This article is mentioned in:

Introduction

The Gram-negative bacteria Brucella causes Brucellosis, a zoonotic disease that is widely disseminated throughout the world (1). In humans, Brucellosis causes undulant fever, arthritis and myocarditis (2). Brucella spp. are able to survive and multiply inside the placenta and fetus of pregnant mammals, causing abortion during pregnancy (3). The interactions between Brucella and their hosts are extremely complex, as these facultative intracellular parasites are able to adapt to the harsh environment of host cells, which include oxidative damage, nitrosative damage, acidic pH, antimicrobial peptides and nutrient deprivation (4,5). Brucella spp. are able to achieve this by regulating gene expression differently when growing in vitro or in vivo. However, the mechanisms underlying this survival and multiplication within host cells require further characterization.

Brucella spp. have a tropism for cells containing erythritol, such as embryo-trophoblasts found in the placenta (6), and erythritol has a growth-promoting effect on some Brucella strains. Therefore, Brucella spp. are able to colonize and reproduce in embryo trophoblast cells, which can cause placentitis and result in abortion (7). Furthermore, the virulence of Brucella spp. is correlated with erythritol metabolism (8), and the Brucella-encoded catabolic erythritol pathways are required for intracellular survival (9). Erythritol usage relies on the ery operon, which consists of the genes eryA, eryB, eryC and eryD (10). The eryA gene encodes a 519 amino acids (AA) putative erythritol kinase (10). The eryB gene encodes an erythritol phosphate dehydrogenase (10). The eryC gene product has been assigned as a D-erythrulose-1-phosphate dehydrogenase, and the eryD gene encodes a regulator of ery operon expression (10–12). Although ery operon expression is correlated with erythritol metabolism, growth conditions can regulate gene expression (10). To understand ery operon regulation in Brucella melitensis during infection, we examined gene expression at several timepoints following growth in HPT-8 trophoblast cells. The results help to characterize the mechanisms required for Brucella spp. pathogenesis.

Materials and methods

Bacterial strains, plasmids and growth conditions

Table I lists the strains and constructed plasmids used in this study. Brucella abortus 2308 was obtained from the Chinese Center of Disease Prevention and Control (CDC; Beijing, China). B. melitensis 027 strain was isolated from Xinjiang, China, and was identified by the CDC. Brucella strains were cultured in tryptic soy agar (TSA) or tryptic soy broth (TSB; Sigma-Aldrich, St. Louis, MO, USA). Plates were incubated at a temperature of 37°C in an atmosphere enriched with 5% CO2. Escherichia coli strain JM109 (Promega Corporation, Madison, WI, USA) was grown in Luria-Bertani (LB) media. The culture media were supplemented with 50 µg/ml ampicillin (Invitrogen; Thermo Fisher Scientific, Inc., Carlsbad, CA, USA). The plasmid pMD18-T Simple Vector was purchased from Takara Bio, Inc. (Otsu, Japan). The standard curves were constructed using pMD18-T Simple Vector.

Table I. Bacterial strains and plasmids used in this study.

Table I.

Bacterial strains and plasmids used in this study.

Name	Description	Source
Bacteria strain
Brucella abortus 2308	Wild-type, virulent strain	China CDC
Brucella melitensis 027	Biotype 3, virulent strain (China), identified by China CDC	Present study
2308Δery	Δery promoter mutant of strain 2308	Present study
027Δery	Δery promoter mutant of strain 027	Present study
Escherichia coli JM109	endA1, recA1, gyrA96, thi, hsdR17 (rk-, mk+), relA1,
	supE44, Δ(lac-proAB), [F', traD36, proAB, laqIqZΔM15]	Promega
Plasmid
pMD18-T simple vector	Broad-host range vector; Ampr	Takara
pMD18-eryA	pMD18-T containing 87 bp fragment amplified with	Present study
	eryA-RT-S and eryA-RT-A including a fraction of eryA
pMD18-eryB	pMD18-T containing 104 bp fragment amplified with	Present study
	eryB-RT-S and eryB-RT-A including a fraction of eryB
pMD18-eryC	pMD18-T containing 118 bp fragment amplified with	Present study
	eryC-RT-S and eryC-RT-A including a fraction of eryC
pMD18-eryD	pMD18-T containing 120 bp fragment amplified with	Present study
	eryD-RT-S and eryD-RT-A including a fraction of eryD
pMD18-16S rRNA	pMD18-T containing 88 bp fragment amplified with	Present study
	16s-RNA-S and 16s-RNA-A including a fraction of 16S rRNA

Cells

Murine macrophages (RAW 264.7) and human trophoblasts (HPT-8) were used in this study. HPT-8 cells and RAW 264.7 murine macrophage were purchased from the Cell Resource Center, IBMS, CAMS/PUMC (Beijing, China).

