Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
February 2012 Volume 3 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
February 2012 Volume 3 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Influence of interleukin-8 (IL-8) and IL-8 receptors on the migration of human keratinocytes, the role of PLC-γ and potential clinical implications

  • Authors:
    • Wen G. Jiang
    • Andrew J. Sanders
    • Fiona Ruge
    • Keith G. Harding
  • View Affiliations / Copyright

    Affiliations: Departments of Surgery and Wound Healing, Cardiff University School of Medicine, Heath Park, Cardiff CF14 4XN, UK
  • Pages: 231-236
    |
    Published online on: December 1, 2011
       https://doi.org/10.3892/etm.2011.402
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Interleukin (IL)-8 is a pro-inflammatory cytokine that has a direct effect on immune cells, including polymorphonuclear cells. Keratinocytes are a rich source of IL-8. However, there is little knowledge on the role of IL-8 in clinical wound healing and the direct biological effect of IL-8 on keratinocytes. In this study, the effect of recombinant human IL-8 (rhIL-8) on migration and adhesion was tested using HaCaT keratinocytes as a cell model. The cell functions were evaluated using impedance cell sensing. The expression of IL-8 receptor (IL-8R) transcripts in human skin and wounds (acute and chronic) was assessed using real-time transcript analysis. rhIL-8 significantly increased the migration of keratinocytes (3.5±0.3 for cells treated with IL-8 vs. 2.7±0.6 for controls; p=0.029). It is interesting to note that treatment of keratinocytes with IL-8 resulted in a marked shift in the responsive frequencies. IL-8 only resulted in a marginal increase in cell adhesion, which was particularly noticeable at high frequencies. The PLC-γ inhibitor completely eradicated the action of IL-8 on the migration of HaCaT cells. Using real time PCR, it was found that chronic wounds had significantly lower levels of the B form of the IL-8R (IL-8RB) (p=0.045) and marginally lower levels of the A form, IL-8RA, in comparison with acute wounds. Therefore, IL-8 has a direct and profound stimulatory effect on the migration of human keratinocytes, which is likely to occur via the PLC-γ pathway. Together with a reduced level of IL-8Rs in difficult-healing wounds, IL-8 has a clear prognostic and therapeutic value in wound healing.

Introduction

Interleukin (IL)-8, also known as neutrophil activating peptide, CXCL8, small inducible cytokine subfamily B (SCY88) and granulocyte chemotactic protein-1 (GCP-1), is a cytokine that belongs to the CXC chemokine family (1,2). IL-8 is a small protein that is encoded by the IL-8 gene, which is located on chromosome 4q12-q21 (3). IL-8 has been shown to be linked to a number of conditions including viral bronchiolitis (4–6), cystic fibrosis related pathophysiology of the lungs, infection and other inflammatory diseases, including rheumatoid arthritis (7). It plays a pivotal role in the pathophysiology of sepsis. IL-8 is a powerful chemoattractant for neutrophils, basophils and T cells, but not monocytes, although the latter is a rich source of IL-8.

The action of IL-8 is mediated by its receptor, IL-8R. IL-8R has two forms, IL-8RA and IL-8RB. IL-8RA is also known as chemokine, CXC motif, receptor-1 (CXCR1), or IL-8R1. IL-8RA is located on chromosome 2q35 (8,10). IL-8RB is also known as chemokine, CXC motif, receptor-2 (CXCR2) or IL-8R2 (8,9), and is located on chromosome 2q35. In the body, monocytes and fibroblasts are rich sources of IL-8. It was recently reported that the healing of diabetic and non-diabetic leg ulcers following treatment with Lactobacillus plantarum, increased such that, to a certain degree, it coincided with the increase in the IL-8 production of the polymorphonuclear cells in the wound base (11). It has also been shown that IL-8 has an impact on the migration of fibroblasts and endothelial cells.

