Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
January 2013 Volume 5 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January 2013 Volume 5 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Analysis of the expression of KIR and HLA‑Cw in a Northeast Han population

  • Authors:
    • Yu Han
    • Ling Zhao
    • Zhenyu Jiang
    • Ning Ma
  • View Affiliations / Copyright

    Affiliations: Jilin Blood Center, Changchun, Jilin 130033, P.R. China, Department of Rheumatology, First Hospital, Jilin Unversity, Changchun 130021, P.R. China
  • Pages: 300-304
    |
    Published online on: October 25, 2012
       https://doi.org/10.3892/etm.2012.763
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The aim of this study was to investigate the expression of the human leukocyte antigen (HLA)‑Cw and killer cell immunoglobulin‑like receptor (KIR) genes in a Jilin Han population and to provide a theoretical basis for further studies of their roles in disease. A total of 154 unpaid Jilin Han blood donors were selected and KIR and HLA‑Cw genotyping was performed using PCR‑SSP. Recognition of HLA‑Cw and the corresponding activatory or inhibitory KIR receptor was distinguished according to the identification of HLA‑Cw and KIR. In the present study, the expression frequency of HLA‑C2Lys80+2DL1 was 27.27%, HLA‑C1Asn80+2DL2/2DL3 was 68.83%, 2DS2+HLA‑C1Asn80 was 9.74% and 2DS1+HLA‑C2Lys80 was 9.74%. Of the individuals in the study, 72.08% expressed only KIR2DL1 without HLA‑Cw, 21.43% expressed only KIR2DS1 without HLA‑CwLys‑KIR2DL1 and 2.60% expressed only KIR2DS2 without HLA‑CwAsn‑KIR2DL2/L3. In conclusion, the expression of inhibitory HLA‑Cw‑KIR is higher than the expression of activating HLA‑Cw‑KIR and approximately 20% of the individuals separately expressed the activated HLA‑Cw‑KIR in the Jilin Han population in the present study.

Introduction

Killer cell immunoglobulin-like receptor (KIR), expressed by natural killer (NK) cells and certain T cells, is a type of CD158 glucoprotein (1). Through the recognition of human leukocyte antigen (HLA)-I, KIR regulates the cytoactivity of the effector cell, begins the immunological process and regulates cytokine secretion. KIR gene clusters have extremely complex gene structures gradually formed from the single gene structure of KIR3DX1 (2). The human KIR gene cluster contains fifteen genes and two silencers. The KIR gene cluster encoding the receptor contains protein guide sequences (exons 1 and 2), the extracellular domain (exons 3–5), stem (exon 6), transmembrane domain (exon 7) and intracellular domain (exons 8 and 9). The KIR gene cluster genes are named according to their extracellular domain and intracellular domain structural features. An extracellular domain with two similar immunoglobulin domains would be named 2D, or 3D if it had three similar immunoglobulin domains. KIR genes with longer intracellular domains and transduction inhibitory signals are designated L, while those with shorter intracellular domains and transduction activition signals are designated S. The main ligand of KIR is the HLA-I class antigen. Following the recognition of various HLAs, the KIR receptor determines whether the object belongs to the ‘self’ or not, thus making it extremely important in immune regulation (3,4). The KIRs may be divided into two categories: stimulatory KIRs (sKIRs) and inhibitory KIRs (iKIRs).

The specific receptors of certain inhibitory KIR class HLA-I molecules are already known. The ligand of the inhibitory genes KIR2DL1, -2DL2 and -2DL3 is HLA-C. Based on the amino acid combination at the heavy chain loci 80, HLA-C has been divided into two groups. In the HLA-C1 group, the amino acid of site 80 is lysine, while in the HLA-C2 group it is aspartic acid. The ligand of KIR2DL1 is HLA-C2 and the ligand of KIR2DL2/2DL3 is HLA-C1 (5). KIR2DL1+HLA-C2 combined excitatory and inhibitory signals are stronger than those of KIR2DL2/2DL3+HLA-C1 (6). The ligand of KIR3DL1/S1 is the HLA-B antigen which contains a Bw4 structure. It has been reported that KIR3DL1/S1 is able to combine with the HLA-A antigen, which also contains a Bw4 structure (7). The ligand of KIR3DL2 is HLA-A3 or HLA-A11. The ligand of KIR2DL4 is HLA-G. The ligand of KIR2DS1-5, an activating gene of KIR, may be an HLA class I antigen although there is no direct evidence to support this theory. Individuals with variations in the KIR gene cluster number and type may be divided into the haploid A and B subtypes, according to its haploid configuration. Haploid A contains frame gene KIR2DL1, KIR2DL3, KIR3DL1 suppressor gene, and KIR2DS4 activating gene. Other configurations are collectively referred to as haploid B. Haploid B contains a number of activating genes.

