This article is mentioned in:

Introduction

A high-fat diet (HFD) is known to cause numerous metabolic diseases, such as obesity, insulin resistance and fatty liver. Exposure to a HFD at puberty increases the risk of type 2 diabetes, coronary heart disease and metabolic syndrome (1). Apart from atherosclerosis and obesity, HFD is also associated with neuroendocrine alterations (2). Obesity, which may develop as a result of a HFD, is known to increase the risk of behavioral disorders associated with anxiety in humans; this is particularly pronounced among females (3). A recent epidemiological survey revealed that behavioral and emotional problems during childhood are associated with pre- and postnatal HFD (4). Likewise, female adult rats exposed to a HFD for merely 1 week exhibited anxiety and reduced exploration behavior (5).

A HFD during adolescence has also been shown to increase the blood corticosterone (CORT) levels and expression of glucocorticoid receptors (GRs) in the hypothalamus and hippocampus (6,7). The activity of the hypothalamic-pituitary-adrenal (HPA) axis is modulated by a feedback regulation of GCs and adrenocorticotropic hormone (ACTH) at the levels of the hippocampus, paraventricular nucleus of hypothalamus and pituitary gland. Verma et al (8) found an increased sensitivity of the adrenal cortex in women compared to men. In addition, the variance in ACTH and CORT levels in response to stress are uniformly higher in female rodents. The HPA axis is a vital neuroendocrine axis with a negative feedback regulation center in the hippocampus. The paraventricular nucleus of the hypothalamus directly modulates HPA axis activity (9). Multiple studies have demonstrated that HPA axis imbalance contributes to diseases of the central nervous system (10,11). Clinical evidence has reveals that patients with depression or anxiety are also characterized by increased levels of corticotropin-releasing hormone (CRH) and arginine vasopressin (AVP) (12). A HFD is also associated with HPA axis alterations. For instance, maternal HFD during pregnancy modulates glucocorticoid signaling pathways in limbic areas, and is associated with the regulation of HPA function and anxiety in adulthood (13). A post-weaning HFD until early puberty leads to altered HPA axis function in female rats, indicating that HFD-induced nutritional imbalance in young females may lead to neuroendocrine dysfunction, which in turn may promote the appearance of stress-associated disorders during adolescence (6). Chronic mild stress (CMS) is often associated to the pathogenesis of obesity (14). The ability of CMS to lead to depression, including the wide range of accompanying physical, neurochemical and behavioral changes (e.g., anhedonia) have been well documented (15–17).

Few experimental animal studies on CMS have induced an obese-like state in the animals. Instead, CMS leads to decreases in the consumption of highly palatable foods with subsequent loss in body weight (18–20). Due to the inherent variability of stress paradigms, it is difficult to map out the hormonal and neurochemical responses to CMS. In any given CMS protocol, multiple stressors are used. Furthermore, it is difficult to draw parallels between animal models of CMS and any type of chronic stress in humans (21).

Thus far, however, the effects of a HFD from post-weaning age until adolescence on the HPA axis and behavior have remained elusive. Moreover, the association between HFD-induced behavioral changes and HPA axis sensitivity has remained to be determined. Therefore, the present study used a female rat model to assess the effects of a post-weaning HFD, CMS and their combination on the HPA axis as well as their behavior. Furthermore, the hippocampal mineralocorticoid receptor (MR) and glucocorticoid receptor (GR) expression levels were determined in order to assess any possible correlation between the HFD-induced altered HPA axis sensitivity and behavioral changes.

Materials and methods

Animals and treatment

Animal experiments were performed at the Animal Center of Yangtze University (Jingzhou, China), which is accredited by the Association for Assessment and Accreditation of Laboratory Animal Care International. The study protocol was designed in accordance with the Guidelines for the Care and Use of Laboratory Animals and was approved by the Ethical Research Committee of the Medical College of Yangtze University (Jingzhou, China). Wistar rats (8–10 weeks; n=8 male and 8 female) were supplied the by Experimental Center of Hubei Medical Scientific Academy (no. 2009-0004; Hubei, China). The animals were housed under standard conditions (temperature, 18–22°C; humidity, 40–60%; 12:12 h light-dark cycle) and allowed access to food ad libitum.

