Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
May-2017 Volume 13 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2017 Volume 13 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

A pilot study: Screening target miRNAs in tissue of nonsyndromic cleft lip with or without cleft palate

  • Authors:
    • Shan Wang
    • Changsheng Sun
    • Yan Meng
    • Bing Zhang
    • Xin Wang
    • Yanguo Su
    • Lei Shi
    • Eryang Zhao
  • View Affiliations / Copyright

    Affiliations: Department of Oral Pathology, The First Affiliated Hospital, Harbin Medical University, Harbin, Heilongjiang 150001, P.R. China, Department of Oral and Maxillofacial Surgery, The First Affiliated Hospital, Harbin Medical University, Harbin, Heilongjiang 150001, P.R. China
  • Pages: 2570-2576
    |
    Published online on: March 21, 2017
       https://doi.org/10.3892/etm.2017.4248
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Nonsyndromic cleft lip with or without cleft palate (NSCLP) has been recognized as a condition resulting from a combination of environmental and genetic factors. Studies have demonstrated that microRNAs (miRNAs) are involved in embryonic development. However, few studies have focused on screening potential target miRNAs in human NSCLP tissue. Using microarray-based miRNA expression profiling, miRNA expression was compared in tissue samples from 4 NSCLP patients and 4 healthy control subjects. Two hundred and fifty‑four miRNAs were found to be differentially expressed. Changes in Homo sapiens (hsa)-miR-24-3p, hsa‑miR‑27b‑3p, hsa‑miR‑205‑5p, hsa‑miR‑1260b and hsa‑miR‑720 were of particular interest with respect to Wnt signaling (fold‑changes were 12.5, 12.2, 12.1, 12.3 and 10.5, respectively; P<0.005 for all). The levels of hsa-miR-24-3p, hsa‑miR‑1260b and hsa‑miR‑205‑5p were higher in tissues from NSCLP patients than in those from controls according to PCR analysis. Hsa‑miR‑24‑3p, hsa‑miR‑1260b and hsa‑miR‑205‑5p may be candidate miRNAs involved in the etiology of NSCLP via Wnt signaling.

Introduction

Nonsyndromic cleft lip with or without cleft palate (NSCLP) is one of the most common human craniofacial malformations. The incidence is 1.82/1,000 live births in China, and the worldwide overall incidence of oral clefts is estimated to be 1.43/1,000, with a wide variability among ethnic groups and regions (1). NSCLP is a complex disorder that does not follow normal Mendelian patterns of inheritance; rather, NSCLP exhibits etiological heterogeneity wherein genetic and environmental factors may predispose patients to orofacial clefts (2–4). In addition, gene-gene and/or gene-environment interactions may contribute to clefting (5–7). The etiopathogenesis of clefts has been widely studied but remains poorly understood.

Mature microRNAs (miRNAs), which are small, naturally occurring non-coding RNAs, inhibit messenger RNA and act as negative regulators of gene expression. miRNAs are crucial for the proper spatiotemporal development of various tissues and organs (8–11). The roles of miRNAs in cellular proliferation and differentiation as well as embryonic development are gradually becoming clear (12). In addition, there is evidence that miRNAs may be required for craniofacial development (13), and Eberhart et al (14) demonstrated that the microRNA Mirn140 negatively regulates platelet-derived growth factor (PDGF) signaling during palatal development, and provided a mechanism for how the disruption of PDGF signaling causes palatal clefting in zebrafish.

Despite the acknowledged function of miRNAs in development and their importance in disease, as well as the fact that miRNAs are a unique means of modulating signaling pathways such as Wnt and transforming growth factor-β (15–18), little is known with regard to the involvement of miRNAs in regulating NSCLP. Research on the above issue is still in the early stages, at which the problem of selecting appropriate samples and screening miRNAs in human tissues require to be solved. It represents a novel approach to elucidating the pathogenesis of NSCLP with regard to miRNAs. Certain general principles require establishment as follows: i) Tissue was selected over blood, as tissue provides RNA of higher quality and quantity. This is likely to reduce the stress and potential side effects associated with invasive sample collection and thus, greatly facilitate participant recruitment for the study. ii) Umbilical samples were used as control tissue. NSCLP is a congenital deformity caused by abnormal facial development during gestation and forms in embryos at 6–8 gestational weeks (19). The umbilical cord develops from and contains remnants of the yolk sac and allantois (and is therefore derived from the zygote), which is involved in the whole embryonic process. Healthy umbilical cords were used in the present study. This not only takes into consideration the fact that NSCLP tissues collected were more than one year apart from the timing when clefts were forming in utero, but also allows the miRNA to be synchronized with spatiotemporal characteristics in development. iii) Patients aged 3–24 months were selected as these patients can endure plastic surgery according to Chinese standards (20).

The expression of 1,800 unique human miRNAs was profiled in four NSCLP and 4 normal umbilical cord samples using locked nucleic acid-based oligonucleotide microarrays and several miRNAs that may be associated with the Wnt signal pathway were screened.