HLA-Cw is distributed widely in human tissue cells, specifically recognized by KIR and involved in the regulation of NK cell function, which is the basis of NK cell recognition of self and non-self molecules. When the same HLA-Cw molecule is combined with different KIRs, it produces different signals to activate or inhibit the killing function of the NK cells (8). Observations have revealed that there are differences between individuals in the combined forms of HLA-Cw and sKIR or iKIR, which not only affect susceptibility to disease (9) but also disease progression (10). In order to understand the method of the recognition of HLA-Cw and KIR in a Chinese population, the KIR and its HLA-Cw ligands of 154 normal Han individuals from Jilin were examined by PCR-SSP and the identification of HLA-Cw and KIR was analyzed, to provide a the theoretical basis for future research concerning its role in disease progression.

Materials and methods

Objective of the study

A total of 154 normal specimens were selected from unpaid blood donors from a Jilin Han population. This group contained 84 males and 70 females (no blood relations) aged between 21 and 50 years old. Venous blood (5 ml) was obtained, placed in test tubes containing EDTA anticoagulants and stored in a −80°C refrigerator. The experimental protocol was established according to the guidelines of the Declaration of Helsinki and was approved by Human Ethics Committee of Jilin University. Informed consent was obtained from each subject prior to their inclusion in the study.

Genomic DNA extraction

Using the TIANamp Blood DNA kit (Tiangen Biotech Beijing Co. Ltd., Beijing, China), genomic DNA was extracted according to the manufacturer’s instructions. The DNA concentration was ≥80 mg/l and the purity was A260/280 = 1.65–1.90.

Primer synthesis

A previously published method for synthesizing the amplified KIR genes using PCR-SSP genotyping primers (Table I) was used (11). The internal control primers of reactions 1 to 15 were FGH (5′-GCCTTCCCAACCATTCCCTTA-3′) and RGH (5′-TCACGGATTTCTGTTGTGTTTC-3′). The length of the amplification product was 429 bp; the internal contrast primers of reaction 16 were DRB1-F (5′-TGCCAAGTGGAGCACCCAA-3′) and DRB1-R (5′-GCATCTTGCTCTGTGCAGAT-3′) and the length of the amplification products was 796 bp. The primers of the HLA-Cw gene for PCR-SSP genotyping were in accordance with those of Mandelboim et al(5). The primers are shown in Table II. All primers were synthesized by Beijing DingGuo ChangSheng Biotechnology Co., Ltd. (Beijing, China) and verified by BLAST.

Table I

Primers used for KIR genotyping by PCR-SSP.

Table I

Primers used for KIR genotyping by PCR-SSP.

