circRNA-104293, circRNA-060184 and circRNA-091419 in hMMD samples compared to iMMD. Conversely, circRNA-029937, circRNA-103574 and circRNA-103572 showed significant downregulation in hMMD samples.

Reverse transcription-quantitative
PCR validation of expression levels of circRNAs identified by
microarray analysis. Samples were prepared in triplicate. The error
bar stands for standard deviations. *P<0.05,
**P<0.01; ***P<0.001. circRNAs,
circular RNAs; MMD, moyamoya disease; h, hemorrhagic; i,
ischemic.

Figure 3

Reverse transcription-quantitative PCR validation of expression levels of circRNAs identified by microarray analysis. Samples were prepared in triplicate. The error bar stands for standard deviations. *P<0.05, **P<0.01; ***P<0.001. circRNAs, circular RNAs; MMD, moyamoya disease; h, hemorrhagic; i, ischemic.

Bioinformatics analysis

GO and KEGG analysis of differentially expressed circRNAs was next performed (Fig. 4). The GO and KEGG pathway analyses revealed distinct patterns between hMMD and iMMD (Fig. 4). Fig. 4A shows upregulated circRNAs in hMMD were enriched in mRNA catabolic processes and protein targeting pathways. Fig. 4B indicates downregulated circRNAs were mainly involved in cell cycle regulation. In KEGG analysis, Fig. 4C demonstrates upregulated pathways including AGE-RAGE signaling and focal adhesion, while Fig. 4D shows downregulated pathways with ubiquitin-mediated proteolysis being the most significant. In GO analysis of biological processes, ‘mRNA catabolic process’ and ‘nuclear-transcribed mRNA catabolic process’ were two of the biological processes with the most significance in upregulated circRNAs in hMMD samples. By contrast, ‘cell cycle phase transition’ and ‘mitotic cell cycle phase transition’ were the biological processes with the most significance amongst the downregulated circRNAs in the hMMD samples (Tables II and SIV).

GO and Kyoto Encyclopedia of Genes
and Genomes pathway analysis of the differentially expressed
circRNAs. Top 10 GO biological processes for (A) upregulated and
(B) downregulated circRNAs. Top 10 enriched pathways for (C)
upregulated and (D) downregulated circRNAs. circRNAs, circular
RNAs; GO, Gene Ontology.

Figure 4

GO and Kyoto Encyclopedia of Genes and Genomes pathway analysis of the differentially expressed circRNAs. Top 10 GO biological processes for (A) upregulated and (B) downregulated circRNAs. Top 10 enriched pathways for (C) upregulated and (D) downregulated circRNAs. circRNAs, circular RNAs; GO, Gene Ontology.

Table II

Top five GO biological processes of upregulated and downregulated target genes with most significance in hMMD compared with iMMD.

Table II

Top five GO biological processes of upregulated and downregulated target genes with most significance in hMMD compared with iMMD.

GO termFold enrichmentP-value
A, Upregulated target genes
GO:0006402 mRNA catabolic process2.9791136184.34E-11
GO:0000956 nuclear-transcribed mRNA catabolic process3.0613294164.82E-11
GO:0000184 nuclear-transcribed mRNA catabolic process, nonsense-mediated decay3.5715509855.75E-10
GO:0006614 SRP-dependent cotranslational protein targeting to membrane3.8403774043.09E-09
GO:0006613 cotranslational protein targeting to membrane3.7144130253.26E-09
B, Downregulated target genes
GO:0044770 cell cycle phase transition2.7649482694.06E-13
GO:0044772 mitotic cell cycle phase transition2.8181203524.06E-13
GO:0018205 peptidyl-lysine modification2.8110218122.10E-11
GO:0016570 histone modification2.7195846752.12E-11
GO:0007059 chromosome segregation2.7649482691.57E-08

[i] GO, Gene Ontology; MMD, moyamoya disease; h, hemorrhagic; i, ischemic.