Materials and methods

Specimen collection

The NSCLP samples used in the present study were obtained from four patients with NSCLP from the Department of Oral and Maxillofacial Surgery (Hospital of Stomatology, the First Affiliated Hospital, Harbin Medical University, Harbin, China) and were tissues that were not re-used in plastic surgery. The 4 umbilical cord tissues (used as the control) were obtained from the Department of Obstetrics and Gynecology at the First Affiliated Hospital of Harbin Medical University from July 2012 to August 2012. Control umbilical cord tissues were donated by healthy gravidae without systemic disease, clefts or family history thereof. The samples were flash-frozen in liquid nitrogen and stored at −80°C until RNA extraction. Of these samples, 8 were used for miRNA microarray analysis and 8 were used for reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis. The NSCLP cases were classified as bilateral NSCLP, unilateral NSCLP, right unilateral NSCLP and left unilateral NSCLP. The clinical data of the patients are shown in Table I. Written consent for tissue donation (for research purposes) was obtained from the patients or their parents prior to tissue collection and the protocol was approved by the Institutional Review Board of the First Affiliated Hospital of Harbin Medical University (Harbin, China).

Table I.

Clinical background of the 4 Han Chinese NSCLP patients.

Table I.

Clinical background of the 4 Han Chinese NSCLP patients.

GenderAge (months)ClassificationTissue type
Female  3Right unilateral NSCLPLip mucosa
Male  3Left unilateral NSCLPLip mucosa
Female24Bilateral NSCLPPalatine mucosa
Male18Left unilateral NSCLPPalatine mucosa

[i] NSCLP, nonsyndromic cleft lip with or without cleft palate.

miRNA microarray

The 7th generation miRCURY™ LNA Array (v.18.0; Exiqon, Inc, Woburn, MA, USA) contains 3,100 capture probes, covering all the human miRNAs annotated in miRBase 18.0 as well as all viral miRNAs associated with these. In addition, this array contains capture probes for 25 miRPlus™ human miRNAs.

RNA extraction

Total RNA was isolated using TRIzol (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and the miRNeasy Mini kit (Qiagen, Hilden, Germany) according to the manufacturers' instructions, efficiently recovering all RNA species including miRNA. RNA quality and quantity was measured using a NanoDrop spectrophotometer (ND-1000; Thermo Fisher Scientific, Inc.) and RNA integrity was determined by gel electrophoresis.

RNA labeling

After RNA isolation from the samples, the miRCURY™ Hy3™/Hy5™ Power labeling kit (Exiqon, Inc.) was used according to the manufacturer's instructions for miRNA labeling. One microgram of each sample was 3′-end-labeled with the Hy3™ fluorescent label, using T4 RNA ligase and the following procedure: RNA in 2.0 µl water was combined with 1.0 µl CIP buffer and CIP (Exiqon). The mixture was incubated for 30 min at 37°C and the reaction was terminated by incubating at 95°C for 5 min. Subsequently, 3.0 µl labeling buffer, 1.5 µl fluorescent label (Hy3™), 2.0 µl dimethyl sulfoxide and 2.0 µl labeling enzyme were added to the mixture. The labeling reaction was then incubated for 1 h at 16°C and terminated by incubating at 65°C for 15 min.

Array hybridization

After stopping the labeling procedure, the Hy3™-labeled samples were hybridized to the miRCURY™ LNA Array (v.18.0; Exiqon, Inc.) according to the instructions from the array manual. The total 25-µl mixture containing the Hy3™-labeled samples was added to 25 µl hybridization buffer, denatured for 2 min at 95°C and then incubated on ice for 2 min. Subsequently, the mixture was hybridized to the microarray for 16–20 h at 56°C in a 12-Bay Hybridization System (Nimblegen Systems Inc., Madison, WI, USA), which provided an active mixing action and constant incubation temperature to improve hybridization uniformity and enhance the signal. Following hybridization, the slides were washed several times using a Wash Buffer kit (Exiqon, Inc.) and dried by centrifugation for 5 min at 127.44 × g. The slides were then scanned using an Axon GenePix 4000B microarray scanner (Axon; Molecular Devices, LLC, Sunnyvale, CA, USA).

miRNA target prediction

MicroCosm Targets Version5 (http://www.ebi.ac.uk/enright-srv/microcosm/htdocs/targets/v5/), formerly miRBase Targets, Miranda (http://www.microrna.org/microrna/home.do), which contains the target information for the hg19, mm9 and RN34 miRNAs, and TargetScan version 6.2 (http://www.targetscan.org/vert_60/), which provides information about human and mouse miRNA, were used to analyze potential target genes for the deregulated miRNAs.