IL-8 has been found to be highly stained in keratinocytes (12). Keratinocytes increased the expression of IL-8 in response to inflammatory stimuli such as tissue plasminogen activator (tPA) (13). Other agents, include trypsin, which increases and salbutamol, which inhibits the production of IL-8 from keratinocytes (14). Gingko biloba extract also inhibits IL-8 secretion from keratinocytes (15). IL-8RA and IL-8RB have been found to be present in keratinocytes of the skin. IL-8 and IL-8R have also been shown to be co-expressed in gingival keratinocytes (16). In psoriasis, IL-8R has been found to be overexpressed in keratinocytes, which may be inhibited by FK-506, an anti-psoriasis compound (17).

The potential role of IL-8 as a cell migration and chemotaxis factor indicates a significant role in wound healing. Indeed, it has been demonstrated that IL-8 may be chemotactic for human keratinocytes, which express IL-8Rs (18). In animal models using IL-8RB knockout mice, there was a delayed rate of wound healing (19). This appears to be associated with a delay in monocyte recruitment to the wounding space and a delay in re-epithelialisation and angiogenesis.

The impact of IL-8 and the IL-8R in the context of chronic wounds and clinical wound healing have otherwise not been well investigated. Chronic wounds represent a major health issue. Derived from multiple aetiology, including diabetes mellitus, pressure sores and circulation conditions, chronic wounds are costly to treat for the healthcare system. For example, in the UK, there are approximately 200,000 patients with chronic wounds at any given time, the care of which consumes more than 3% of the budget of the NHS. However, the biology of wound healing and, in particular, chronic wound healing are not yet fully understood. Wound healing is a complex biological process that requires temporal, special and co-ordinated action of multiple cell types, including immune cells for combating possible pathogens, fibroblasts for matrix deposition and remodelling, endothelial cells for the angiogenic process and keratinocytes for re-epithelialisation. IL-8 appears to play multiple roles in these processes.

In the present study, we investigated the transcript expression of IL-8RA and IL-8RB in a cohort of human wound tissues, and report the significant link between the cytokine complex and the fate of the wound. Furthermore, we have shown that IL-8 has a direct effect on the migration of human keratinocytes.

Materials and methods

Cells and tissues

The human keratinocyte cell line, HaCaT, was purchased from the German Cancer Institute and routinely maintained in Dulbecco’s Modified Eagle’s Medium (DMEM), supplemented with 10% fetal calf serum (FCS) and antibiotics. A cohort of fresh, frozen human wound tissues, acute wound tissues (n=10) and chronic wound tissues from venous ulcers (n=14), were collected under an Ethics Approval from clinics in the University Hospital of Wales, and used for histology and gene expression analysis, as previously reported (20,21).

Recombinant human IL-8 (rhIL-8) was obtained from NBSB (Potters Bar, England, UK). Antibodies to human IL-8RA and IL-8RB were from Santa Cruz Biotechnologies Inc. (Santa Cruz, CA, USA). ERK inhibitor II (FR180204) and PLC-γ inhibitor (U73122) were purchased from Calbiochem (Merck Chemicals Ltd, Nottingham, UK). FAK inhibitor was from Tocris (Bristol, England), and Arp2/3 inhibitor was from Chemidiv Ltd (San Diego, CA, USA).

Tissue processing and preparation of materials for protein and molecular investigations

Tissues were frozen and sectioned on a Leica cryostat at 5–10 μM thickness. The sections were divided into two portions: one section was processed for histological investigation and the other for extraction of genetic materials. For histological analysis, sections were laid on slides, prior to fixing and blocking by hydrogen peroxide and methanol. The section was then processed for H&E staining.

A large number of frozen sections were combined and homogenised using a homogenizer in a RNA isolation buffer (Triagent; Sigma-Aldrich, Poole, Dorset, UK). Total RNA was subsequently separated and quantified using a spectrophotometer.