KEGG pathway analysis demonstrated 10 enrichment pathways in the upregulated circRNAs and 36 enriched pathways in the downregulated circRNAs (Tables III and SV). Among them, the ‘Ubiquitin mediated proteolysis’ (Fig. 5) and ‘Cell cycle’ pathways were the top enriched pathways with the most significance. Fig. 5 shows the ubiquitin-mediated proteolysis pathway from the KEGG database. The red boxes highlight differentially expressed genes between hMMD and iMMD, including ubiquitin-activating enzyme (E1), ubiquitin-conjugating enzymes (E2), and ubiquitin ligases (E3). This pathway's dysregulation in hMMD suggests altered protein degradation may contribute to vessel wall instability. The validated circRNAs, 34 predicted miRNAs and 308 target genes were next used to construct the circRNA/miRNA network (Fig. 6).

Target genes in the ubiquitin
mediated proteolysis pathway. Target genes are shown in red. The
image was generated based on Kanehisa Laboratories and Kyoto
Encyclopedia of Genes and Genomes pathways.

Figure 5

Target genes in the ubiquitin mediated proteolysis pathway. Target genes are shown in red. The image was generated based on Kanehisa Laboratories and Kyoto Encyclopedia of Genes and Genomes pathways.

Co-expression network of the
validated circRNAs and predicted miRNAs and targeted genes. The red
dots represent circRNAs, purple dots represent miRNAs and the green
dots represent genes. circRNAs, circular RNAs; miRNAs,
microRNAs.

Figure 6

Co-expression network of the validated circRNAs and predicted miRNAs and targeted genes. The red dots represent circRNAs, purple dots represent miRNAs and the green dots represent genes. circRNAs, circular RNAs; miRNAs, microRNAs.

Table III

KEGG pathways of upregulated and downregulated target genes with most significance in hMMD compared with iMMD.

Table III

KEGG pathways of upregulated and downregulated target genes with most significance in hMMD compared with iMMD.

KEGG termFold enrichmentP-value
A, Upregulated target genes
hsa04933 AGE-RAGE signaling pathway in diabetic complications2.9140651806.42E-06
hsa03010 Ribosome2.4085640771.44E-05
hsa04510 Focal adhesion2.2090831521.51E-05
hsa05165 Human papillomavirus infection1.8634783644.39E-05
hsa04012 ErbB signaling pathway2.7155989471.00E-4
B, Downregulated target genes
hsa04120 Ubiquitin mediated proteolysis3.9509005932.02E-11
hsa04110 Cell cycle3.3794383851.02E-07
hsa00310 Lysine degradation4.7350323131.13E-07
hsa04068 FoxO signaling pathway3.0423479401.33E-06
hsa03013 RNA transport2.5526946861.23E-05

[i] KEGG, Kyoto Encyclopedia of Genes and Genomes; MMD, moyamoya disease; h, hemorrhagic; i, ischemic.

Discussion

In the present study, the circRNA expression of hMMD and iMMD were comprehensively profiled by microarray analysis. Compared with iMMD samples, a total of 3,607 significantly differentiated circRNAs in hMMD were detected. Subsequently, the differentially expressed circRNAs were identified to be involved in several biological processes and signaling pathways, such as ‘mRNA catabolic process’ and ‘ubiquitin mediated proteolysis’, according to GO analysis and KEGG pathway analysis. In addition, a network map of circRNA/miRNA gene interactions was also constructed for the validated significantly differentiated circRNAs. These results suggested that there was a significant difference in the circRNA expression profile between the iMMD and hMMD samples. Several key circRNAs may show promise as candidate biomarkers for hemorrhage in MMD.

CircRNAs have been recently found to be pervasively transcribed in the genome (11,21). It was previously reported that circRNAs can reverse the inhibitory effects of miRNAs on their target mRNAs by directly binding to miRNAs through miRNA response elements (22). In addition, previous studies suggested that circRNAs are enriched in the brain and may participate in regulating synaptic function and neural plasticity (23,24). Dysregulated circRNAs have been reported to be associated with several human diseases, including neurological disease, cardiovascular system diseases and cancers (25-27). Circular antisense non-coding RNA in the INK4 locus (cANRIL) was documented to influence INK4/ADP ribosylation factor expression and increase the risk of atherosclerotic vascular disease (28). This finding suggests that circRNAs are involved in the development of atherosclerotic cerebrovascular disease (23). The mechanism of MMD remains poorly understood. However, genetic and environmental factors were considered to be vital in the development of the vascular stenosis and MMD vessel formations (29).