RT-qPCR

To confirm the results obtained by miRNA profiling, the expression of selected miRNAs was measured using RT-qPCR according to standard protocols on an Applied Biosystems 7700 HT Sequence Detection System (Thermo Fisher Scientific, Inc.). In brief, complementary (c)DNA was synthesized from total RNA using gene-specific primers (Table II). Reverse transcriptase reactions contained 800 ng RNA, 1 µmol/l stem-loop RT primer, 10X RT buffer, 2.5 mmol/l of each of the dNTPs, 200 U/µl MultiScribe reverse transcriptase and 40 U/µl RNase inhibitor. The 20-µl reactions were incubated for 30 min at 16°C, 40 min at 42°C, and 5 min at 85°C and then were held at 4°C. The 10-µl PCR reaction mixture included 2 µl RT product, 2 µl 2X SYBR Green PCR master mix (Thermo Fisher Scientific, Inc.) and 1 µl primers (Table II). Reactions were incubated in a 384-well optical plate at 95°C for 10 min, followed by 40 cycles of 95°C for 10 sec and 60°C for 1 min. U6 small nuclear RNA was used as an internal control to normalize RNA input. The fold-change was calculated using the 2−ΔΔCq method (21), where Cq is defined as the fractional cycle number at which the fluorescence passes the fixed threshold, and presented as the fold-expression change in NSCLP tissues relative to their corresponding normal tissues after normalization to the endogenous control. All experiments were performed in triplicate.

Table II.

Oligonucleotide primers used in the present study.

Table II.

Oligonucleotide primers used in the present study.

Primer set name Reverse-transcriptase reaction primer (5′-3′)PCR primer (5′-3′)
U6 CGCTTCACGAATTTGCGTGTCATF: GCTTCGGCAGCACATATACTAAAAT
R: CGCTTCACGAATTTGCGTGTCAT
hsa-miR-1260b GTCGTATCCAGTGCGTGTCGTGGAGTCGSP: GGAATCCCACCACTGC
GGCAATTGCACTGGATACGACATGGTGR: TGCGTGTCGTGGAGTC
hsa-miR-24-3p GTCGTATCCAGTGCGTGTCGTGGAGTCGSP: GGGTGGCTCAGTTCAGC
GGCAATTGCACTGGATACGACCTGTTCR: CAGTGCGTGTCGTGGAG
hsa-miR-27b-3p GTCGTATCCAGTGCGTGTCGTGGAGTCGSP: GGGGGTTCACAGTGGCTAAG
GGCAATTGCACTGGATACGACGCAGAAR: GTGCGTGTCGTGGAGTCG
hsa-miR-205-5p GTCGTATCCAGTGCGTGTCGTGGAGTCGGSP: CGTCCTTCATTCCACCG
GCAATTGCACTGGATACGACCAGACTR: CAGTGCGTGTCGTGGAGT

[i] F, forward; R, reverse; GSP, gene-specific primer; PCR, polymerase chain reaction; miR, microRNA; hsa, Homo sapiens.

Data analysis

Scanned images were imported into the GenePix Pro 6.0 software (Axon; Molecular Devices, LLC) for grid alignment and data extraction. Replicated miRNAs were averaged, and miRNAs with intensities ≥30 in all samples were chosen for use in calculating the normalization factor. Median normalization was used to normalize the expression data. After normalization, miRNAs with significant differences in expression were identified using volcano plot filtering. Hierarchical clustering was performed using MEV software (v4.6, TIGR; The J. Craig Venter Institute, La Jolla, CA, USA).

Group data are expressed as the mean ± standard error of the mean. Statistical comparisons (performed using analysis of variance followed by Dunnett's post hoc test) were performed using Microsoft Excel 2007 (Microsoft Corp., Redmond, WA, USA). A two-tailed P<0.05 was considered to indicate a statistically significant difference.

Results

RNA quantity and quality

The quantity and quality of the RNA samples in each group were checked by denaturing agarose gel electrophoresis and absorbance at 260 nm (A260)/280 and A260/230 ratios (Fig. 1). The A260/280 ratio, A260/230 ratio and gel electrophoresis results confirmed that the quality of the RNA isolated was good.

Figure 1.

Determination of RNA integrity and genomic DNA contamination by denaturing agarose gel electrophoresis. Lanes: 1, total RNA from NSCLP sample 1; 2, total RNA from NSCLP sample 2; 3, total RNA from NSCLP sample 3; 4, total RNA from NSCLP sample 4; 5, total RNA from control sample 1; 6, total RNA from control sample 2; 7, total RNA from control sample 3; 8, total RNA from control sample 4. NSCLP, nonsyndromic cleft lip with or without cleft palate.

Differential expression of miRNAs in NSCLP and control tissues

After normalization of the raw data, 254 miRNAs were found to be differentially expressed. Compared to the control, 181 miRNAs were found to be upregulated and 73 downregulated in the NCLP samples. Of these, based on fold-changes and P-values, 10 miRNAs were selected for further analysis, including 7 miRNAs that were upregulated (hsa-miR-24-3p, hsa-miR-27b-3p, hsa-miR-720, hsa-miR-205-5p, hsa-miR-1260b, hsa-miR-3676-5p and hsa-miR-5701) and 3 miRNAs that were downregulated (hsa-miR-564, hsa-miR-4799-3p and hsa-miR-4703-3p) (Table III).