Quantitative analysis of IL-8RA and IL-8RB transcripts in cells and tissues

Total RNA was extracted from cell pellets using Triagent obtained from Sigma-Aldrich. Fresh frozen wound tissues were combined, resuspended in Triagent and homogenised using a hand-held homogeniser (Fisher Scientific). Total RNA was extracted and purified from the cells and tissue sections according to manufacturer’s instructions. Equal amounts of RNA were reverse transcribed into complementary DNA (cDNA) using a first-strand reverse transcription (RT) kit from Bio-Rad (Hemel Hemstead, UK). For quantitative analysis of the IL-8R transcripts, we employed a real-time quantitative PCR assay, as previously reported (22–24). Briefly, primers (sequences shown in Table I) were designed using the Beacon Designer software and satisfied the following criteria: the amplified region sits on an exon-exon joint region and is specific to the respective target; the amplicon is smaller than 150 bp; a sequence that was complementary to the probe was added to one of the primers (routinely the reverse primer); and the annealing temperature is, or is close to being, 55°C. The Ampliflor Uniprimer system was used as the probe system. cDNA from cells and tissues, together with a set of standards were amplified simultaneously, on a IcyclerIQ5 system (Bio-Rad). The concentration of the respective transcript was calculated from the standard curve, which was simultaneously generated. The levels of the transcripts are shown here as the respective transcript/glyceraldehyde 3-phosphate dehydrogenase (GAPDH) ratio.

Table I.

Primers used in the quantitative analysis of gene transcripts.

Table I.

Primers used in the quantitative analysis of gene transcripts.

Molecule nameForward primer (5′-3′)Reverse primer (5′-3′)
IL-8RA TGGGGACTGTCTATGAATCT ACTGAACCTGACCGTACACATTTCCCAGGACCTCATA
IL-8RB TCAAATTCATATGTCTCAGCA ACTGAACCTGACCGTACAGTTGCCCATGTCCTCATA
IL-8 TCTCTTGGCAGCCTTCCT ACTGAACCTGACCGTACATGTCTTTATGCACTGACATCT
GAPDH CTGAGTACGTCGTGGAGTC ACTGAACCTGACCGTACACAGAGATGATGACCCTTTTG

[i] GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IL-8R, IL-8 receptor; IL, interleukin.

Electric cell-substrate impedance sensing (ECIS)-based cell adhesion and cell migration assays

ECIS Ztheta and 96W1E arrays were used (Applied Biophysics Inc, Troy, NY, USA) (23,25,26). Following treatment of the array surface with a cysteine solution, the arrays were incubated with complete medium for 1 h. The same number of HaCaT cells were added into each well, with or without IL-8 and small inhibitors. Cell adhesion was recorded immediately following addition of the cells, at multiple frequencies, for up to 6 h. For the cell migration assay, confluent HaCaT cells with or without IL-8, and small signalling inhibitors, were wounded for 20 sec at 6 V. The migration of the cells was immediately traced following wounding for up to 18 h, again with multiple frequencies. Cell behaviour was modelled using the Rb method, using a cell-free well as a reference unit. Cell migration and adhesion are shown here as the change in resistance.

Statistical analysis was carried out using Minitab. For normality test, the Anderson-Darling test was used, and for statistical differences the Student’s t-test and Mann-Whitney U test were used as appropriate.

Results

IL-8 markedly increased the migration of keratinocytes

Using electrical wounding methods, we first tested the impact of rhIL-8 on the migration of HaCaT cells following wounding. As seen in Fig. 1, IL-8 markedly increased the migration of the cells (Fig. 1).

Figure 1.

The effect of rhIL-8 on the migration of HaCaT cells. Confluent HaCaT cells in the 96W1E array were wounded for 20 sec at 6 V, following which the migration was immediately traced for up to 8 h over 12 frequencies [shown are (A) 1000, (B) 4000 and (C) 32000 Hz]. rhIL-8 markedly increased the pace of migration of the cells. rhIL-8, recombinant human IL-8.

Using 3-D cellular modelling, the differences between control and IL-8-treated cells were clearly visible (Fig. 2) with the maximum effects observed at a frequency of 4,000 Hz. This difference was statistically significant (p<0.01) (Fig. 2).

Figure 2.