Construction of 2308Δery and 027Δery

Deletion of the ery operon in B. abortus 2308 and B. melitensis 027 (2308Δery and 027Δery) was performed as previously described (13).

Growth curve of 2308Δery and 027Δery

To monitor the growth of B. abortus 2308, B. melitensis 027, 2308Δery and 027Δery, cells were cultured in TSB to an optical density at 600 nm (OD600) of 0.6, then diluted with TSB to an OD600 of 0.05 and cultured in rotary shaker (100.62 × g) at 37°C for 48 h. Aliquots of cultures were collected at 4-h intervals, and bacterial growth was measured at OD600.

Erythritol sensitivity of 2308Δery and 027Δery

To detect erythritol sensitivity in 2308Δery and 027Δery, stationary phase pre-cultures of B. abortus 2308, B. melitensis 027, 2308Δery and 027Δery were diluted in TSB containing 20 mM erythritol (Sigma-Aldrich), and grown for 48 h. The bacterial growth was measured at an OD600.

Evaluation of 2308Δery and 027Δery attenuation in RAW 264.7 murine macrophages

RAW 264.7 murine macrophages were used to assess the intracellular survival of B. abortus 2308, B. melitensis 027, 2308Δery and 027Δery. RAW 264.7 cells were infected as previously described (14). Briefly, 5×105 cells/well were cultured in 24-well plates for 16 h at 37°C and infected with Brucella at a multiplicity of infection (MOI) of 100. Culture plates were centrifuged for 5 min at 350 × g at room temperature and placed in an incubator at 37°C with 5% CO2 atmosphere. At 45 min post-infection, the cells were washed twice with media and then incubated with Dulbecco's modified Eagle's medium (DMEM; Gibco; Thermo Fisher Scientific, Inc., Rockville, MD, USA) containing 50 µg/ml gentamicin (Invitrogen; Thermo Fisher Scientific, Inc.) for 1 h to kill extracellular bacteria. The media was then replaced with DMEM containing 25 µg/ml gentamicin (incubation point 0 min). At 4, 12, 24 and 48 h post-infection, the number of colony-forming units (CFU) was obtained by plating serial dilutions of the lysates on TSA plates. All assays were performed in triplicate and repeated at least three times.

HPT-8 cells invasion assay

HPT-8 cells were infected by B. abortus 2308 and B. melitensis 027 in media with or without erythritol (20 mM). HPT-8 cells were grown at 37°C in a 5% CO2 atmosphere in DMEM containing 20% fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc.). Cells were seeded (1×106) in 12-well culture dishes 24 h prior to each infection assay. HPT-8 cells were infected at a MOI of 100 bacteria per cell as previously described (14,15). Culture plates were centrifuged for 5 min at 350 × g at room temperature. Post-infection, cells were grown in the presence of erythritol at a concentration of 1% as a nutritional supplement or at 20 mM for induction of the ery operon and placed in an incubator at 37°C with 5% CO2 atmosphere. Cells were washed three times with phosphate-buffered saline (PBS) and monolayers of cells were further incubated with culture media supplemented with 50 µg/ml gentamicin for 1 h to kill extracellular bacteria. The cells were washed with DMEM containing 10% fetal bovine serum to remove gentamicin, then the cells were lysed with TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.).

RNA isolation and reverse transcription

Total RNA (1 µg) from HPT-8 cells at 0 min (bacterial culture), 20 min, 1 h, 2 h, 3 h, 4 h and 12 h post-infection was isolated (Qiagen RNeasy Mini-kits; Qiagen, Hilden, Germany) and cDNA was generated using random hexamer primers and MMLV-RT according to the manufacturer's recommendations (Gibco; Thermo Fisher Scientific, Inc.). Genomic DNA was removed using a DNase RT kit (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's instructions. The 10 µl reaction mixture system containing 1 µg RNA, 1U DNase, 1 µl DNase buffer and ddH2O was added to 10 µl. The mixture system was mixed and allowed to rest for 10 min at room temperature. A total of 1 µl 25 mM EDTA was added and incubated for 10 min at 65°C. The DNA polymerase was obtained from Invitrogen (Thermo Fisher Scientific, Inc.). cDNA was stored at −80°C and used as a template for reverse transcription-quantitative polymerase chain reaction (RT-qPCR).