The animals were treated as described previously (22). Pregnant rats were fed independently until delivery, and a total of 8 pups from each litter were kept (4 males and 4 females). On postnatal week (PW) 4, the pups were separated from their mothers, and 16 female pups (2 female pups from each mother) were assigned to each group. One group was fed a normal diet (21% kcal from protein, 68.5% kcal from carbohydrates and 10.5% kcal from fat) and the other group received a HFD (88.0% corn flour, 11.5% lard and 0.5% cholesterol, which provided 18.9% kcal from protein, 61.7% kcal from carbohydrates and 19.4% kcal from fat) (23). The HFD and control groups were then further subdivided into two subgroups each (n=8 in each): One subgroup of each group was subjected to 21 days of CMS from PWs 9–12, while the second subgroup was not subjected to stress. Thus, there were a total of four subgroups (n=8 rats per group): The control, in which the rats were fed standard chow and received no stress; the HFD group, in which the rats were fed an HFD; the CMS group, in which the rats were subjected to CMS; and the CMS + HFD group, in which the rats received a HFD as well as CMS. Body weights were determined every 2 weeks from PW4-12.

At PW8, all the animals were subjected to the open field test and electric maze test (Fig. 1). The time interval between the sequential tests was two days. Behavioral tests were performed between 09:30 am and 15:30 pm. Blood samples were collected from the caudal vein after the rats were made to fast for 12 h. The rats in the CMS and CMS + HFD groups were subjected to CMS from PW9-12 according to the procedure described in a previous study (23). This included food and water deprivation for 24 h, pinching of the tail (2 cm from the tail end) for 5 min, treatment with heat at 45°C for 5 min, swimming in cold water at 4–8°C for 4 min followed by towel drying, reversal of the day and night cycles and social isolation (single rat per cage) for 24 h. The stressors were randomly administered and continuously applied at day and night. On PW13, after the last open field test and electric maze test, all of the animals were anesthetized with isoflurane (Baxter Healthcare Co., Deerfield, IL, USA) and decapitated prior to blood sample collection. Finally, the hippocampi and hypothalami were dissected and stored at −80°C for subsequent use.

Figure 1. Schematic illustration of the course of animal treatment in the present study. PW, postnatal weeks.

Behavioral tests

According to the protocol of a previous study (24), the open field test was used to evaluate the locomotor activity and exploratory behavior of the rats. A plywood box with black walls and the dimensions 120×90×30 cm was divided into 25 equal squares. Each rat was individually placed in the center of the apparatus at the time of the test for 3 min and their behavior during this time were recorded in detail. When the hind legs crossed the line of a square, the rat was considered to have crossed over to the next square (crossing), and when the forelegs were lifted from the floor, the animal scored one point. At the end of each open field test, the cage was carefully cleaned with 75% ethanol and purified water prior to the test for the next rat, ensuring no possible interference with the spontaneous behavior of the next animal.

According to a previously described method (22), rat learning and memory were determined by using a Y-type electric maze test. In brief, each rat was placed in the maze and electrical stimulation was performed. Upon electrical stimulation, direct escape from the starting position to a safe region was considered as the correct reaction. The times of correct reaction (TOCR) and total time to escape (TTE) in 10 tests were utilized to evaluate learning and memory abilities.

The serum ACTH and CORT levels were determined according to previously described methods (25) using radioimmunoassay (RIA) and ELISA kits in accordance with the manufacturers' protocols. The rat CORT ELISA kit was obtained from Assaypro (St. Charles, MO, USA). The rat ACTH RIA kit was obtained from Beijing North Biotech Institute (Beijing, China). The gain rate of serum ACTH and CORT levels after vs. prior to stress were calculated as follows: Gain rate (%)=[(Concentration after stress-concentration before stress)/concentration before stress] × 100.