Effect of rhIL-8 on cellular migration of HaCaT cells, a 3-D demonstration. Cells were wounded in a similar fashion as in Fig. 1 and recorded following wounding over 7 h. When treated with IL-8, cells migrated earlier (B) and faster than the control cells (B). (A and B) mean of 8 traces, (C) Cell modelling. *p<0.01 vs. control cells. rhIL-8, recombinant human IL-8.

IL-8 had a significant effect on the adhesion of keratinocytes

We further tested to see whether IL-8 had an effect on the adhesion of keratinocytes to the matrix. Again, using the ECIS attachment method, we evaluated the rate of cell adhesion. As shown in Fig. 3, the presence of IL-8 markedly increased the adhesion of the cells.

Figure 3.

rhIL-8 had a significant impact on the adhesion of keratinocytes, assessed using the ECIS method. Cells were added to the ECIS arrays, pre-treated with 10% FCS; the adhesion was traced immediately following addition of the cells. (A) Traces of adhesion, (B) normalised resistance of adhesion traces, (C and D) 3-D modelling of adhesion (as resistance). rhIL-8, recombinant human IL-8; ECIS, electric cell-substrate impedance sensing; FCS, fetal calf serum; WT, wild-type.

Potential signalling pathways in the action of IL-8

In order to explore potential pathways involved in the aforementioned action, we used a panel of small inhibitors to some of the known pathways downstream of the IL-8R. We have demonstrated that the PLC-γ inhibitor markedly inhibited the increased migration induced by IL-8, and brought the migration to the control level. The same inhibitor has an inhibitory effect on cell adhesion, although this is yet to reach significance (data not shown). The ERK inhibitor also had an inhibitory effect on the migration of keratinocytes, but did not completely eliminate the action of IL-8. The FAK and ARP2/3 inhibitors had marginal effects (Fig. 4).

Figure 4.

Potential signalling pathways involved in IL-8-mediated migration in HaCaT cells. (A) ECIS traces following electric wounding, (B) Mean changes of resistance. *p<0.05 vs. without IL-8. n=4. rhIL-8, recombinant human IL-8; ECIS, electric cell-substrate impedance sensing.

Human chronic wound tissues had a marked low level of IL-8RB

We investigated the transcript levels of the IL-8Rs, IL-8RA and IL-8RB in acute and chronic wound tissues. As shown in Fig. 5, there were significantly lower levels of IL-8RB in chronic wound tissues than in acute tissues (Fig. 5). Although the levels of IL-8RA tended to be lower, this was not statistically significant.

Figure 5.

The levels of IL-8 receptor transcript expression in acute and chronic wounds. (A) IL-RA, (B) IL-8RB. The levels shown are the medians. *p<0.05 vs. acute wound tissues, as shown by the Mann-Whitney U test. IL-8R, IL-8 receptor.

Discussion

The present study reports that the status of the IL-8R, IL-8RB, is linked to clinical outcome in chronic wounds. Furthermore, this study further demonstrates that IL-8 has a direct impact on the migration of human keratinocytes.

We show that IL-8 has a profound effect on the migration of keratinocytes. It has previously been shown that IL-8 may act as a chemoattractant to keratinocytes, in that keratinocytes may respond to the gradient change of IL-8. In the present study, we used a novel method, ECIS, and an electrical wounding model. In this model, cells were wounded by an electric current, and the migration of cells from the surrounding areas was traced in the prescence of IL-8. The data presented here, therefore, clearly indicate that IL-8 also induces migration, most likely in the form of chemokinesis, of keratinocytes, another crucial form of cell migration.

CXC chemokine-induced chemotaxis involves a number of intracellular signalling pathways, classically the JAK, Src/PI3K, FAK and PLC pathways (27–30). The present study clearly demonstrates that the IL-8-induced migration of HaCaT cells (chemokinesis) critically requires the PLC-γ pathway, in that the PLC-γ inhibitor suppressed IL-8-induced migration and completely blocked the action of IL-8. By contrast, FAK, ARP2/3 and ERK inhibitors do not appear to signficantly affect the action of IL-8.