Oligonucleotide primers

TaqMan primers for 16S rRNA (housekeeping gene), eryA, eryB, eryC and eryD genes were designed using Primer Express 5.0 software (Applied Biosystems, Palo Alto, CA, USA) according to sequences in GenBank (http://www.ncbi.nlm.nih.gov/genbank/) (Table II).

Table II. Primer sequences used in this study.

Table II.

Primer sequences used in this study.

Primer	Sequence
16S rRNA-RT-sense	GCGGCTCACTGGTCCATTAC
16S rRNA-RT-anti-sense	CGTTTACGGCGTGGACTACC
eryA-RT-sense	CGCACACGCCAGTATGATGA
eryA-RT-anti-sense	CGACCCGTCGATGATTTCAG
eryB-RT-sense	GAGATTGCCAATGCCGATTA
eryB-RT-anti-sense	GCACCATAGAGCCGTCCATA
eryC-RT-sense	GCTTTCGCTCAACACCAATC
eryC-RT-anti-sense	CATGGGTAAGCTGGAGGTCA
eryD-RT-sense	CGTGGAAAACGCCGATATGA
eryD-RT-anti-sense	GTCCGTTCGTCGGTGATGAG

Construction of recombinant plasmids

Ery operon (eryA, eryB, eryC and eryD) and 16S rRNA open reading frames were amplified by PCR with specific primers (see Table II; Premier Biosoft, Palo Alto, CA, USA) from the B. abortus 2308 genome. The amplified DNA fragments and pMD18-T simple vectors were ligated overnight at 16°C using T4 DNA ligase (Takara Bio, Inc.). The ligation reaction was transformed into E. coli JM109, and insert-containing plasmids were identified by restriction analysis or PCR. Positive recombinant plasmids were sequenced to confirm the correct construction.

Transcriptional analysis of ery operon genes by RT-qPCR

The concentration and purity of recombinant plasmids (dilution, ×100) were measured using a Nanodrop 2000 Spectrophotometer (Thermo Fisher Scientific, Inc.) and used to compute target gene copy numbers. A three-step, 45-cycle RT-qPCR method was conducted using a LightCycler® 480 System (Roche Diagnostics, Basel, Switzerland). A linear standard curve was created with the LightCycler® 480 System Software and serial dilutions of recombinant plasmids containing the genes encoding 16S rRNA, eryA, eryB, eryC and eryD. RT-qPCR was conducted with the following reaction conditions: 5 min at 95°C, followed by 45 cycles at 58°C for 30 sec and 72°C for 30 sec. A negative control (no cDNA) and RT control (no reverse transcription) were used in the experiments. All assays were performed in triplicate and repeated at least three times. The expression levels of the target genes were calculated by comparison with cycle threshold (Ct) and determined at 0 min, 20 min, 1 h, 2 h, 3 h, 4 h and 12 h post-infection. 16S rRNA expression was used as a reference value to compare the relative expression levels at the various time points. Target genes were amplified in triplicate using the LightCycler® 480 System, and the data were presented as the mean of each triplicate with standard deviations (SDs). All assays were repeated a minimum of three times.

Statistical analysis

The data were analyzed using Student's t-test and expressed as the mean value ± SD. The differences between groups were analyzed by analysis of variance using SPSS 17.0 software (SPSS, Inc., Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

ery operon was successfully deleted in B. abortus 2308 and B. melitensis 027

The ery operon deletion was confirmed by PCR in the 2308Δery and 027Δery clones (Fig. 1A). Bacteriological analysis and typing of the mutant showed that deletion of the ery gene was stable after passage in culture media (Fig. 1B).

Figure 1. Identification of construction of the 2308Δery and 027Δery. (A) Polymerase chain reaction identification of 2308Δery and 027Δery. Lanes: 1, the strain 2308; 2, the strain 027; 3, 2308Δery mutant strain; 4, 027Δery mutant strain; 5, negative control; M, DNA marker. (B) Genetic stability detection of 2308Δery and 027Δery. Lanes: 1, the strain 2308; 2 and 3, 2308Δery mutant strain; 4, the strain 027; 5 and 6, 027Δery mutant strain; 7, negative control; M, DNA marker.

Growth curve of 2308Δery and 027Δery

To test whether deletion of the ery operon affected the growth of 2308 or 027, we measured the bacterial growth in nutrient-replete (TSB 7.0) media. When cultured in normal TSB media, 2308Δery and 027Δery displayed a similar lag phase and reached the stationary phase at a similar optical density compared with 2308 and 027 (Fig. 2A).

Figure 2. Growth curves of Brucella strains in (A) nutrient-replete (TSB 7.0) media (A) or containing (B) erythritol (20 mM). The OD600 value was measured to determine growth.

