Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
January-2018 Volume 15 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January-2018 Volume 15 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Evaluation of the inactivation effect of riboflavin photochemical method on duck hepatitis B virus

  • Authors:
    • Zi-Yu Zhou
    • Xing-Xiu Bi
  • View Affiliations / Copyright

    Affiliations: Xuzhou Red Cross Blood Station, Xuzhou, Jiangsu 221006, P.R. China
    Copyright: © Zhou et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 751-754
    |
    Published online on: November 13, 2017
       https://doi.org/10.3892/etm.2017.5507
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Hepatitis B virus (HBV) is a common and widespread infection that poses a serious threat among carriers for the development of life-threatening liver diseases. The aim of the present study was to evaluate the effectiveness of the riboflavin photochemical method in inactivating duck hepatitis B virus (DHBV) in plasma via an animal model. Forty ducks were selected and randomly divided into the experimental (n=10), the virus control (n=10), the visible light control (n=10) and the plasma control group (n=10). Ducks in the experimental group were injected with plasma inactivated by the riboflavin photochemical method; in the virus control group were injected with plasma without inactivation treatment; in the visible light control group were injected with plasma irradiated by visible light; and in the plasma control group were injected with normal plasma. The serum of the ducks in each group was taken at different time points to detect DHBV-DNA levels via FQ-PCR and duck hepatitis B surface antigen (DHBsAg) via ELISA. DHBV-DNA in the experimental group was decreased gradually over time until it disappeared and there was a significant difference in DHBsAg between the experimental and control groups (P<0.05). In conclusion, the results showed that the riboflavin photochemical method is effective in the inactivation of viruses in plasma, which has relevance for preventive strategies against transfusion-derived infections.

Introduction

HBV (hepatitis B virus) is a common virus that poses a serious threat to humans. and the hepatic failure, liver cirrhosis and primary hepatocellular carcinoma caused by HBV infection are extremely harmful to human health (1). There are many reports of patients infected with hepatitis B due to HBV contained in blood samples, resulting in great harm to the patients and their families (2). However, with ongoing developments in socioeconomics and improvements in the medical field, advancements such as blood transfusion therapy have made a great contribution to reducing morbidity from viral illness. As such, an increasing number of researchers have investigated viral inactivation techniques, including that of the riboflavin photochemical method.

The riboflavin photochemical method has previously drawn widespread attention in the field of inactivation of pathogenic microorganisms in blood components. Its effectiveness and safety have been scientifically confirmed (3). The principle of inactivation is that riboflavin binds to viral DNA/RNA to oxidize guanine residues on nucleic acid chains while under the activation of ultraviolet/visible light, thereby forming covalent bonds that mediate the rupture of nucleic acid backbone chains. This rupture of the nucleic acid prevents the replication, transcription and translation of viral nucleic acid, thus inactivating the virus (4). To evaluate its effectiveness, a cell infection method is often used; that is, the corresponding host cell is infected with the virus to observe the cytopathic effect in order to indirectly simulate and observe the viral inactivation effect (5). Both duck hepatitis B virus (DHBV) and HBV belong to the hepatotropic DNA virus family, and the nucleic acid composition, biological characteristics and pathogenesis of DHBV are similar to those of HBV. For this reason, ducks infected with DHBV were used as an animal model to study HBV infection and pathogenesis (6).

The aim of the present study was to evaluate the effectiveness of riboflavin photochemical method in the inactivation of DHBV with visible light as a control.

Materials and methods

Main reagents and instruments

DHBV seeds were provided by Xuzhou Medical College (Xuzhou, China). Protease K, Taq DNA polymerase, PCR buffer, dNTP mixture and MgCl2 were the products of Sangon Biological Engineering Technology & Services Co., Ltd. (Shanghai, China). Riboflavin sodium phosphate was the product of Sigma-Aldrich (St. Louis, MO, USA). Duck hepatitis B surface antigen (DHBsAg) kit, microplate reader, and a microplate washer were provided by (Biosharp, Hefei, China). Blood was provided by the Xuzhou Blood Center (Xuzhou, China). A viral inactivation cabinet was sourced from Zibo Zhongbaokang Medical Equipment Co., Ltd. (Shandong, China). Quantitative fluorescence-polymerase chain reaction (QF-PCR) amplifier and nucleic acid protein detector were sourced from Bio-Rad Laboratories (Hercules, CA, USA).