GenePrimerSequencePrimerSequenceSize (bp)
2DL1F1 GTTGGTCAGATGTCATGTTTGAAR1 GGTCCCTGCCAGGTCTTGCG146
F2 TGGACCAAGAGTCTGCAGGAR2 TGTTGTCTCCCTAGAAGACG330
2DL2F1 CTGGCCCACCCAGGTCGR1 GGACCGATGGAGAAGTTGGCT173
F2 GAGGGGGAGGCCCATGAATR2 TCGAGTTTGACCACTCGTAT151
2DL3F1 CTTCATCGCTGGTGCTGR1 AGGCTCTTGGTCCATTACAA550
F2 TCCTTCATCGCTGGTGCTGR2 GGCAGGAGACAACTTTGGATCA800
2DL4F1 CAGGACAAGCCCTTCTGCR1CTGGGTGCCGACCACT254
F2 ACCTTCGCTTACAGCCCGR2 CCTCACCTGTGACAGAAACAG288
2DS2F1 TTCTGCACAGAGAGGGGAAGTAR1 GGGTCACTGGGAGCTGACAA175
F2CGGGCCCCACGGTTTR2 GGTCACTCGAGTTTGACCACTCA240
2DS3F1TGGCCCACCCAGGTCGR1 TGAAAACTGATAGGGGGAGTGAGG242
F2 CATTGACATGTACCATCTATCCACR2 AAGCAGTGGGTCACTTGAC190
2DS5F1 TGATGGGGTCTCCAAGGGR1 TCCAGAGGGTCACTGGGC126
F2 ACAGAGAGGGGACGTTTAACCR2 ATGTCCAGAGGGTCACTGGG178
3DL1F1CGCTGTGGTGCCTCGAR1 GGTGTGAACCCCGACATG191
F2 CCCTGGTGAAATCAGGAGAGAGR2 TGTAGGTCCCTGCAAGGGCAA186
3DL2F1 CAAACCCTTCCTGTCTGCCCR1 GTGCCGACCACCCAGTGA211
F2 CCCATGAACGTAGGCTCCGR2CACACGCAGGGCAGGG130
3DS1F1 AGCCTGCAGGGAACAGAAGR1 GCCTGACTGTGGTGCTCG300
F2 CCTGGTGAAATCAGGAGAGAGR2GTCCCTGCAAGGGCAC180
3DL3F1 GTCAGGACAAGCCCTTCCTCR1 GAGTGTGGGTGTGAACTGCA232
F2 TTCTGCACAGAGAGGGGATCAR2 GAGCCGACAACTCATAGGGTA165
2DL5F1GCGCTGTGGTGCCTCGR1 GACCACTCAATGGGGGAGC214
F2 TGCAGCTCCAGGAGCTCAR2 GGGTCTGACCACTCATAGGGT191
2DP1F1 GTCTGCCTGGCCCAGCTR1 GTGTGAACCCCGACATCTGTAC205
F2 CCATCGGTCCCATGATGGR2 CACTGGGAGCTGACAACTGATG89
2DS1F1 CTTCTCCATCAGTCGCATGAAR1 AGAGGGTCACTGGGAGCTGAC102
F2 CTTCTCCATCAGTCGCATGAG
2DS4F1 CTGGCCCTCCCAGGTCAR1 TCTGTAGGTTCCTGCAAGGACAG204
F2 GTTCAGGCAGGAGAGAATR2 GTTTGACCACTCGTAGGGAGC197/219
3DP1F1 GGTGTGGTAGGAGCCTTAGR1 GAAAACGGTGTTTCGGAATAC280
F2 CGTCACCCTCCCATGATGTA395

[i] KIR, killer cell immunoglobulin-like receptor; F1/F2, forward primers; R1/R2, reverse primers.

Table II

Primers used for HLA-Cw genotyping by PCR-SSP.

Table II

Primers used for HLA-Cw genotyping by PCR-SSP.

Forward primers
Reverse primers
GenePrimerSequencePrimerSequenceSize (bp)
HLA-C1Asn80F GAGGTGCCCGCCCGGCGAR CGCGCAGGTTCCGCAGGC332
HLA-C2Lys80F GAGGTGCCCGCCCGGCGAR CGCGCAGTTTCCGCAGGT332

[i] HLA-Cw, human leukocyte antigen-Cw; Asn, asparagine; Lys, lysine.

KIR genes and the HLA-Cw PCR-SSP classification

Each KIR gene required two pairs of KIR gene primers (upstream and downstream) plus an internal contrast primer system. The HLA-Cw gene also required upstream and downstream primers and an internal contrast primer system.