It has previously been shown that IL-8 is associated with wound healing in vivo (19). In an IL-8RB knockout mouse model, it was found that the rate of wound healing was reduced, thought to be the result of a reduction in monocyte recruitment to the wounding space, reduced angiogenesis and re-epithelialisation. In this study, we provide further evidence that IL-8 itself has a direct impact on the re-epithelialisation of keratinocytes.

Despite the evidence, in vitro and in vivo, that IL-8 and IL-8Rs have an impact on wound healing, it is not known how the IL-8Rs are linked to the healing of human wounds. The present study provides first-line evidence that in chronic wounds, the levels of IL-8RA and, in particular, IL-8RB are significantly lower when compared with acute wound tissues. This is noteworthy, as it indicates that a loss or reduction of IL-8Rs may be an essential part of the mechanisms of why wounds are not healing or responding to IL-8. It is highly plausible that the low levels of IL-8Rs rendered cells necessary for wound healing irresponsive or poorly responsive to IL-8, a cytokine that appears to be involved in the wound healing process. Together with in vitro data and evidence from animal studies, it is suggested that IL-8 and IL-8Rs are a useful indicator for the nature of healing of a given wound. This further suggests that IL-8 may be a means to manipulate the healing of wound tissues and may have a therapeutic value. This is likely to be manifested by the direct effect of IL-8 on keratinocytes, on endothelial cells, through the induction of angiogenesis, on immune cells for combating infection and fibroblasts during the tissue modelling process of wound healing. Of course, IL-8 is not at all a clear wound healer without concerns. It has been shown that IL-8RB may mediate skin carcinogenesis when overexpressed or repeatedly induced (30).

In conclusion, IL-8 has a profound impact on keratinocytes by increasing the rate of cell migration. Together with the observation that IL-8Rs are markedly lower in chronic than in acute wounds, it is suggested that IL-8 and its receptors have prognostic and therapeutic value in difficult-healing wounds.

Acknowledgements

The authors wish to thank Dr Kevin Conway for his help in the collection of tissues. The authors also wish to thank the Welsh Government (A4B programme), Cardiff Partnership Fund, Cancer Research Wales and Albert Hung Foundation for their support.

References

1. 

J Van DammeB DecockR ConingsJP LenaertsG OpdenakkerA BilliauThe chemotactic activity for granulocytes produced by virally infected fibroblasts is identical to monocyte-derived interleukin 8Eur J Immunol191189119419892668011

2. 

SD WolpeA CeramiMacrophage inflammatory proteins 1 and 2: members of a novel superfamily of cytokinesFASEB J32565257319892687068

3. 

WS ModiZQ ChenLocalization of the human CXC chemokine subfamily on the long arm of chromosome 4 using radiation hybridsGenomics47136139199810.1006/geno.1997.51009465307

4. 

J HullA ThomsonD KwiatkowskiAssociation of respiratory syncytial virus bronchiolitis with the interleukin 8 gene region in UK familiesThorax5510231027200010.1136/thorax.55.12.102311083887

5. 

RL SmythK MobbsU O’HeaD AshbyCA HartThe association between disease severity, cytokines and virus genotype in infants with respiratory syncytial virus (RSV) bronchiolitisArch Dis Child82Suppl 1A4A52000

6. 

J HullK RowlandsE LockhartM SharlandC MooreN HanchardDP KwiatkowskiHaplotype mapping of the bronchiolitis susceptibility locus near IL8Hum Genet114272279200410.1007/s00439-003-1038-x14605870

7. 

M SrivastavaO EidelmanJ ZhangC PaweletzH CaohuyQ YangKA JacobsonE HeldmanW HuangC JozwikBS PollardHB PollardDigitoxin mimics gene therapy with CFTR and suppresses hypersecretion of IL-8 from cystic fibrosis lung epithelial cellsProc Nat Acad Sci USA10176937698200410.1073/pnas.040203010115136726

8. 

SW MorrisN NelsonMB ValentineDN ShapiroAT LookCJ KozloskyMP BeckmannDP CerrettiAssignment of the genes encoding human interleukin-8 receptor types 1 and 2 and an interleukin-8 receptor pseudogene to chromosome 2q35Genomics14685691199210.1016/S0888-7543(05)80169-71427896

9. 