A previous genome-wide association study has shown Ring Finger 213 (RNF213) to be an important MMD susceptibility gene (30). Vasculogenesis and angiogenesis, which require endothelial cell proliferation and migration, form the two central processes involved in the development of biological revascularization (31). The arteriogenesis process, which refers to the formation of collateral circulation, is typically activated by the increased fluid shear stress generated by the pressure difference between perfusion territories (32). The proliferation of endothelial and smooth muscle cells may lead to aberrant angiogenesis (29). The associated changes in circulating endothelial/smooth muscle progenitor cells (33), angiogenesis (33-35) and caveolin (36), may also be involved. The pathogenesis of MMD had also been associated with non-coding RNAs in previous studies. miRNAs, which are small non-coding RNAs ~23 nucleotides in length, can negatively regulate the expression of proteins by altering their gene expression through post-transcriptional repression or mRNA degradation (37). miRNAs have been reported to serve an important role in the regulation of proliferation and aging of various tissues. A previous microarray study on miRNAs profiles in serum from patients with MMD suggested that elevated serum levels of miRNAs are associated with RNF213(38). Another study previously revealed that the increased expression of miRNA Let-7c in patients with MMD may also contribute to MMD pathogenesis by targeting RNF213 expression (39). In addition, annexin 1, which is expressed in endothelial and smooth muscle cells (SMC), is a gene target of miRNA-196a to mediate apoptosis and inhibition of cell proliferation (29).

Although there is notable heterogeneity in clinical symptoms depending on the age of onset and ethnicity (40-42), patients with MMD typically present with ischemic and/or hemorrhagic stroke. These two subtypes may have pathogenic differences. The proposed pathophysiologic mechanism for hemorrhage in MMA is long-term hemodynamic stress to collateral vessels (43). Theoretically, impaired perfusion results in hemodynamic stress on the vessel wall and facilitates dilation or micro-aneurysm formation in collateral vessels. Dilatation and abnormal branching of the anterior choroidal artery and/or posterior communicating artery are viable predictors of hemorrhage in adult patients with MMD (44). In addition, one previous study suggested that by using 7T time-of-flight magnetic resonance angiography, ventricular micro-aneurysms in MMD angiopathy collateral vessels can be detected (45). The non-coding RNAs have been suggested to be involved in other hemorrhagic cerebral vascular diseases. A previous study suggests that lncRNAs may contribute to the pathogenesis of cerebral aneurysms by regulating loss of the contractile SMC phenotype (46). The distinction between hemorrhagic and ischemic presentations of MMD has important clinical implications. Zhao et al (47) previously demonstrated that patients with hMMD show distinct imaging characteristics and collateral patterns compared to iMMD, suggesting different pathophysiological mechanisms. The circRNA findings of the present study provided molecular support for this, revealing divergent expression patterns between subtypes. The identified circRNA networks may help explain the different propensities for hemorrhage compared with ischemia (16). The different circRNA expression may serve a role in different vessel formation in different MMD subgroups.

In addition, circRNAs may serve roles in the pathogenesis of hMMD by regulating SMC proliferation and TGF-β signaling. As shown in the network (Fig. 6), circRNA-0005873 may serve a role in the expression of TGF-β by regulating miRNA-141-3p. Alterations in normal TGF-β signaling have been implicated in the pathophysiology of several vascular disorders, including atherosclerosis and primary pulmonary hypertension (48). Another study suggested that TGF-β is one of the underlying factors contributing to the development of thoracic aortic aneurysm (49). As shown in the network, pappalysin-1 (PAPPA) was the direct target gene of miRNA-141. A previous study has also suggested that miRNA-141 can inhibit vascular SMC proliferation through targeting PAPPA (50).

The ubiquitin mediated proteolysis pathway was detected as the top significant pathway according to KEGG analysis. These results suggested that circRNAs may serve important roles in proteolysis processes in hemorrhage. Proteases, including thrombin and MMPs, were previously reported to have complex functions in the brain under both normal and pathological conditions (49). MMPs are endopeptidases that can degrade components of the extracellular matrix. The MMPs serve an important role in normal and atherosclerotic blood vessels by being involved in plaque disruption (51). Increased vascular MMP2 or MMP9 expression is involved in the pathogenesis of spontaneous intracranial hemorrhage in patients with cerebral amyloid angiopathy (52). Abdominal aortic aneurysm expansion is likely to result from increasing proteolysis related to increasing MMP-9 expression (53).