To amplify KIR genes by PCR-SSP (12), 1 μl of each primer mix (5 μM) was dispensed into separate wells in 384-well plates. Each sample required two vertical rows of wells but KIR2DS1 and KIR3DP1 required only one well. PCR cocktails were prepared for each sample with a total volume of 132 μl (enough for 33 reactions) as follows: 200 ng DNA, 16.5 μl 10X PCR buffer (final concentration, 1X), 4.95 μl MgCl2 (final concentration 1.5mM), 1.32 μl dNTP (final concentration 200 mM) and 0.825 μl Taq polymerase. PCR cocktail (4 μl) was added to each primer mix (total PCR volume = 5 μl). The samples were amplified using a programmable thermal cycler with a heated lid using the following parameters: 3 min at 94°C, 5 cycles of 15 sec at 94°C, 15 sec at 65°C and 30 sec at 72°C; 21 cycles of 15 sec at 94°C, 15 sec at 60°C and 30 sec at 72°C; 4 cycles of 15 sec at 94°C, 1 min at 55°C and 2 min at 72°C with a final 7-min extension step at 72°C.

The HLA-Cw genes were amplified using PCR-SSP genotyping (12). The PCR system was as follows: In each reaction, 100 ng of genomic DNA was amplified in 15 μl of 1X PCR master mix [67 mM Tris-HCl, pH 8.8, 16.6 mM (NH4)2SO4, 0.1% Tween-20, 2 mM MgCl2, 200 mM dNTP] containing specific (0.1–0.8 μm) and control primers, as well as 0.5 units Taq polymerase. PCR conditions were: 2 min at 94°C, 10 cycles of 10 sec at 94°C and 60 sec at 65°C; 20 cycles of 10 sec at 94°C, 50 sec at 61°C and 30 sec at 72°C with a final 10-min extension step at 72°C.

Gel electrophoresis

The amplification products (5 μl) were electrophoresed on 2% agarose gels with a migration distance of ∼3 cm and stained with ethidium bromide. The amplification was evaluated on a UV transilluminator and photographed.

Analysis of the recognition of HLA-Cw and KIR

The difference in the method of recognition between various HLA-Cws and KIRs depended on the 80th amino acid residues of the HLA-Cw. If the residue was lysine (Lys; HLA-Cw2Lys80), the receptor was KIR2DL1/S1. If the residue was asparagine (Asn; HLA-Cw1Asn80), the receptor was KIR2DL2/L3/S2. The amino acid sequence was acquired according to the HLA-Cw classification results. By combining this information with the phenotype of the KIR, separate HLA-Cw and KIR recognition statistics could be analyzed.

Statistical analysis

The statistical analysis followed that of Martin and Carrington (11) and also included the frequency and genotype frequency of HLA-Cw and KIR in the Han population of Jilin. The KIR gene-frequency (F) was measured by direct counting, the phenotype frequency (pf; %) = total number of positive gene/total nu,ber of research group; the KIR gene frequency was calculated as F = 1−√(1−pf).

Results

Electrophoresis of the KIR gene

Electrophoretic analysis following the conventional amplification of the KIR gene revealed that the size of the target fragment was consistent with the expected results (Fig. 1).

Figure 1

KIR genotyping by PCR-SSP. Lanes 1-16, the PCR-SSP products of KIR2DL1, KIR2DL2, KIR2DL3, KIR2DL4, KIR2DL5, KIR3DL1, KIR3DL2, KIR3DL3, KIR2DS2, KIR2DS3, KIR2DS5, KIR3DS1, KIR2DP1, KIR2DS1 and KIR3DP1, respectively; M, Marker 2000; KIR, killer cell immunoglobulin-like receptor.

Electrophoresis of the HLA-Cw gene

Electrophoretic analysis following the conventional amplification of the HLA-Cw gene revealed that the size of the target fragment was consistent with the expected results (Fig. 2).

Figure 2

HLA-Cw genotyping by PCR-SSP. M, Marker 2000; C1, PCR-SSP products of HLA-Cw1Asn; C2, PCR-SSP products of HLA-Cw2Lys; HLA-Cw, human leukocyte antigen-Cw.

Phenotype and genotype frequencies of HLA-Cw and KIR in the Han population in Jilin

The results are shown in Table III.

Table III

Phenotype and genotype frequency of KIR and HLA-Cw in the Jilin Han population.

Table III

Phenotype and genotype frequency of KIR and HLA-Cw in the Jilin Han population.