C MollereauF MuscatelliMG MatteiG VassartM ParmentierThe high-affinity interleukin 8 receptor gene (IL8RA) maps to the 2q33-q36 region of the human genome: cloning of a pseudogene (IL8RBP) for the low-affinity receptorGenomics16248251199310.1006/geno.1993.11678486366

10. 

PM MurphyHL TiffanyCloning of complementary DNA encoding a functional human interleukin-8 receptorScience25312801283199110.1126/science.1891716

11. 

MC PeralMM RachidNM GobbatoMA Huaman MartinezJC ValdezInterleukin-8 production by polymorphonuclear leukocytes from patients with chronic infected leg ulcers treated with Lactobacillus plantarumClin Microbiol Infect16281286201010.1111/j.1469-0691.2009.02793.x19519855

12. 

M SticherlingE BornscheuerJM SchröderE ChristophersLocalization of neutrophil-activating peptide-1/interleukin-8-immunoreactivity in normal and psoriatic skinJ Invest Dermatol962630199110.1111/1523-1747.ep125146891702820

13. 

C CataissonAJ PearsonMZ TsienF MasciaJL GaoS PastoreSH YuspaCXCR2 ligands and G-CSF mediate PKCalpha-induced intraepidermal inflammationJ Clin Invest11627572766200610.1172/JCI2751416964312

14. 

FR WetteyL XueR PettipherSalbutamol inhibits trypsin-mediated production of CXCL8 by keratinocytesCytokine362934200610.1016/j.cyto.2006.10.00817161617

15. 

S TrompezinskiM BonnevilleI PernetA DenisD SchmittJ ViacGingko biloba extract reduces VEGF and CXCL-8/ IL-8 levels in keratinocytes with cumulative effect with epigallocatechin-3-gallateArch Dermatol Res302183189201010.1007/s00403-009-0979-x19597830

16. 

A SfakianakisCE BarrDL KreutzerLocalization of the chemokine interleukin-8 and interleukin-8 receptors in human gingiva and cultured gingival keratinocytesJ Periodontal Res37154160200210.1034/j.1600-0765.2002.00024.x12009185

17. 

BS SchulzG MichelS WagnerR SüssA BeetzRU PeterL KeményT RuzickaIncreased expression of epidermal IL-8 receptor in psoriasis. Down-regulation by FK-506 in vitroJ Immunol1514399440619937691948

18. 

G MichelL KeményRU PeterA BeetzC RiedP ArenbergerT RuzickaInterleukin-8 receptor-mediated chemotaxis of normal human epidermal cellsFEBS Lett305241243199210.1016/0014-5793(92)80677-91299623

19. 

RM DevalarajaLB NanneyJ DuQ QianY YuMN DevalarajaA RichmondDelayed wound healing in CXCR2 knockout miceJ Invest Dermatol115234244200010.1046/j.1523-1747.2000.00034.x10951241

20. 

K ConwayG HarrisonP PriceKG HardingWG JiangExpression of HGF, HGF receptor and the JHGF regulators in the acute and chronic wounds in the lower limbWound Repair Reg156836922007

21. 

K ConwayG HarrisonP PriceKG HardingWG JiangVascular endothelial growth inhibitor represents an important target for therapeutic angiogenesis in the lower limbInt Wound J455642007

22. 

IA NazarenkoSK BhatnagarRJ HohmanA closed tube format for amplification and detection of DNA based on energy transferNucleic Acids Res2525162521199710.1093/nar/25.12.25169171107

23. 

WG JiangL YeG PatelKG HardingExpression of WAVES, the WASP (Wiskott-Aldrich Syndrome Protein) family of Verprolin Homologous proteins, in human wound tissues determines the fate of wound healingWound Repair Reg18594604201010.1111/j.1524-475X.2010.00630.x

24. 

WG JiangG DaviesTA MartinC ParrG WatkinsMD MasonRE ManselExpression of membrane type-1 matrix metalloproteinase, MT1-MMP in human breast cancer and its impact on invasiveness of breast cancer cellsInt J Mol Med17583590200616525713

25. 