Proteolysis has been associated with the rupture of abdominal aortic aneurysms. A previous study has shown that Smad7 can interact with the heteromeric TGF-β receptor complex and recruits the E3 ubiquitin-ligases Smurf1 and Smurf2, targeting the receptors for degradation to terminate the signaling response (54). These factors may work in concert to modify and direct the response to signals through this complex pathway. Additionally, MMPs have been reported to serve a significant role in regulating angiogenesis, the process of new blood vessel formation (55). An enhanced understanding of the molecular mechanisms involved in hemorrhage in MMD may potentially lead to novel therapeutic strategies against this potentially lethal condition. While acute vascular events such as stroke can alter circRNA expression patterns, emerging evidence suggests circRNAs may also play causative roles in vascular pathology. The findings in the present study of distinct circRNA profiles between hMMD and iMMD suggested these molecules could be both markers and mediators of disease progression. Further mechanistic studies are needed to fully elucidate the complex interplay between circRNAs and vascular remodeling in MMD.

The present study had several limitations that warrant consideration. All samples were acquired from a single ethnic group in mainland China. Consequently, different circRNA signatures may exist across diverse ethnic groups. A limitation of the present study is the relatively small sample size. While it detected significant differences between groups, larger cohorts will be needed to validate these findings and establish clinical utility of circRNA biomarkers. In addition, the functions of circRNAs in MMD were analyzed based on bioinformatics predictions. While this approach is widely used in non-coding RNA research, future studies on the specific interactions of circRNAs with miRNAs and the downstream effects on hMMD and iMMD signaling pathways are necessary. A key limitation is the descriptive nature of the current findings and a lack of mechanistic studies.

To conclude, to the best of the authors' knowledge, the present study represented the first comparison of circRNA expression profiles in hMMD and iMMD samples. These findings expanded on the understanding of the mechanisms underlying hemorrhage in MMD, which may provide novel insights for developing therapeutic interventions for hemorrhagic complications of MMD.

Supplementary Material

Baseline clinical characteristics of patients with ischemic and hemorrhagic moyamoya disease.
Microarray analysis data.
circRNA expression change >2 fold.
GO analysis BP_up
Downregulated KEGG analysis.

Acknowledgements

Not applicable.

Funding

Funding: The present study was funded by ‘13th Five-Year Plan’ National Science and Technology Supporting Plan (grant no. 2015BAI12B04), the National Natural Science Foundation of China (grant no. 81371292) and Beijing Municipal Administration of Hospitals' Mission Plan (grant no. SML20150501).

Availability of data and materials

The datasets generated in the current study are not publicly available to ncbi.nlm.nih.gov due to institutional policy and regional data sharing restrictions but may be requested from the corresponding author. Raw data are provided in the supplementary materials of this article.

Authors' contributions

MZ and JZ participated in study conceptualization and methodology development. WL supervised the project, acquired funding, and provided resources. XY performed data curation, formal analysis and statistical analysis. QZ and YZ were responsible for investigation, experimental work and data validation. MZ drafted the original manuscript, while YZ and JZ reviewed and edited the manuscript. QZ and YZ were responsible for confirming the authenticity of all raw data. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The patients provided written informed consent for biobanking and future research use. The specific circRNA analysis protocol was reviewed and approved by the Ethics Committee Review Board of Beijing Tiantan Hospital (Beijing, China; approval no. KYSQ2020-161-01) prior to conducting the molecular studies.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Suzuki J and Takaku A: Cerebrovascular moyamoya disease: Disease showing abnormal net-like vessels in base of brain. Arch Neurol. 20:288–299. 1969.PubMed/NCBI View Article : Google Scholar

2 

Suzuki J and Kodama N: Moyamoya disease-a review. Stroke. 14:104–109. 1983.PubMed/NCBI View Article : Google Scholar

3 

Baba T, Houkin K and Kuroda S: Novel epidemiological features of moyamoya disease. J Neurol Neurosurg Psychiatry. 79:900–904. 2008.PubMed/NCBI View Article : Google Scholar