Table III.

miRNAs selected for bioinformatics analysis.

Table III.

miRNAs selected for bioinformatics analysis.

NameFold-change (exp vs. con)P-value (exp vs. con)
hsa-miR-24-3p12.545690.02068
hsa-miR-27b-3p12.245500.040829
hsa-miR-72010.490210.000145
hsa-miR-205-5p12.087840.010106
hsa-miR-1260b12.254860.011225
hsa-miR-3676-5p15.983450.006023
hsa-miR-570123.224850.049594
hsa-miR-5640.0988980.036984
hsa-miR-4799-3p0.0995800.002004
Down 3
  hsa-miR-4703-3p0.0804860.003453

[i] exp, experimental; con, control; miR, microRNA; hsa, Homo sapiens.

miRNA target prediction and RT-qPCR validation of microarray results

MicroCosm, Miranda and TargetScan were used to identify potential target genes for the dysregulated miRNAs. The results revealed that hsa-miR-1260b, hsa-miR-205-5p, hsa-miR-24-3p, hsa-miR-27b-3p and hsa-miR720 may be associated with Wnt signaling genes, including WNT10B, WNT5A, WNT5B, WNT10A, WNT9B, WNT4, WNT8B, WNT2B, WNT3A, WNT3 (NSF), AXIN2, glycogen synthase kinase 3β (GSK3B), golgi SNAP receptor complex member 2, secreted frizzled related protein 1 (SFRP1), dickkopf WNT signaling pathway inhibitor 2 (DKK2), low-density lipoprotein receptor-related protein (LRP)5, LRP6 and Frizzled class receptor 7 (Table IV). The dysregulation of hsa-miR-1260b, hsa-miR-205-5p, hsa-miR-24-3p and hsa-miR-27b-3p, for which predicted target information was supported by information from at least two or more databases, was confirmed by RT-qPCR. The results of the RT-qPCR analysis were consistent with the microarray data for three of the four miRNAs examined and showed that, although expression of hsa-miR-27b-3p was not significantly different between NSCLP and control (P=0.09), hsa-miR-1260b (P=0.001), hsa-miR-205-5p (P=0.001) and hsa-miR-24-3p (P=0.003) were significantly upregulated in NSCLP tissues (Fig. 2).

Figure 2.

Confirmation of miRNA expression by PCR. PCR analysis confirmed the microarray results for three of the four miRNAs: hsa-miR-1260b, hsa-miR-205-5p and hsa-miR-24-3p were upregulated in NSCLP tissues; the difference in hsa-miR-27b-3p expression between NSCLP and control tissues was not statistically significant. The experiment was performed in triplicate. **P<0.01 vs. NSCLP. PCR, polymerase chain reaction; hsa, Homo sapiens; miR, microRNA; NSCLP, nonsyndromic cleft lip with or without cleft palate; Cq, fractional cycle number at which the fluorescence passes the fixed threshold.

Table IV.

Wnts associated with upregulated miRNAs.

Table IV.

Wnts associated with upregulated miRNAs.

miRNAGene symbolMirandaMicroCosmTargetScanNum statistics
hsa-miR-1260bWNT10B1012
hsa-miR-1260bWNT5A1001
hsa-miR-1260bWNT5B1001
hsa-miR-205-5pWNT10A1001
hsa-miR-205-5pWNT5A1102
hsa-miR-205-5pWNT5B0101
hsa-miR-205-5pWNT9B0101
hsa-miR-205-5pWNT3 (NSF)1012
hsa-miR-205-5pAXIN21012
hsa-miR-205-5pSMAD41012
hsa-miR-24-3pWNT40011
hsa-miR-24-3pWNT8B1102
hsa-miR-24-3pGSK3B1012
hsa-miR-27b-3pWNT2B1001
hsa-miR-27b-3pWNT3A0112
hsa-miR-27b-3pGOSR21012
hsa-miR-27b-3pSFRP11012
hsa-miR-27b-3pDKK21012
hsa-miR-27b-3pLRP51102
hsa-miR-27b-3pLRP61012
hsa-miR-27b-3pFZD71012
hsa-miR720WNT5B1001

[i] Classification: 0, potential target gene did not exist; 1, potential target gene existed in the database; 2, potential target gene existed in two databases. miR, microRNA; hsa, Homo sapiens; GSK3B, glycogen synthase kinase 3β; GOSR2, golgi SNAP receptor complex member 2; SFRP1, secreted frizzled related protein 1; DKK2, dickkopf WNT signaling pathway inhibitor 2; LRP5, low-density lipoprotein receptor-related protein 5; FZD7, frizzled class receptor 7.