Erythritol growth response in 2308Δery and 027Δery

To test whether the 2308Δery and 027Δery strains were sensitive to erythritol when grown in broth containing erythritol (20 mM), we measured the bacterial growth. The results showed that the virulent strains 2308 and 027 grew well in broth containing erythritol; however, the 2308Δery and 027Δery mutants grew at a slower rate (Fig. 2B). These results indicated that 2308Δery and 027Δery do not respond to erythritol, and that the virulent strains 2308 and 027 may utilize erythritol for growth.

2308Δery and 027Δery are attenuated and experience reduced survival in macrophages

To assess whether the ery operon influences virulence, RAW 264.7 macrophages were infected with 2308Δery, 027Δery, 2308 and 027. The surviving bacteria were enumerated, and there was no difference in the number of surviving bacteria 4 h post-infection (Fig. 3; P>0.05). This indicated that deletion of the ery operon does not affect macrophage invasion. However, at 12 h post-infection, there was a 1.50-log decrease (P<0.05) in the number of 2308Δery compared to 2308, and there was a 1.55-log decrease (P<0.05) in the number of 027Δery compared to 027 (Fig. 3). At 24 h post-infection there was a 2.70-log decrease in the number of 2308Δery compared to 2308 (Fig. 3; P<0.01); and there was a 2.70-log decrease in the number of 027Δery compared to 027 (Fig. 3; P<0.01). At 48 h post-infection, there was a 4.10-log decrease in the number of 2308Δery compared to 2308 (Fig. 3; P<0.01); and there was a 4.00-log decrease in the number of 027Δery compared to 027 (Fig. 3; P<0.01). Therefore, 2308Δery and 027Δery mutants had a replication defect in RAW264.7 macrophages.

Figure 3. Survival of bacterial strains 2308Δery, 027Δery, 2308 and 027 in RAW 264.7 macrophages. Monolayers of macrophages were infected with Brucella at 4, 12, 24 and 48 h post-infection, the macrophages were lysed and supernatants were diluted for colony-forming factor enumeration. Significant differences in replication are indicated as follows: Significant differences between 2308Δery and 2308 are indicated by *P<0.05 and **P<0.01. Significant differences between 027Δery and 027 are indicated as follows #P<0.05 and ##P<0.01.

Preparation of standard curves of different genes by RT-qPCR assay

The equations for the linear regression line for the standard curves of different genes generated by RT-qPCR assay and the corresponding R2 value are as follows: 16S rRNA, y=0.238x+11.041, R2=0.986; eryA, y=−0.267x+12.217, R2=0.986; eryB, y=−0.266x+11.081, R2=0.983; eryC, y=−0.216x+10.165, R2=0.977; and eryD, y=−0.297x+11.414, R2=0.995. Based on the slope rates of these regression lines, the levels of amplification efficiency (E=10−a-1) were 72.98% for 16S rRNA, 84.93% for eryA, 84.50% for eryB, 64.44% for eryC, 98.15% for eryD. Melt curve (unpublished) analysis of amplification products indicated that there was a single peak with a Tm of 86.8°C for 16S rRNA, 86.2°C for eryA, 84.6°C for eryB, 90.06°C for eryC and 91.75°C for eryD.

Ery operon gene expression following infection

We analyzed gene expression at 0 min, 20 min, 1 h, 2 h, 3 h, 4 h and 12 h post-infection. The relative expression levels of eryA, eryB, eryC and eryD were significantly higher in Brucella grown with medium containing erythritol. Furthermore, the relative expression levels of eryA, eryB and eryC were highest (P<0.01) at 2 h post-infection (Fig. 4A-C), but were highest (P<0.01) at 3 h post-infection for eryD (P<0.05) (Fig. 4D). Gene expression levels were calculated based on the comparison to the expression of 16S rRNA. Based on these calculations, eryB was the most highly expressed gene followed by eryA, eryC and eryD (Fig. 5).

Figure 4. Relative expression level of eryA (A), eryB (B), eryC (C) and eryD (D) of Brucella abortus 2308 and Brucella melitensis 027 in media with or without erythritol (20 mM) at several time points. Growth of B. abortus 2308 and B. melitensis 027 grown in media without erythritol. In addition, expression in B. abortus 2308+ and B. melitensis 027+ were followed in the presence of erythritol (20 mM). The relative expression of eryA, eryB and eryC peaked at 2 h post-infection in HPT-8 cells, and that eryD expression peaks at 3 h post-infection. Data points represent means of triplicate reactions, and error bars indicate standard deviation. The data set is representative of three independent experiments using the same sample.