RT-qPCR was performed to assess the mRNA expression levels of MR and GR in the hippocampus as well as CRH and AVP in the hypothalamus. Oligonucleotide primers used in the present study for PCR were all synthesized by Sangon Biotech Co., Ltd. (Shanghai, China) and are listed in Table I. Total RNA was isolated using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's instructions, and its concentration and purity were determined with a spectrophotometer. Total RNA was stored in diethyl pyrocarbonate-treated H2O (DEPC-H2O) at −80°C. RT-qPCR analysis was performed using a reverse transcription and qPCR kit (Takara Biotechnology Co., Ltd., Dalian, China), and reactions were performed and products were analyzed using an ABI PRISM 7300 instrument (Applied Biosystems; Thermo Fisher Scientific, Inc.). Single-stranded complementary (c)DNA was prepared according to the protocol of the Exscript RT reagent kit (Takara Biotechnology Co., Ltd.). The amplification system had a total reaction volume of 25 µl containing 2 µl of a 0.1 µg/µl solution of cDNA template, 0.5 µl of a 10 µmol/l solution of each primer, 12.5 µl 2X Premix Ex Taq, 0.5 µl 20X SYBR-Green I and 9 µl DEPC-H2O. The mRNA levels of the housekeeping gene β-actin were measured as quantitative controls and each sample was normalized to the specific β-actin mRNA content (26). PCR amplification was performed using the following protocol: Initial denaturation step at 95°C for 5 min; 40 cycles of 95°C for 5 sec, with various annealing conditions (Table I) and a step at 72°C for 30 sec if the annealing temperature was <60°C.

Table I. Primers and annealing conditions.

Table I.

Primers and annealing conditions.

Gene	Forward primer (5′-3′)	Reverse primer (5′-3′)	Annealing temperature (°C)/time (sec)
β-actin	GTTGCCAATAGTGATGACCT	GGACCTGACAGACTACCTCA	54/20
CRH	AGAACAACAGTGCGGGCTCA	GCTCCGGTTGCAAGAAATTCA	60/30
AVP	AAGAGGGCCACATCCGACA	AGGGCAGGTAGTTCTCCTCCTG	58/20
MR	TGCATGATCTCGTGAGTGA	AAGTTCTTCCTGGCCGGTAT	62/30
GR	CACCCATGACCCTGTCAGTC	AAAGCCTCCCTCTGCTAACC	61/30

[i] CRH, corticotropin-releasing hormone; AVP, arginine vasopressin; MR, mineralocorticoid receptor; GR, glucocorticoid receptor.

Data were analyzed using SPSS 17 (SPSS Inc., Chicago, IL, USA) and GraphPad Prism 6 (GraphPad Software, Inc., La Jolla, CA, USA). Values are expressed as the mean ± standard error of the mean. Analysis with Student's unpaired t-test was used to compare the mean of different groups, as applicable. Analysis with a paired t-test was used to compare the means of the same group before and after chronic stress, assuming equal variances. P<0.05 was considered to indicate a statistically significant difference.

Results

HFD from PW 4–12 increases rat body weight gain

As shown in Table II, there were no significant differences in the body weight between the HFD, CMS, HFD + CMS and control groups before PW 10. The body weight in the HFD group was significantly increased at PW 12 compared with that in the control group (P<0.01). The body weight in the HFD + CMS group at PW 12 as well as that in the HFD group at PWs 6, 8 and 10 was also increased relative to the control at the respective time-points; however, the differences were not statistically significant.

Table II. Body weight and weight gain rates in female rats.

Table II.

Body weight and weight gain rates in female rats.

	PW 4		PW 6		PW 8		PW 10		PW 12
Group	Body weight (g)	Body weight (g)	Gain rate (%)	Body weight (g)	Gain rate (%)	Body weight (g)	Gain rate (%)	Body weight (g)	Gain rate (%)
Control	48.5±1.9	76.6±3.2	54.3±3.9	94.6±4.4	96.3±10.4	126.8±6.0	162.5±12.7	176.4±7.6	265.4±12.5
HFD	53.2±2.4	81.4±3.8	54.9±8.9	103.2±4.4	96.4±10.9	138.4±5.5	163.5±13.3	210.5±5.9a	302.6±23.5
CMS	48.6±1.3	78.6±1.6	62.2±4.4	104.4±3.4	95.1±7.5	130.8±3.8	169.7±8.7	170.1±4.1	266.5±8.5
HFD+CMS	54.1±2.2	84.5±2.3	56.2±4.7	104.6±3.3	94.7±7.2	137.5±7.4	155.2±15.5	193.9±7.1	260.2±11.2

a P<0.01 vs. control. Values are expressed as the mean ± standard error of the mean (n=8). Groups: Control, rats receiving normal diet and not subjected to CMS; CMS, rats receiving normal diet and subjected to CMS (at PW 9–12); HFD, rats receiving HFD (24% fat by weight from PW 4–12) but not subjected to CMS; CMS + HFD, rats receiving a HFD and subjected to CMS. HFD, high-fat diet; CMS, chronic mild stress; PW, postnatal week.