GeneNumberPhenotype frequency (%)Genotype frequency
2DL115399.3510.919
2DL22113.6360.071
2DL315399.3510.919
2DL41541001
2DL54931.8180.174
3DL114392.8570.733
3DL21541001
3DL31541001
2DS21912.3380.064
2DS31811.6880.06
2DS53724.0260.128
3DS14327.9220.151
2DP115399.3510.919
2DS14831.1690.17
3DP1*0037649.3510.288
3DP1*001/002/00415399.3510.919
2DS4*001/00211373.3770.484
2DS4*003-0077246.7530.27
HLA-C1Asn8012379.870.551
HLA-C2Lys804327.9220.151

[i] KIR, killer cell immunoglobulin-like receptor; HLA-Cw, human leukocyte antigen-Cw; Asn, asparagine; Lys, lysine.

Recognition of HLA-C2Lys and KIR

The HLA-C2Lys expression frequency was 27.92%, while 72.08 and 21.43% of individuals expressed only KIR2DL1 or KIR2DS1, respectively, without HLA-C2Lys. Table IV shows the distribution of the HLA-Cw KIR activating and inhibitory pairing in the Han population of Jilin. The frequency of HLA-C2Lys80+2DL1 was 27.27% and that of 2DS1+HLA-C2Lys80 was 9.74%. Of the studied individuals, 21.43% expressed only KIR2DS1 without HLA-C2Lys-KIR2DL1.

Table IV

The combined frequencies of various compound KIR-HLA genetypes in the Jilin Han population.

Table IV

The combined frequencies of various compound KIR-HLA genetypes in the Jilin Han population.

iKIR+HLAFrequency (%)sKIR+HLAFrequency (%)
HLA-C1Asn80+2DL2/2DL368.83 2DS2+HLA-C1Asn809.74
HLA-C2Lys80+2DL127.27 2DS1+HLA-C2Lys809.74

[i] KIR, killer cell immunoglobulin-like receptor; iKIR, inhibitory KIR; sKir, stimulatory KIR; HLA, human leukocyte antigen; Asn, asparagine; Lys, lysine.

Recognition of HLA-C1Asn KIR

The HLA-C1Asn80 expression frequency was 79.87%, notably higher than the expression frequency of HLA-C2Lys80 which was 27.92%, while 34.42% of individuals expressed only HLA-C1Asn without iKIR or sKIR. Table IV shows the distribution of the HLA-Cw KIR activating and inhibitory pairings in the Han population of Jilin. The frequency of HLA-C1Asn80+2DL2/2DL3 was 68.83% and that of 2DS2+HLA-C1Asn80 was 9.74%. Of the studied individuals, 2.60% expressed only KIR2DS2 without HLA-C1Asn-KIR2DL2/L3.

Discussion

NK cells recognize virus-infected tissue and tumor cells, then modulate the immune response by killing the target cells through cytotoxic effects or secreting cytokines. NK cells constitute the first barrier of the human immune system (13,14). Immature NK cells must be ‘educated’ by the MHC HLA-Class I molecules, in order to become mature NK cells (15). NK cells adjust their functional status precisely through inhibiting or activating receptors on the membrane surface. In the long-term coevolution of the KIR and the HLA, now highly efficient and accurate receptor-ligand system is formed gradually. (16). Previously, in a study of 477 cases of malaria, Hirayasu et al(17) observed that there was a marked correlation between the KIR2DL3 gene and its ligand HLA-C1 in the cerebral malaria patients compared with non-cerebral malaria patients. Further research revealed that the frequency of the combination of the KIR2DL3-HLA-C1 in the malaria high-risk population was maintained at a low level.

Thus, the KIR and HLA combination system is important in regulating NK cell function. Therefore, determining the method of recognition of the HLA-Cw and KIR is particularly important. A total of 154 Han individuals from Jilin were selected. The KIR and HLA-Cw genotyping results revealed that the expression frequency of HLA-C1Asn80 was 79.87%, lower than the 97.5% of a Han population in Guangdong (18) and the 76% of a population in Iran (12). The expression frequency of HLA-C2Lys80 in the Han population of Jilin was 27.92%, which was equal to that of the Guangdong Han population (18) and lower than the frequency in the Iranian population (12). The frequency of HLA-C1Asn80 in the Guangdong Han population was 97.5%, which was significantly higher than that of the Jilin Han population. Compared with other populations, the combination frequency of the KIR receptor and its ligand in the Jilin Han population was essentially the same. The frequency of KIR2DS2+HLA-C1Asn80 in the Han population of Jilin was 9.74%, less than that of the Guangdong Han (14%) and Iranian (21.5%) populations. The Jilin Han HLA-C1Asn80+KIR2DL2/2DL3 frequency was 68.83%, higher than in the Guangdong Han (41.8%) and Iranian (6.5%) populations. These observations may be due to ethnic and regional differences of the HLA and KIR.