Discussion

The present study detected 254 miRNAs that were differentially expressed in NSCLP tissues as compared to those in normal umbilical cord tissues. The NSCLP miRNA signature revealed an altered biological phenotype that is similar to the miRNA profiles of various growth-associated diseases: It was characterized by significant upregulation of miRNAs (181/254). Based on fold-change and P-values, 10 of these miRNAs, including 8 hsa-miRNAs that were upregulated and 2 hsa-miRNAs that were downregulated, were selected for further analysis. Of note, hsa-miR-27b-3p, hsa-miR-720, hsa-miR-1260b, hsa-miR-24-3p and hsa-miR-205-5p were found to be highly expressed in tissues from NSCLP patients. Furthermore, bioinformatics analysis showed that various Wnt genes such as WNT2B and WNT10B were associated with these hsa-miRNAs that we screened. Accordingly, various miRNAs in control and NSCLP tissues were identified by RT-qPCR, including hsa-miR-720, hsa-miR-1260b, hsa-miR-24-3p and hsa-miR-205-5p.

A growing body of evidence showed that the Wnt family of genes and their associated signaling pathways have critical roles in various processes of growth and development, including embryonic induction, epithelial and mesenchymal cellular polarity, cell fate determination, cytoskeletal organization and cell proliferation (22–24). Wnt expression is observed in the upper lip and primary and secondary palates, and Wnts are involved in regional specification of the vertebrate face.

WNT4, targeted by hsa-miR-24-3p (25), is a member of the canonical Wnt signaling pathway and is extensively expressed in palatal epithelium. He et al (26) found that WNT4 is expressed in the palatal epithelium in the anterior as well as posterior palate in a microarray survey of gene expression profile in E13.5 mouse palatal shelves. Yu et al (27) demonstrated miR-205 suppresses the expression of GSK-3β, the protein encoded by GSK3B, through binding to its 3′-untranslated region. It has been shown that GSK-3β is a direct target of miR-205 in 3T3-L1 cells and suppression of the expression of GSK-3β by miR-205 led to activation of the Wnt pathway. GSK3B is part of the Wnt signaling pathway and has a major role in epithelial cell homeostasis (28). A role for GSK3B in craniofacial defects has also been demonstrated, since homozygous null mice display incomplete fusion of the ribs at the midline and bifid sternum, delayed sternal ossification and cleft palate (29).

However, no direct evidence has illustrated how miR-1260b regulates Wnt genes and affects lip fusion and palatal fusion. Hirata et al (30) found that miRNA-1260b can silence SFRP1, DKK2 and SMAD4 genes, which affects cancer cell proliferation and invasion as well as the percentage of apoptotic cells. Iwata et al (31) revealed that Smad4 can synergistically regulate the fate of the medial edge epithelium during palatal fusion in mice. Accordingly, it was speculated that miRNA-1260b may also regulate other genes associated with orofacial clefts.

In fact, individuals born with a cleft have a higher mortality rates at all stages of life (32). Individuals with a cleft as well as their family members also have a higher risk of developing various cancer types. Andrade Filho et al (33) found that GSK-3β and Axin2 belong to the Wnt pathway and increase susceptibility to oral squamous cell carcinoma and colon cancer, respectively. The present study showed that hsa-miR-205-5p and hsa-miR-24-3p regulates the levels of GSK-3β and Axin2. Axin2 is a negative regulator of Wnt-β-catenin, which has a critical and evolutionarily conserved role in directing cell fate during craniofacial morphogenesis, and Axin2 mRNA is expressed throughout palatogenesis stages (34).

As Wnt-regulating miRNAs were found to be associated with NSCLP in the present study for the first time, they hold potential value for further research on the association of miRNAs with NSCLP. Wnt5A deficiency has been found to lead to a complete cleft of the secondary palate, which exhibits distinct phenotypic alterations at the histological, cellular and molecular level in the anterior as well as posterior regions (35). Alterations in Wnt5A function may perturb formation and/or fusion of the facial processes and predispose to NSCLP (36). WNT9B may also be involved in the clefting phenotype and is therefore an excellent candidate gene for NSCLP. Wnt9b can activate the Wnt/β-catenin response in first branchial arch mesenchyme. When A/WySn mice were bred with WNT9B−/− mice, there was a higher prevalence of clefting in the progeny (67%) than in the founders (37). WNT10A and WNT10B have not previously been identified as being associated with NSCLP. However, Lin et al (38) showed that WNT10a and WNT10b transcripts in palatal epithelium were involved in the formation of palatal rugae, with Wnt10a being more strongly expressed in the rugae. Although it has not yet been determined whether WNT8B and WNT5B are directly involved in NSCLP, Kawakami et al (39) found that limb bud formation was initiated by Wnt molecules (Wnt2b and Wnt8), which are expressed in the lateral plate mesoderm and which signal through β-catenin to restrict fibroblast growth factor 10 expression in the presumptive limb mesoderm. Kim et al (40) also showed that Wnt8b can suppress Frizzled 8a expression in the anterior neuroectoderm and potentially affect the level and/or range of Wnt signaling.