Post-weaning HFD and CMS induce behavioral alterations in female rats

In the open field test, CMS significantly decreased the frequency of crossing in rats receiving a normal diet or HFD (P<0.01; Fig. 2A and B). Furthermore, after CMS, the frequency of crossing and rearing in the rats receiving a HFD was lower compared to that in rats receiving a normal diet (P<0.05). However, there were no significant changes in the frequency of grooming, total distance moved and distance moved from the center between the HFD and HFD + CMS groups (Fig. 2C-E). Of note, CMS significantly reduced the time spent in the central zone of the maze by rats in rats receiving an HFD (P<0.05; Fig. 2F).

Figure 2. Effects of a post-weaning HFD on frequencies of (A) crossing, (B) rearing and (C) grooming, as well as (D) total distance, (E) center distance and (F) time spent in the central area by female rats in the open field test prior to and after induction of CMS. The female rats from the HFD group were fed a HFD containing 24% fat by weight from PWs 4–12. A proportion of the animals were subjected to 21 days of CMS at PW 9–12. Values are expressed as the mean ± standard error of the mean (n=8). *P<0.05 vs. the control group (Student's unpaired t-test); #P<0.05 and ##P<0.01 vs. before CMS (paired t-test). HFD, high-fat diet; CMS, chronic mild stress; PW, postnatal weeks.

The rats were subjected to the electric maze test to assess animal behavior after stress. Prior to CMS, there were no differences in reaction time and the TTE between the HFD and control groups. However, after CMS, the TOCR was significantly decreased (P<0.05) and the total TTE was slightly increased in the HFD group relative that in the control group (Table III). The TOCR of both the control and HFD groups were significantly decreased after CMS (P<0.01). However, the change in the HFD group after CMS was greater than that in the control. The total TTE did not markedly change.

Table III. TOCR and TTE of the female rats in the electric maze test prior to and after CMS.

Table III.

TOCR and TTE of the female rats in the electric maze test prior to and after CMS.

	Before CMS		After CMS
Group	TOCR (count)	TTE (sec)	TOCR (count)	TTE (sec)
Control	7.62±0.37	65.98±4.96	6.00±0.76a	78.44±4.91
HFD	7.12±0.29	64.92±9.34	4.75±1.03a,b	87.21±5.12

a P<0.01 vs. before CMS by paired t-test

b P<0.05 vs. control by independent t-test. Values are expressed as the mean ± standard error of the mean (n=8). Rats in the HFD group were fed a HFD containing 24% fat by weight from PW 4–12. A proportion of the rats were subjected to 21 days of CMS from PW 9–12. TOCR, times of correct reaction; TTE, total time to escape; HFD, high-fat diet; CMS, chronic mild stress; PW, postnatal week.

Post-weaning HFD and CMS affect serum ACTH and CORT levels in female rats

Prior to CMS, the serum ACTH levels were similar between the control and HFD groups, while the CORT levels were increased in the HFD group (P<0.05). After CMS, the group receiving the HFD showed higher serum ACTH and CORT levels than the group on a normal diet (P<0.01; Fig. 3A and B). Furthermore, in the rats receiving a normal diet as well as a HFD, the ACTH (P<0.01) and CORT (P<0.05 and P<0.01) levels were elevated after CMS, while the CMS-induced increases in the levels of these hormones were considerably higher in the HFD rats compared with those in the rats receiving a normal diet (P<0.05; Fig. 3C).

Figure 3. Effects of a post-weaning HFD on the serum (A) ACTH and (B) CORT levels prior to and after CMS were detected by radioimmunoassay and ELISA, respectively. Rats in the HFD group were fed a HFD containing 24% fat by weight from PW 4–12. A proportion of the rats were subjected to 21 days of CMS from PW 9–12. (C) The gain rates of ACTH and CORT were also calculated. Values are expressed as the mean ± standard error of the mean (n=8). *P<0.05, **P<0.01 vs. control group (Student's unpaired t-test); #P<0.05, ##P<0.01 vs. before CMS (paired t-test). ACTH, adrenocorticotropin-releasing hormone; CORT, corticosterone; HFD, high-fat diet; CMS, chronic mild stress; PW, postnatal weeks.