In the 154 Han individuals from Jilin, it was also observed that 9.74% of individuals expressed only the combination of 2DS2+HLA-C1Asn80 and 9.74% expressed only the combination of 2DS1+HLA-C2Lys80. For these individuals, due to the inhibitory signal being unable to completely block the activation of signal transduction, their NK cells may attack other tissues, resulting in autoimmune diseases (10). However, this has yet to be confirmed in patients through larger sample and clinical experiments.

Martin et al(9) suggested that the ligands of sKIRs may not be HLA antigens, but bacterial proteins. The authors observed that the KIR2DL1 and KIR2DL2/L3 frequency was high, up to 100%. Therefore the individual expression of HLA-Cw indicates that a corresponding inhibitory ligand receptor is activated. NK cells with sKIR lacking a corresponding HLA-Cw (for example, KIR2DS1 without HLA-Cw2Lys) may be activated by bacterial proteins, resulting in autoimmune diseases. In the current study, 21.43% of individuals were observed to express KIR2DS1 without HLA-Cw2Lys inhibitory receptor ligands. Due to the expression frequency of HLA-Cw1Asn being up to 79.87%, no expression of KIR2DS2 only was observed. However, 2.60% of the population expressed KIR2DS2 but not HLA-Cw1Asn inhibitory receptor ligands. The susceptibility to autoimmune disease of such individuals is worthy of investigation.

Acknowledgements

This study was supported by grants from the National Natural Science Foundation of China (No. 30972610). The authors would like to thank Medjaden Bioscience Limited for assisting in the preparation of this manuscript.

References

1 

Parham P: Immunogenetics of killer cell immunoglobulin-like receptors. Mol Immunol. 42:459–462. 2005. View Article : Google Scholar : PubMed/NCBI

2 

Guethlein LA, Abi-Rached L, Hammond JA and Param P: The expanded cattle KIR genes are orthologous to the conserved single-copy KIR3DX1 gene of primates. Immunogenetics. 59:517–522. 2007. View Article : Google Scholar : PubMed/NCBI

3 

van Bergen J, Thompson A, Retière C, et al: Cutting edge: killer Ig-like receptors mediate ‘missing self’ recognition in vivo. J Immunol. 182:2569–2572. 2009.

4 

Lanier LL: Missing self, NK cells, and The White Album. J Immunol. 174:65652005. View Article : Google Scholar : PubMed/NCBI

5 

Mandelboim O, Reyburn HT, Valés-Goméz M, et al: Protection from lysis by natural killer cells of group 1 and 2 specificity is mediated by residue 80 in human histocompatibility leukocyte antigen C alleles and also occurs with empty major histocompatibility complex molecules. J Exp Med. 184:913–922. 1996. View Article : Google Scholar

6 

Moesta AK, Norman PJ, Yawata M, et al: Synergistic polymorphism at two positions distal to the ligand-binding site makes KIR2DL2 a stronger receptor for HLA-C than KIR2DL3. J Immunol. 180:3969–3979. 2008. View Article : Google Scholar : PubMed/NCBI

7 

Stern M, Ruggeri L, Capanni M, et al: Human leukocyte antigens A23, A24, and A32 but not A25 are ligands for KIR3DL1. Blood. 112:708–710. 2008. View Article : Google Scholar : PubMed/NCBI

8 

Yin Xiaolin: The evolution, expression and function of KIR gene. Immunology. 20:S103–S105. 2004.