4 

Kobayashi E, Saeki N, Oishi H, Hirai S and Yamaura A: Long-term natural history of hemorrhagic moyamoya disease in 42 patients. J Neurosurg. 93:976–980. 2000.PubMed/NCBI View Article : Google Scholar

5 

Sharp FR, Xu H, Lit L, Walker W, Apperson M, Gilbert DL, Glauser TA, Wong B, Hershey A, Liu DZ, et al: The future of genomic profiling of neurological diseases using blood. Arch Neurol. 63:1529–1536. 2006.PubMed/NCBI View Article : Google Scholar

6 

Sharp FR, Xu H, Lit L, Walker W, Pinter J, Apperson M and Verro P: Genomic profiles of stroke in blood. Stroke. 38 (2 Suppl):S691–S693. 2007.PubMed/NCBI View Article : Google Scholar

7 

Wardlaw JM, Brazzelli M, Chappell FM, Miranda H, Shuler K, Sandercock PAG and Dennis MS: ABCD2 score and secondary stroke prevention: Meta-analysis and effect per 1,000 patients triaged. Neurology. 85:373–380. 2015.PubMed/NCBI View Article : Google Scholar

8 

Amarenco P, Labreuche J and Lavallée PC: Patients with transient ischemic attack with ABCD2 <4 can have similar 90-day stroke risk as patients with transient ischemic attack with ABCD2 ≥4. Stroke. 43:863–865. 2012.PubMed/NCBI View Article : Google Scholar

9 

Sanders LM, Srikanth VK, Blacker DJ, Jolley DJ, Cooper KA and Phan TG: Performance of the ABCD2 score for stroke risk post TIA: Meta-analysis and probability modeling. Neurology. 79:971–980. 2012.PubMed/NCBI View Article : Google Scholar

10 

Perry JJ, Sharma M, Sivilotti ML, Sutherland J, Symington C, Worster A, Émond M, Stotts G, Jin AY, Oczkowski WJ, et al: Prospective validation of the ABCD2 score for patients in the emergency department with transient ischemic attack. CMAJ. 183:1137–1145. 2011.PubMed/NCBI View Article : Google Scholar

11 

Memczak S, Jens M, Elefsinioti A, Torti F, Krueger J, Rybak A, Maier L, Mackowiak SD, Gregersen LH, Munschauer M, et al: Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 495:333–338. 2013.PubMed/NCBI View Article : Google Scholar

12 

Esteller M: Non-coding RNAs in human disease. Nat Rev Genet. 12:861–874. 2011.PubMed/NCBI View Article : Google Scholar

13 

Vicens Q and Westhof E: Biogenesis of circular RNAs. Cell. 159:13–14. 2014.PubMed/NCBI View Article : Google Scholar

14 

Wilusz JE and Sharp PA: Molecular biology: A circuitous route to noncoding RNA. Science. 340:440–441. 2013.PubMed/NCBI View Article : Google Scholar

15 

Mehta SL, Pandi G and Vemuganti R: Circular RNA expression profiles alter significantly in mouse brain after transient focal ischemia. Stroke. 48:2541–2548. 2017.PubMed/NCBI View Article : Google Scholar

16 

Zhao M, Gao F, Zhang D, Wang S, Zhang Y, Wang R and Zhao J: Altered expression of circular RNAs in Moyamoya disease. J Neurol Sci. 381:25–31. 2017.PubMed/NCBI View Article : Google Scholar

17 

Research Committee on the Pathology and Treatment of Spontaneous Occlusion of the Circle of Willis; Health Labour Sciences Research Grant for Research on Measures for Infractable Diseases: Guidelines for diagnosis and treatment of moyamoya disease (spontaneous occlusion of the circle of Willis). Neurol Med Chir(Tokyo). 52:245–266. 2012.PubMed/NCBI View Article : Google Scholar

18 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar

19 

Pasquinelli AE: MicroRNAs and their targets: Recognition, regulation and an emerging reciprocal relationship. Nat Rev Genet. 13:271–282. 2012.PubMed/NCBI View Article : Google Scholar

20 

Chou CH, Chang NW, Shrestha S, Hsu SD, Lin YL, Lee WH, Yang CD, Hong HC, Wei TY, Tu SJ, et al: miRTarBase 2016: Updates to the experimentally validated miRNA-target interactions database. Nucleic Acids Res. 44(D1):D239–D247. 2016.PubMed/NCBI View Article : Google Scholar