Figure 5. Comparison of the relative expression levels of ery operon, including eryA, eryB, eryC and eryD, in Brucella melitensis strain 2308 at different time points. Each value in the figure represents the mean of triplicate experiments ± standard deviation.

Discussion

The majority of Brucella spp. utilize erythritol to promote growth (except B. abortus S19). Metabolism and usage of erythritol are regulated by the 7.7-kb ery operon, which consists of four genes eryA, eryB, eryC and eryD (EryA, 519 AA; EryB, 502 AA; EryC, 309 AA and EryD, 316 AA) (16–18). The functions of these four proteases are similar to xylulose kinase (E. coli xylB), glycerol-3-phosphate dehydrogenase (E. coli glpD), hydrogenase (Alcaligenes hydrogenophilus hupL), operon regulators (Rhodobacter sphaeroides smoC and Klebsiella pneumoniae dalR) (10). In addition, the promoter of the ery operon also includes an integration host factor binding site. This study demonstrates that the expression of the ery operon in HPT-8 cells is higher than in culture medium, and suggests that the B. melitensis 027 ery operon is induced by erythritol within HPT-8 cells. Furthermore, the expression of the eryD gene may repress the expression of the other genes in the operon. This is the first demonstration of the expression and regulation of the ery operon of B. melitensis in human trophoblast cells.

Brucella is detected in non-professional phagocytes 30 min post-infection (19). Therefore, the infection time used in this study was 20 min, at which time Brucella were detectable within host cells. Once entry has been established a brucellosome is formed, a process that lasts 2–3 h. To study the expression of the ery operon during the initial stage of infection, we measured ery operon expression at 20 min, 1 h, 2 h, 3 h and 4 h post-infection in HPT-8 cells. In addition, the expression of the ery operon was measured at 12 h post-infection and was markedly decreased, which may be due to changes in the intracellular environment induced by Brucella. Notably, HPT-8 cells easily detached from the culture flask after infection. In general, longer infection times correlated with higher levels of detachment. In this study, we used expression of the 16S rRNA gene as a reference to eliminate determine genes expression levels at 20 min, 1 h, 2 h, 3 h, 4 h and 12 h post-infection.

Numerous genes from pathogen bacteria, such as Brucella and Mycobacterium tuberculosis, are regulated by environment signals in vitro (20). Mariani et al (17) investigated the expression of 14 genes in Mycobacterium tuberculosis H37Rv in both medium and macrophages. Five of these genes were expressed in media and macrophages, four genes were expressed in media, and the remaining five genes were only expressed in macrophages. In this study, we characterized the expression of the ery operon in media and at different timepoints following infection.

All four genes of the ery operon are essential for optimal Brucella virulence. The function of the genes in the ery operon control erythritol catabolism, which has been postulated to increase virulence in the host environment (21). Cells infected with Brucella were grown in liquid media with or without erythritol at a concentration of 20 mM. During the early phase of infection without erythritol, the expression levels of eryA-C are highest at 2 h post-infection; eryD is highest at 3 h post-infection. Therefore, as eryD expression increased the expression of eryA-C declined (Fig. 4). When erythritol was present in the media, expression was similar to the above-mentioned results. However, the expression levels of eryA-C peaked at 2 h then remained constant, whereas eryD peaked at 3 h and then declined (Fig. 5). Two explanations may account for this phenomenon. First, EryD protein expression may inhibit transcription of the ery operon (7). A second explanation may involve acidification of the brucellosome at 3 h post-infection, as multiplication in the acidified-brucellosome may represent a starvation condition due to decreased ery operon expression induced by erythritol.

Trophoblastic cells contain high levels of erythritols and are targeted for infection by Brucella. It has been previously reported that Brucella preferentially utilizes the carbon source erythritol. This study demonstrates that the expression of the ery operon is significantly lower in media compared with trophoplastic cells.

Therefore, the present results indicate that the expression of the ery operon of B. melitensis 027 differs when grown in media or HPT-8 cells, and that this expression is regulated by environmental signals. Specifically, the ery operon is induced by erythritol after entry into HPT-8 cells. However, a number of questions remain to be answered before we can understand the role of the Ery system in Brucella virulence.

Acknowledgements

The present study was supported by grants from the International Science and Technology Cooperation Project of China (grant nos. 2013BC005 and 2015DFR31110), the Outstanding Youth Project of Shihezi University (grant no. 2012ZRKXJQ02), the National Natural Science Foundation of China (grant nos. 31460650 and 31260596), and the University Key Research Project of Henan Province (grant no. 16A230013).

References