9 

Martin MP, Nelson G, Lee JH, et al: Cutting edge: susceptibility to psoriatic arthritis: influence of activating killer Ig-like receptor genes in the absence of specific HLA-Cw alleles. J Immunol. 169:2818–2822. 2002. View Article : Google Scholar : PubMed/NCBI

10 

Yen JH, Moore BE, Nakajima T, et al: Major histocompatibility complex class I-recognizing receptors are disease risk genes in rheumatoid arthritis. J Exp Med. 193:1159–1167. 2001. View Article : Google Scholar : PubMed/NCBI

11 

Martin MP and Carrington M: KIR locus polymorphisms: genotyping and disease association analysis. Methods Mol Biol. 415:49–64. 2008.PubMed/NCBI

12 

Tajik N, Shahsavar F, Nasiri M and Radjabzadeh MF: Compound KIR-HLA genotype analyses in the Iranian population by a novel PCR-SSP assay. Int J Immunogenet. 37:159–168. 2010. View Article : Google Scholar : PubMed/NCBI

13 

Wodnar-Filipowicz A and Kalberer CP: Function of natural killer cells in immune defence against human leukaemia. Swiss Med Wkly. 137(Suppl 155): 25S–30S. 2007.PubMed/NCBI

14 

Cheent K and Khakoo SI: Natural killer cells: integrating diversity with function. Immunology. 126:449–457. 2009. View Article : Google Scholar : PubMed/NCBI

15 

Brodin P, Kärre K and Höglund P: NK cell education: not an on-off switch but a tunable rheostat. Trends Immunol. 30:143–149. 2009. View Article : Google Scholar : PubMed/NCBI

16 

Single RM, Martin MP, Gao X, et al: Global diversity and evidence for coevolution of KIR and HLA. Nat Genet. 39:1114–1119. 2007. View Article : Google Scholar : PubMed/NCBI

17 

Hirayasu K, Ohashi J, Kashiwase K, et al: Significant association of KIR2DL3-HLA-C1 combination with cerebral malaria and implications for co-evolution of KIR and HLA. PLoS Pathog. 8:e10025652012. View Article : Google Scholar : PubMed/NCBI

18 

Yin Xiaolin, Xiao Lulu and Guo Kunyuan: The analysis of HLA-Cw and KIR in 79 Han people of Guangdong. China Immunology. 21:605–607. 2005.

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Han Y, Zhao L, Jiang Z and Ma N: Analysis of the expression of KIR and HLA‑Cw in a Northeast Han population. Exp Ther Med 5: 300-304, 2013.
APA
Han, Y., Zhao, L., Jiang, Z., & Ma, N. (2013). Analysis of the expression of KIR and HLA‑Cw in a Northeast Han population. Experimental and Therapeutic Medicine, 5, 300-304. https://doi.org/10.3892/etm.2012.763
MLA
Han, Y., Zhao, L., Jiang, Z., Ma, N."Analysis of the expression of KIR and HLA‑Cw in a Northeast Han population". Experimental and Therapeutic Medicine 5.1 (2013): 300-304.
Chicago
Han, Y., Zhao, L., Jiang, Z., Ma, N."Analysis of the expression of KIR and HLA‑Cw in a Northeast Han population". Experimental and Therapeutic Medicine 5, no. 1 (2013): 300-304. https://doi.org/10.3892/etm.2012.763
Copy and paste a formatted citation
x
Spandidos Publications style
Han Y, Zhao L, Jiang Z and Ma N: Analysis of the expression of KIR and HLA‑Cw in a Northeast Han population. Exp Ther Med 5: 300-304, 2013.
APA
Han, Y., Zhao, L., Jiang, Z., & Ma, N. (2013). Analysis of the expression of KIR and HLA‑Cw in a Northeast Han population. Experimental and Therapeutic Medicine, 5, 300-304. https://doi.org/10.3892/etm.2012.763
MLA
Han, Y., Zhao, L., Jiang, Z., Ma, N."Analysis of the expression of KIR and HLA‑Cw in a Northeast Han population". Experimental and Therapeutic Medicine 5.1 (2013): 300-304.
Chicago
Han, Y., Zhao, L., Jiang, Z., Ma, N."Analysis of the expression of KIR and HLA‑Cw in a Northeast Han population". Experimental and Therapeutic Medicine 5, no. 1 (2013): 300-304. https://doi.org/10.3892/etm.2012.763
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team