Post-weaning HFD and CMS affect hypothalamic CRH and AVP mRNA levels in female rats

The AVP and CRH mRNA levels in the hypothalamus were significantly increased in the HFD + CMS group (P<0.05 and P<0.01, respectively) compared to those in the control group (Fig. 4A and B). In addition, the CRH mRNA levels in the hypothalamus were significantly increased in the HFD group compared with those in the control group (P<0.01). Furthermore, CMS significantly increased the CRH mRNA levels in the hypothalamus compared with those in the control group (P<0.05; Fig. 4B). Finally, the CRH mRNA levels in the hypothalamus were higher in the HFD+CMS group than those in the CMS group (P<0.05).

Figure 4. Effects of a post-weaning HFD on gene expression levels of hypothalamic (A) CRH and (B) AVP in the control, HFD, CMS and CMS + HFD groups at PW 13. Values are expressed as the mean ± standard error of the mean (n=8). *P<0.05 and **P<0.01 vs. control; #P<0.05 vs. CMS. Groups: Control, rats receiving normal diet and not subjected to CMS; CMS, rats receiving normal diet and subjected to CMS (at PW 9–12); HFD, rats receiving HFD (24% fat by weight from PW 4–12) but not subjected to CMS; CMS + HFD, rats receiving a HFD and subjected to CMS. CRH, corticotropin-releasing hormone; AVP, arginine vasopressin; HFD, high-fat diet; CMS, chronic mild stress; PW, postnatal weeks.

Effects of post-weaning HFD and CMS on hippocampal MR and GR mRNA expression levels in female rats

No significant changes were observed in the hippocampal MR and GR mRNA levels between the HFD and control groups (Fig. 5A and B). Among all of the groups, no significant changes in the hippocampal MR mRNA expression were detected. However, the GR gene expression levels in the hippocampus were significantly lower in the HFD + CMS group than in the HFD and CMS groups (all P<0.05; Fig. 5B); in addition, the MR/GR ratio in the HFD + CMS group was overtly increased (P<0.05; Fig. 5C).

Figure 5. Effects of post-weaning HFD on hippocampal expression levels of (A) MR, (B) GR and (C) the ration of MR/GR in the control, HFD, CMS and CMS + HFD groups at PW 13. Values are expressed as the mean ± standard error of the mean (n=8). &P<0.05 vs. HFD group; #P<0.05 vs. CMS group. Groups: Control, rats receiving normal diet and not subjected to CMS; CMS, rats receiving normal diet and subjected to CMS (at PW 9–12); HFD, rats receiving HFD (24% fat by weight from PW 4–12) but not subjected to CMS; CMS + HFD, rats receiving a HFD and subjected to CMS. HFD, high-fat diet; CMS, chronic mild stress; PW, postnatal weeks; MR, mineralocorticoid receptor; GR, glucocorticoid receptor.

Discussion

The high-fat rat diet used in the present study (24% fat) mimics the HFD consumed by humans (6,7). Previous studies have shown that women are more prone to mental diseases after HFD and exhibit a higher sensitivity to CMS than men (27), which is why only female rats were assessed in the present study. Fat accumulation is more pronounced when energy is gained from dietary fat rather than from carbohydrates or proteins (28). In the present study, the rat body weight did not show any significant difference between the HFD and control groups at PW 10, while the increase was significant at PW 12. While HFD obviously induced the increase in body weight, it may have also in part been attributed to enhanced food intake, metabolic disturbance of adipocytes and energy imbalance, eventually leading to an obesity-like state (29). Of note, there was no significant body weight change between the CMS and control groups, indicating that CMS alone did not induce any changes in weight gain, indicating that CMS alone without a HFD does not lead to obesity.