In the present study, hsa-miR-27b-3p was also identified by microarray analysis as being upregulated in NSCLP, although the RT-qPCR results indicated that the difference between NSCLP and control tissues was not significant (P=0.09). However, its involvement in NSCLP cannot be ruled out until more samples are collected and tested.

It should be noted that the present study only revealed a disparity in the expression of miRNAs, which may be associated with the Wnt family of genes and the associated signaling pathways, between 4 NSCLP tissue samples and 4 normal umbilical cord samples. One of the limitations of the present study is the relatively modest number of NSCLP cases examined, which may explain certain results. It remains to be determined whether the miRNAs identified in the present study actually perturb the Wnt signaling pathway, even though bioinformatics support this hypothesis. In the future, a larger number of samples should be collected and tested in a follow-up study to elucidate the various factors that contribute to NSCLP.

Acknowledgements

This study was supported by grants from the Li Ka Shing Foundation.

Glossary

Abbreviations

Abbreviations:

NSCLP

nonsyndromic cleft lip with or without cleft palate

miRNAs

microRNAs

References

1 

Meng T, Shi B, Zheng Q, Wang Y and Li S: Clinical and epidemiologic studies of nonsyndromic cleft lip and palate in china: Analysis of 4268 cases. Ann Plast Surg. 57:264–269. 2006. View Article : Google Scholar : PubMed/NCBI

2 

Maestri NE, Beaty TH, Hetmanski J, Smith EA, McIntosh I, Wyszynski DF, Liang KY, Duffy DL and VanderKolk C: Application of transmission disequilibrium tests to nonsyndromic oral clefts: Including candidate genes and environmental exposures in the models. Am J Med Genet. 73:337–344. 1997. View Article : Google Scholar : PubMed/NCBI

3 

Schliekelman P and Slatkin M: Multiplex relative risk and estimation of the number of loci underlying an inherited disease. Am J Hum Genet. 71:1369–1385. 2002. View Article : Google Scholar : PubMed/NCBI

4 

Wyszynski DF, Duffy DL and Beaty TH: Maternal cigarette smoking and oral clefts: A meta-analysis. Cleft Palate Craniofac J. 34:206–210. 1997. View Article : Google Scholar : PubMed/NCBI

5 

Lidral AC and Moreno LM: Progress toward discerning the genetics of cleft lip. Curr Opin Pediatr. 17:731–739. 2005. View Article : Google Scholar : PubMed/NCBI

6 

Lidral AC and Murray JC: Genetic approaches to identify disease genes for birth defects with cleft lip/palate as a model. Birth Defects Res A Clin Mol Teratol. 70:893–901. 2004. View Article : Google Scholar : PubMed/NCBI

7 

Shi M, Wehby GL and Murray JC: Review on genetic variants and maternal smoking in the etiology of oral clefts and other birth defects. Birth Defects Res C Embryo Today. 84:16–29. 2008. View Article : Google Scholar : PubMed/NCBI

8 

Bernstein E, Kim SY, Carmell MA, Murchison EP, Alcorn H, Li MZ, Mills AA, Elledge SJ, Anderson KV and Hannon GJ: Dicer is essential for mouse development. Nat Genet. 35:215–217. 2003. View Article : Google Scholar : PubMed/NCBI

9 

Chen JF, Murchison EP, Tang R, Callis TE, Tatsuguchi M, Deng Z, Rojas M, Hammond SM, Schneider MD, Selzman CH, et al: Targeted deletion of Dicer in the heart leads to dilated cardiomyopathy and heart failure. Proc Natl Acad Sci USA. 105:2111–2116. 2008. View Article : Google Scholar : PubMed/NCBI

10 

Murchison EP, Stein P, Xuan Z, Pan H, Zhang MQ, Schultz RM and Hannon GJ: Critical roles for Dicer in the female germline. Genes Dev. 21:682–693. 2007. View Article : Google Scholar : PubMed/NCBI

11 

Shalgi R, Brosh R, Oren M, Pilpel Y and Rotter V: Coupling transcriptional and post-transcriptional miRNA regulation in the control of cell fate. Aging (Albany NY). 1:762–770. 2009. View Article : Google Scholar : PubMed/NCBI

12 

Alvarez-Garcia I and Miska EA: MicroRNA functions in animal development and human disease. Development. 132:4653–4662. 2005. View Article : Google Scholar : PubMed/NCBI

13 

Wienholds E, Koudijs MJ, van Eeden FJ, Cuppen E and Plasterk RH: The microRNA-producing enzyme Dicer1 is essential for zebrafish development. Nat Genet. 35:217–218. 2003. View Article : Google Scholar : PubMed/NCBI