21 

Hansen TB, Jensen TI, Clausen BH, Bramsen JB, Finsen B, Damgaard CK and Kjems J: Natural RNA circles function as efficient microRNA sponges. Nature. 495:384–388. 2013.PubMed/NCBI View Article : Google Scholar

22 

Chen Y, Li C, Tan C and Liu X: Circular RNAs: A new frontier in the study of human diseases. J Med Genet. 53:359–365. 2016.PubMed/NCBI View Article : Google Scholar

23 

Shao Y and Chen Y: Roles of circular RNAs in neurologic disease. Front Mol Neurosci. 9(25)2016.PubMed/NCBI View Article : Google Scholar

24 

You X, Vlatkovic I, Babic A, Will T, Epstein I, Tushev G, Akbalik G, Wang M, Glock C, Quedenau C, et al: Neural circular RNAs are derived from synaptic genes and regulated by development and plasticity. Nat Neurosci. 18:603–610. 2015.PubMed/NCBI View Article : Google Scholar

25 

Chen S, Li T, Zhao Q, Xiao B and Guo J: Using circular RNA hsa_circ_0000190 as a new biomarker in the diagnosis of gastric cancer. Clin Chim Acta. 466:167–171. 2017.PubMed/NCBI View Article : Google Scholar

26 

Wang K, Long B, Liu F, Wang JX, Liu CY, Zhao B, Zhou LY, Sun T, Wang M, Yu T, et al: A circular RNA protects the heart from pathological hypertrophy and heart failure by targeting miR-223. Eur Heart J. 37:2602–2611. 2016.PubMed/NCBI View Article : Google Scholar

27 

Cui X, Niu W, Kong L, He M, Jiang K, Chen S, Zhong A, Li W, Lu J and Zhang L: hsa_circRNA_103636: Potential novel diagnostic and therapeutic biomarker in Major depressive disorder. Biomark Med. 10:943–952. 2016.PubMed/NCBI View Article : Google Scholar

28 

Burd CE, Jeck WR, Liu Y, Sanoff HK, Wang Z and Sharpless NE: Expression of linear and novel circular forms of an INK4/ARF-associated non-coding RNA correlates with atherosclerosis risk. PLoS Genet. 6(e1001233)2010.PubMed/NCBI View Article : Google Scholar

29 

Bang OY, Fujimura M and Kim SK: The pathophysiology of moyamoya disease: An update. J Stroke. 18:12–20. 2016.PubMed/NCBI View Article : Google Scholar

30 

Kamada F, Aoki Y, Narisawa A, Abe Y, Komatsuzaki S, Kikuchi A, Kanno J, Niihori T, Ono M, Ishii N, et al: A genome-wide association study identifies RNF213 as the first Moyamoya disease gene. J Hum Genet. 56:34–40. 2011.PubMed/NCBI View Article : Google Scholar

31 

Kang HS, Kim JH, Phi JH, Kim YY, Kim JE, Wang KC, Cho BK and Kim SK: Plasma matrix metalloproteinases, cytokines and angiogenic factors in moyamoya disease. J Neurol Neurosurg Psychiatry. 81:673–678. 2010.PubMed/NCBI View Article : Google Scholar

32 

Rafat N, Beck GCh, Peña-Tapia PG, Schmiedek P and Vajkoczy P: Increased levels of circulating endothelial progenitor cells in patients with Moyamoya disease. Stroke. 40:432–438. 2009.PubMed/NCBI View Article : Google Scholar

33 

Bedini G, Blecharz KG, Nava S, Vajkoczy P, Alessandri G, Ranieri M, Acerbi F, Ferroli P, Riva D, Esposito S, et al: Vasculogenic and angiogenic pathways in moyamoya disease. Curr Med Chem. 23:315–345. 2016.PubMed/NCBI View Article : Google Scholar

34 

Nanba R, Kuroda S, Ishikawa T, Houkin K and Iwasaki Y: Increased expression of hepatocyte growth factor in cerebrospinal fluid and intracranial artery in moyamoya disease. Stroke. 35:2837–2842. 2004.PubMed/NCBI View Article : Google Scholar