CR KeeseJ WegenerSR WalkerI GiaeverElectrical wound-healing assay for cells in vitroProc Natl Acad Sci USA10115541559200410.1073/pnas.030758810014747654

26. 

WG JiangTA MartinJ Russell-LewisL YeA Douglas-JonesRE ManselEplin-alpha expression in human breast cancer, the impact on cellular migration and clinical outcomeMol Cancer771200810.1186/1476-4598-7-7118796137

27. 

WE HolmesJ LeeWJ KuangGC RiceWI WoodStructure and functional expression of a human interleukin-8 receptorScience25312781280199110.1126/science.1840701

28. 

LC BorishJW SteinkeCytokines and chemokinesJ Allergy Clin Immunol111Suppl 2S460S475200310.1067/mai.2003.10812592293

29. 

H SprengerAR LloydLL LautensTI BonnerDJ KelvinStructure, genomic organization, and expression of the human interleukin-8 receptor B geneJ Biol Chem269110651107219947512557

30. 

C CataissonR OhmanG PatelA PearsonM TsienS JayL WrightH HenningsSH YuspaInducible cutaneous inflammation reveals a protumorigenic role for keratinocyte CXCR2 in skin carcinogenesisCancer Res69319328200910.1158/0008-5472.CAN-08-249019118017

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Jiang WG, Sanders AJ, Ruge F and Harding KG: Influence of interleukin-8 (IL-8) and IL-8 receptors on the migration of human keratinocytes, the role of PLC-γ and potential clinical implications. Exp Ther Med 3: 231-236, 2012.
APA
Jiang, W.G., Sanders, A.J., Ruge, F., & Harding, K.G. (2012). Influence of interleukin-8 (IL-8) and IL-8 receptors on the migration of human keratinocytes, the role of PLC-γ and potential clinical implications. Experimental and Therapeutic Medicine, 3, 231-236. https://doi.org/10.3892/etm.2011.402
MLA
Jiang, W. G., Sanders, A. J., Ruge, F., Harding, K. G."Influence of interleukin-8 (IL-8) and IL-8 receptors on the migration of human keratinocytes, the role of PLC-γ and potential clinical implications". Experimental and Therapeutic Medicine 3.2 (2012): 231-236.
Chicago
Jiang, W. G., Sanders, A. J., Ruge, F., Harding, K. G."Influence of interleukin-8 (IL-8) and IL-8 receptors on the migration of human keratinocytes, the role of PLC-γ and potential clinical implications". Experimental and Therapeutic Medicine 3, no. 2 (2012): 231-236. https://doi.org/10.3892/etm.2011.402
Copy and paste a formatted citation
x
Spandidos Publications style
Jiang WG, Sanders AJ, Ruge F and Harding KG: Influence of interleukin-8 (IL-8) and IL-8 receptors on the migration of human keratinocytes, the role of PLC-γ and potential clinical implications. Exp Ther Med 3: 231-236, 2012.
APA
Jiang, W.G., Sanders, A.J., Ruge, F., & Harding, K.G. (2012). Influence of interleukin-8 (IL-8) and IL-8 receptors on the migration of human keratinocytes, the role of PLC-γ and potential clinical implications. Experimental and Therapeutic Medicine, 3, 231-236. https://doi.org/10.3892/etm.2011.402
MLA
Jiang, W. G., Sanders, A. J., Ruge, F., Harding, K. G."Influence of interleukin-8 (IL-8) and IL-8 receptors on the migration of human keratinocytes, the role of PLC-γ and potential clinical implications". Experimental and Therapeutic Medicine 3.2 (2012): 231-236.
Chicago
Jiang, W. G., Sanders, A. J., Ruge, F., Harding, K. G."Influence of interleukin-8 (IL-8) and IL-8 receptors on the migration of human keratinocytes, the role of PLC-γ and potential clinical implications". Experimental and Therapeutic Medicine 3, no. 2 (2012): 231-236. https://doi.org/10.3892/etm.2011.402
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team