14 

Eberhart JK, He X, Swartz ME, Yan YL, Song H, Boling TC, Kunerth AK, Walker MB, Kimmel CB and Postlethwait JH: MicroRNA Mirn140 modulates Pdgf signaling during palatogenesis. Nat Genet. 40:290–298. 2008. View Article : Google Scholar : PubMed/NCBI

15 

Hornstein E and Shomron N: Canalization of development by microRNAs. Nat Genet. 38 Suppl:S20–S24. 2006. View Article : Google Scholar : PubMed/NCBI

16 

Lee CT, Risom T and Strauss WM: MicroRNAs in mammalian development. Birth Defects Res C Embryo Today. 78:129–139. 2006. View Article : Google Scholar : PubMed/NCBI

17 

Shalgi R, Lieber D, Oren M and Pilpel Y: Global and local architecture of the mammalian microRNA-transcription factor regulatory network. PLoS Comput Biol. 3:e1312007. View Article : Google Scholar : PubMed/NCBI

18 

Song L and Tuan RS: MicroRNAs and cell differentiation in mammalian development. Birth Defects Res C Embryo Today. 78:140–149. 2006. View Article : Google Scholar : PubMed/NCBI

19 

Qiu WL: Oral and maxillofacial surgeryCongenital cleft lip, facial cleft and palate cleft. 4th edition. Beijing People's Medical Publishing House Press; Beijing: pp. 3692000

20 

Qiu WL: Oral and maxillofacial surgeryCongenital cleft lip, facial cleft and palate cleft. 4th edition. Beijing People's Medical Publishing House Press; Beijing: pp. 374–398. 2000

21 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

22 

Cadigan KM and Nusse R: Wnt signaling: A common theme in animal development. Genes Dev. 11:3286–3305. 1997. View Article : Google Scholar : PubMed/NCBI

23 

Bejsovec A: Wnt pathway activation: New relations and locations. Cell. 120:11–14. 2005. View Article : Google Scholar : PubMed/NCBI

24 

Dale RM, Sisson BE and Topczewski J: The emerging role of Wnt/PCP signaling in organ formation. Zebrafish. 6:9–14. 2009. View Article : Google Scholar : PubMed/NCBI

25 

Chhabra R, Dubey R and Saini N: Cooperative and individualistic functions of the microRNAs in the miR-23a~27a~24-2 cluster and its implication inhuman diseases. Mol Cancer. 9:2322010. View Article : Google Scholar : PubMed/NCBI

26 

He F, Xiong W, Wang Y, Li L, Liu C, Yamagami T, Taketo MM, Zhou C and Chen Y: Epithelial Wnt/β-catenin signaling regulates palatal shelf fusion through regulation of Tgfβ3 expression. Dev Biol. 350:511–519. 2011. View Article : Google Scholar : PubMed/NCBI

27 

Yu J, Chen Y, Qin L, Cheng L, Ren G, Cong P, Mo D and He Z: Effect of miR-205 on 3T3-L1 preadipocyte differentiation through targeting to glycogen synthase kinase 3 beta. Biotechnol Lett. 36:1233–1243. 2014. View Article : Google Scholar : PubMed/NCBI

28 

Kim M, Datta A, Brakeman P, Yu W and Mostov KE: Polarity proteins PAR6 and aPKC regulate cell death through GSK-3beta in 3D epithelial morphogenesis. J Cell Sci. 120:2309–2317. 2007. View Article : Google Scholar : PubMed/NCBI

29 

Liu KJ, Arron JR, Stankunas K, Crabtree GR and Longaker MT: Chemical rescue of cleft palate and midline defects in conditional GSK-3beta mice. Nature. 446:79–82. 2007. View Article : Google Scholar : PubMed/NCBI

30 

Hirata H, Ueno K, Nakajima K, Tabatabai ZL, Hinoda Y, Ishii N and Dahiya R: Genistein downregulates onco-miR-1260b and inhibits Wnt-signalling in renal cancer cells. Br J Cancer. 108:2070–2078. 2013. View Article : Google Scholar : PubMed/NCBI

31 

Iwata J, Suzuki A, Pelikan RC, Ho TV, Sanchez-Lara PA, Urata M, Dixon MJ and Chai Y: Smad4-Irf6 genetic interaction and TGFβ-mediated IRF6 signaling cascade are crucial for palatal fusion in mice. Development. 140:1220–1230. 2013. View Article : Google Scholar : PubMed/NCBI

32 

Christensen K, Juel K, Herskind AM and Murray JC: Long term follow up study of survival associated with cleft lip and palate at birth. BMJ. 328:14052004. View Article : Google Scholar : PubMed/NCBI

33 

de Filho PA Andra, Letra A, Cramer A, Prasad JL, Garlet GP, Vieira AR, Ferris RL and Menezes R: Insights from studies with oral cleft genes suggest associations between WNT-pathway genes and risk of oral cancer. J Dent Res. 90:740–746. 2011. View Article : Google Scholar : PubMed/NCBI