35 

Kim SK, Yoo JI, Cho BK, Hong SJ, Kim YK, Moon JA, Kim JH, Chung YN and Wang KC: Elevation of CRABP-I in the cerebrospinal fluid of patients with Moyamoya disease. Stroke. 34:2835–2841. 2003.PubMed/NCBI View Article : Google Scholar

36 

Frank PG, Woodman SE, Park DS and Lisanti MP: Caveolin, caveolae, and endothelial cell function. Arterioscler Thromb Vasc Biol. 23:1161–1168. 2003.PubMed/NCBI View Article : Google Scholar

37 

Bartel DP: MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell. 116:281–297. 2004.PubMed/NCBI View Article : Google Scholar

38 

Dai D, Lu Q, Huang Q, Yang P, Hong B, Xu Y, Zhao W, Liu J and Li Q: Serum miRNA signature in Moyamoya disease. PLoS One. 9(e102382)2014.PubMed/NCBI View Article : Google Scholar

39 

Zhao S, Gong Z, Zhang J, Xu X, Liu P, Guan W, Jing L, Peng T, Teng J and Jia Y: Elevated serum microRNA Let-7c in Moyamoya disease. J Stroke Cerebrovasc Dis. 24:1709–1714. 2015.PubMed/NCBI View Article : Google Scholar

40 

Hallemeier CL, Rich KM, Grubb RL Jr, Chicoine MR, Moran CJ, Cross DT III, Zipfel GJ, Dacey RG Jr and Derdeyn CP: Clinical features and outcome in north american adults with Moyamoya phenomenon. Stroke. 37:1490–1496. 2006.PubMed/NCBI View Article : Google Scholar

41 

Kraemer M, Heienbrok W and Berlit P: Moyamoya disease in Europeans. Stroke. 39:3193–3200. 2008.PubMed/NCBI View Article : Google Scholar

42 

Duan L, Bao XY, Yang WZ, Shi WC, Li DS, Zhang ZS, Zong R, Han C, Zhao F and Feng J: Moyamoya disease in China: Its clinical features and outcomes. Stroke. 43:56–60. 2012.PubMed/NCBI View Article : Google Scholar

43 

Kikuta K, Takagi Y, Nozaki K, Sawamoto N, Fukuyama H and Hashimoto N: The presence of multiple microbleeds as a predictor of subsequent cerebral hemorrhage in patients with moyamoya disease. Neurosurgery. 62:104–11; discussion 111-2. 2008.PubMed/NCBI View Article : Google Scholar

44 

Morioka M, Hamada JI, Kawano T, Todaka T, Yano S, Kai Y and Ushio Y: Angiographic dilatation and branch extension of the anterior choroidal and posterior communicating arteries are predictors of hemorrhage in adult Moyamoya patients. Stroke. 34:90–95. 2003.PubMed/NCBI View Article : Google Scholar

45 

Matsushige T, Kraemer M, Schlamann M, Berlit P, Forsting M, Ladd ME, Sure U and Wrede KH: Ventricular microaneurysms in Moyamoya angiopathy visualized with 7T MR angiography. AJNR Am J Neuroradiol. 37:1669–1672. 2016.PubMed/NCBI View Article : Google Scholar

46 

Li H, Yue H, Hao Y, Li H, Wang S, Yu L, Zhang D, Cao Y and Zhao J: Expression profile of long noncoding RNAs in human cerebral aneurysms: A microarray analysis. J Neurosurg. 127:1055–1062. 2017.PubMed/NCBI View Article : Google Scholar

47 

Zhao M, Zhang D, Wang S, Zhang Y, Deng X and Zhao J: The collateral circulation in moyamoya disease: A single-center experience in 140 pediatric patients. Pediatr Neurol. 77:78–83. 2017.PubMed/NCBI View Article : Google Scholar

48 

Zhang Y, Chen B, Ming L, Qin H, Zheng L, Yue Z, Cheng Z, Wang Y, Zhang D, Liu C, et al: MicroRNA-141 inhibits vascular smooth muscle cell proliferation through targeting PAPP-A. Int J Clin Exp Pathol. 8:14401–14408. 2015.PubMed/NCBI