Behavioral alterations are a major symptom of mental disorders (30,31). These behavioral alterations are induced by regulatory dysfunction of the cerebral limbic system (32). A maternal HFD has been shown to lead to anxiety in offspring, altering the expression levels of multiple genes via glucocorticoid signaling (33). HFD was shown to have rapid and long-lasting negative effects on memory in model mice with and without Alzheimer's disease (34). The open field test is a classic experimental method for behavioral evaluation, including locomotor activity and exploratory behavior, and the electric maze test is used to assess learning and memory. In the open field test performed in the present study, application of CMS resulted in a significantly reduced frequency of crossings in rats with and without HFD as well as a decreasing tendency in the frequency of rearing, and the time in the center zone in the HFD group significantly reduced following CMS, suggesting depression-like symptoms after CMS. The electric maze test revealed that CMS significantly reduced the TOCR of mice with or without HFD and increased the TTE, particularly in the HFD group, suggesting that post-weaning HFD not only predisposed female rats to psychiatric disorders but also altered learning and memory in them. Further study is required to confirm whether HFD may alter learning and memory. Taken together, HFD and CMS appear to act synergistically to cause depression-like symptoms. Indeed, multiple studies have suggested that CMS causes depression-like behaviors, such as alterations of affective processes and impairment of cognitive performance (35).

The HPA axis has a vital role in the stress response and is affected by a number of factors (36–38). Animal experiments have shown that food restriction increased adrenal gland weight and serum CORT levels after overnight fasting in rats (36), and enhanced HPA axis activity resulting in appetite loss and anorexia nervosa (39). Mixed results have been reported by studies assessing the effects of HFD exposure on CORT during developmental stages under basal conditions and after stress challenge (2,40). In the present study, CMS resulted in higher ACTH and CORT levels and higher expression of CRH gene in hypothalamus tissue in the HFD group compared to that in the control group, suggesting that HFD may enhance HPA axis sensitivity to chronic stress. Considerable evidence suggested associations between certain psychiatric disorders and HPA axis alterations, such as elevated glucocorticoid levels (10,41–43). Furthermore, several psychiatric disorders associated with HPA dysfunction arise in obese teenagers, who are more prone to develop depression than adults (44). Therefore, it can be speculated that behavioral alterations in female rats with post-weaning HFD may be attributed to hypersensitivity of the HPA axis induced by HFD.

The hippocampus is the main negative feedback regulation center of the HPA axis. MR and GR are the steroid receptors predominantly expressed in the hippocampus. The hippocampus regulates HPA function in a negative feedback pattern via the binding of circulating GCs to hippocampal GR and MR. These two receptors have different roles in HPA axis regulation under different conditions. Under basal conditions, the hippocampal MR is mainly responsible for the regulation of the HPA axis by glucocorticoids, while GR becomes the major receptor for glucocorticoid under stress (45). Activation of these receptors can modulate the neuronal system associated with function including memory, behavior, responses to stimuli and anxiety (45). MR harbors a neuroprotective function in the hippocampus (46), while GR is a typical target of neuronal signaling that is sensitive and vulnerable to GC and its over-activation would damage hippocampal neurons (45,47), which may lead to behavioral alterations. For instance, HFD administered from post-weaning age until puberty was found to decrease the hippocampal GR protein expression in female rats (6). In the present study, hippocampal MR mRNA levels showed an increasing tendency after CMS, while GR expression was significantly reduced in the HFD group, increasing the MR/GR ratio. Zhe et al (48) demonstrated that stress induced downregulation of MR and GR and the MR/GR ratio in the hippocampus. MR carries neuron-protective function in the hippocampus; the increase in MR mRNA in hippocampus is involved in negative feedback. However, to the best of our knowledge, there have been no reports on the association between the HFD and the hippocampal MR expression. A change in MR/GR ratio alters the ability to maintain homeostasis, which, in turn, alters neuronal excitability, stress responsiveness and behavioral adaptation to a condition of enhanced vulnerability to disease (49). Therefore, it can be speculated that dysregulation of the MR/GR balance may aggravate HPA axis hypersensitivity, which may be an important cause of behavioral alterations.

In conclusion, the present study revealed that post-weaning HFD increased HPA activity in female rats, and the combination of HFD and CMS enhanced those effects. In addition, female rats that were fed a HFD exhibited impaired memory and learning skills following CMS. These effects may be due to hippocampal MR/GR dysregulation, which further aggravated HPA axis hypersensitivity.

Acknowledgements

This work was supported by grants from the Science Foundation of Hubei Provincial Department of Education (grant nos. Q20151308 and Q20141301), the Yangtze Fund for Youth Teams of Science and Technology Innovation (grant no. 2016YZYT1128), Hubei Province Health and Family Planning Scientific Research Project (grant no. WJ2016-YZ-01), the Medical School of Yangtze University Foundation (grant nos. YXYQ201401 and YXYQ201405).

References