34 

Parr BA, Shea MJ, Vassileva G and McMahon AP: Mouse Wnt genes exhibit discrete domains of expression in the early embryonic CNS and limb buds. Development. 119:247–261. 1993.PubMed/NCBI

35 

He F, Xiong W, Yu X, Espinoza-Lewis R, Liu C, Gu S, Nishita M, Suzuki K, Yamada G, Minami Y and Chen Y: Wnt5a regulates directional cell migration and cell proliferation via Ror2-mediated noncanonical pathway in mammalian palate development. Development. 135:3871–3879. 2008. View Article : Google Scholar : PubMed/NCBI

36 

Chiquet BT, Blanton SH, Burt A, Ma D, Stal S, Mulliken JB and Hecht JT: Variation in WNT genes is associated with non-syndromic cleft lip with or without cleft palate. Hum Mol Genet. 17:2212–2218. 2008. View Article : Google Scholar : PubMed/NCBI

37 

Juriloff DM, Harris MJ, McMahon AP, Carroll TJ and Lidral AC: Wnt9b is the mutated gene involved in multifactorial nonsyndromic cleft lip with or without cleft palate in A/WySn mice, as confirmed by a genetic complementation test. Birth Defects Res A Clin Mol Teratol. 76:574–579. 2006. View Article : Google Scholar : PubMed/NCBI

38 

Lin C, Fisher AV, Yin Y, Maruyama T, Veith GM, Dhandha M, Huang GJ, Hsu W and Ma L: The inductive role of Wnt-β-Catenin signaling in the formation of oral apparatus. Dev Biol. 356:40–50. 2011. View Article : Google Scholar : PubMed/NCBI

39 

Kawakami Y, Capdevila J, Büscher D, Itoh T, Rodríguez Esteban C and Izpisúa Belmonte JC: WNT signals control FGF-dependent limb initiation and AER induction in the chick embryo. Cell. 104:891–900. 2001. View Article : Google Scholar : PubMed/NCBI

40 

Kim SH, Shin J, Park HC, Yeo SY, Hong SK, Han S, Rhee M, Kim CH, Chitnis AB and Huh TL: Specification of an anterior neuroectoderm patterning by Frizzled8a-mediated Wnt8b signalling during late gastrulation in zebrafish. Development. 129:4443–4455. 2002.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang S, Sun C, Meng Y, Zhang B, Wang X, Su Y, Shi L and Zhao E: A pilot study: Screening target miRNAs in tissue of nonsyndromic cleft lip with or without cleft palate. Exp Ther Med 13: 2570-2576, 2017.
APA
Wang, S., Sun, C., Meng, Y., Zhang, B., Wang, X., Su, Y. ... Zhao, E. (2017). A pilot study: Screening target miRNAs in tissue of nonsyndromic cleft lip with or without cleft palate. Experimental and Therapeutic Medicine, 13, 2570-2576. https://doi.org/10.3892/etm.2017.4248
MLA
Wang, S., Sun, C., Meng, Y., Zhang, B., Wang, X., Su, Y., Shi, L., Zhao, E."A pilot study: Screening target miRNAs in tissue of nonsyndromic cleft lip with or without cleft palate". Experimental and Therapeutic Medicine 13.5 (2017): 2570-2576.
Chicago
Wang, S., Sun, C., Meng, Y., Zhang, B., Wang, X., Su, Y., Shi, L., Zhao, E."A pilot study: Screening target miRNAs in tissue of nonsyndromic cleft lip with or without cleft palate". Experimental and Therapeutic Medicine 13, no. 5 (2017): 2570-2576. https://doi.org/10.3892/etm.2017.4248
Copy and paste a formatted citation
x
Spandidos Publications style
Wang S, Sun C, Meng Y, Zhang B, Wang X, Su Y, Shi L and Zhao E: A pilot study: Screening target miRNAs in tissue of nonsyndromic cleft lip with or without cleft palate. Exp Ther Med 13: 2570-2576, 2017.
APA
Wang, S., Sun, C., Meng, Y., Zhang, B., Wang, X., Su, Y. ... Zhao, E. (2017). A pilot study: Screening target miRNAs in tissue of nonsyndromic cleft lip with or without cleft palate. Experimental and Therapeutic Medicine, 13, 2570-2576. https://doi.org/10.3892/etm.2017.4248
MLA
Wang, S., Sun, C., Meng, Y., Zhang, B., Wang, X., Su, Y., Shi, L., Zhao, E."A pilot study: Screening target miRNAs in tissue of nonsyndromic cleft lip with or without cleft palate". Experimental and Therapeutic Medicine 13.5 (2017): 2570-2576.
Chicago
Wang, S., Sun, C., Meng, Y., Zhang, B., Wang, X., Su, Y., Shi, L., Zhao, E."A pilot study: Screening target miRNAs in tissue of nonsyndromic cleft lip with or without cleft palate". Experimental and Therapeutic Medicine 13, no. 5 (2017): 2570-2576. https://doi.org/10.3892/etm.2017.4248
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team