49 

Jones JA, Spinale FG and Ikonomidis JS: Transforming growth factor-beta signaling in thoracic aortic aneurysm development: A paradox in pathogenesis. J Vasc Res. 46:119–137. 2009.PubMed/NCBI View Article : Google Scholar

50 

Sappino AP, Madani R, Huarte J, Belin D, Kiss JZ, Wohlwend A and Vassalli JD: Extracellular proteolysis in the adult murine brain. J Clin Invest. 92:679–685. 1993.PubMed/NCBI View Article : Google Scholar

51 

Shah PK, Falk E, Badimon JJ, Fernandez-Ortiz A, Mailhac A, Villareal-Levy G, Fallon JT, Regnstrom J and Fuster V: Human monocyte-derived macrophages induce collagen breakdown in fibrous caps of atherosclerotic plaques. Potential role of matrix-degrading metalloproteinases and implications for plaque rupture. Circulation. 92:1565–1569. 1995.PubMed/NCBI

52 

Lee JM, Yin KJ, Hsin I, Chen S, Fryer JD, Holtzman DM, Hsu CY and Xu J: Matrix metalloproteinase-9 and spontaneous hemorrhage in an animal model of cerebral amyloid angiopathy. Ann Neurol. 54:379–382. 2003.PubMed/NCBI View Article : Google Scholar

53 

McMillan WD, Tamarina NA, Cipollone M, Johnson DA, Parker MA and Pearce WH: Size Matters: The relationship between MMP-9 expression and aortic diameter. Circulation. 96:2228–2232. 1997.PubMed/NCBI View Article : Google Scholar

54 

Kavsak P, Rasmussen RK, Causing CG, Bonni S, Zhu H, Thomsen GH and Wrana JL: Smad7 binds to Smurf2 to form an E3 ubiquitin ligase that targets the TGF beta receptor for degradation. Mol Cell. 6:1365–1375. 2000.PubMed/NCBI View Article : Google Scholar

55 

Sang QX: Complex role of matrix metalloproteinases in angiogenesis. Cell Res. 8:171–177. 1998.PubMed/NCBI View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhao M, Li W, Ye X, Zhang Q, Zhang Y and Zhao J: Differentially expressed circular RNA profile in hemorrhagic and ischemic moyamoya disease. Biomed Rep 24: 45, 2026.
APA
Zhao, M., Li, W., Ye, X., Zhang, Q., Zhang, Y., & Zhao, J. (2026). Differentially expressed circular RNA profile in hemorrhagic and ischemic moyamoya disease. Biomedical Reports, 24, 45. https://doi.org/10.3892/br.2026.2118
MLA
Zhao, M., Li, W., Ye, X., Zhang, Q., Zhang, Y., Zhao, J."Differentially expressed circular RNA profile in hemorrhagic and ischemic moyamoya disease". Biomedical Reports 24.4 (2026): 45.
Chicago
Zhao, M., Li, W., Ye, X., Zhang, Q., Zhang, Y., Zhao, J."Differentially expressed circular RNA profile in hemorrhagic and ischemic moyamoya disease". Biomedical Reports 24, no. 4 (2026): 45. https://doi.org/10.3892/br.2026.2118
Copy and paste a formatted citation
x
Spandidos Publications style
Zhao M, Li W, Ye X, Zhang Q, Zhang Y and Zhao J: Differentially expressed circular RNA profile in hemorrhagic and ischemic moyamoya disease. Biomed Rep 24: 45, 2026.
APA
Zhao, M., Li, W., Ye, X., Zhang, Q., Zhang, Y., & Zhao, J. (2026). Differentially expressed circular RNA profile in hemorrhagic and ischemic moyamoya disease. Biomedical Reports, 24, 45. https://doi.org/10.3892/br.2026.2118
MLA
Zhao, M., Li, W., Ye, X., Zhang, Q., Zhang, Y., Zhao, J."Differentially expressed circular RNA profile in hemorrhagic and ischemic moyamoya disease". Biomedical Reports 24.4 (2026): 45.
Chicago
Zhao, M., Li, W., Ye, X., Zhang, Q., Zhang, Y., Zhao, J."Differentially expressed circular RNA profile in hemorrhagic and ischemic moyamoya disease". Biomedical Reports 24, no. 4 (2026): 45. https://doi.org/10.3892/br.2026.2118
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team