Preparation of virus-containing plasma and viral inactivation treatment

Fresh whole blood (5ml) was extracted from the ducks of each group and was centrifuged for 10 min at 3,000 × g at 4°C to separate the plasma. The plasma was then packed into 50 ml blood bags (10 ml/bag). DHBV seeds were added into the plasma of the experimental, visible light control and virus control groups for a final concentration of 108 cp/250 µl. The experimental group received riboflavin sodium phosphate at a final concentration of 300 µmol/l and irradiation of visible light at an irradiance of 40,000 lux (wavelength: 400–500 nm) for 30 min. The visible light control group only received irradiation of visible light with an irradiance of 40,000 lux for 30 min and without the addition of riboflavin sodium phosphate. The virus control group received riboflavin sodium phosphate at a final concentration of 300 µmol/l and without light treatment, being placed in the dark for 30 min. In addition, the plasma control group did not receive riboflavin sodium phosphate and served as the control, and was placed in the dark for 30 min. The above four groups of experiments were performed on a low-temperature operating desk set at 4±2°C.

Experimental animal grouping

Sixty Tianfu ducks aged 1 day were purchased from the Jiangsu Ecological Poultry Incubation Base (Jiangsu, China). After the sterile collection of venous blood from the ducklings, the serum was separated and screened for experimentation using a DHBV DNA probe via dot hybridization. Forty ducklings without DHBV were then divided into 4 groups, with 10 ducks in each group. Ducks in the experimental group (n=10) were injected via tibial veins with the viral plasma treated with riboflavin photochemical method (0.25 ml/duck). Ducks in the virus control group (n=10) were injected via tibial veins with the viral plasma and with only riboflavin sodium phosphate added (0.25 ml/duck). Ducks in the visible light control group (n=10) were injected via tibial veins with the viral plasma and were only treated with visible light (0.25 ml/duck). Ducks in the plasma control group (n=10) were injected via tibial veins with the plasma but without DHBV (0.25 ml/duck). The blood was collected from the wing veins each time during follow-up. Serum DNA was extracted according to the instructions of the kit and the serum DHBV DNA levels were detected via QF-PCR. The study was approved by the Ethics Committee of Xuzhou Red Cross Blood Station (Xuzhou, China).

QF-PCR detection of DHBV nucleic acid

Blood was drawn from the ducks and the DNA was extracted for QF-PCR amplification according to the instructions of the virus DNA extraction kit. Standard plasmid (2 µl) containing DHBV whole-genome or DNA samples were used as the template. Primers (sense: ACATACACCCCTCTCTCGAA-AG, and antisense: GGACAGTCACACACGACAACA), Taq DNA polymerase, PCR buffer, dNTP mixture, and MgCl2 were all added. The Cq value and the copy number of viral nucleic acid were detected using the QF-PCR amplifier according to the standard curve. Reaction conditions were as follows: Pre-degeneration at 95°C for 1 min, degeneration at 95°C for 5 sec, annealing at 51°C for 5 sec, and extension at 72°C for 30 sec, for a total of 40 cycles. Three tubes were detected for each sample to be detected and the average was taken for each sample.

DHBsAg detection

Duck serum samples were obtained at 2, 7, 14, 21 and 28 days into the experiment and were assessed by qualitative detection via enzyme-linked immunosorbent assay (ELISA). The operation was performed with strict adherence to the instructions of the kit.

Statistical analysis

SPSS 20.0 software (IBM Corp., Armonk, NY, USA) was used for statistical analysis. The Student's t-test was used for the comparison of the means between two sample means and the Chi-square test was used for the comparison of the rates in enumeration data between groups. For each comparison, P<0.05 was considered to indicate a statistically significant diference. The inspection level for type I error was set at α=0.05.

Results

DHBV-DNA QF-PCR standard curve

The standard samples were detected via QF-PCR. The typical amplification curve appeared within the exponential region and there was a good linear correlation among the 6 points. The normal curve was Y (CT value) = −3.872X (log value of copy number) +48.879. Therefore, the sample to be detected was accurately quantified according to the Cq value and standard curve.

DHBV-DNA QF-PCR detection results

Under the assumption that the QF-PCR reaction system and conditions were consistent across tests, each group of samples was detected and the average Cq value was calculated. The average Cq value of each group was converted into the copy number via the standard curve Y=−3.872X+48.879. The results are shown in Table I. The serum was extracted from each group of ducks at regular time intervals to detect DHBV DNA. No infection was evident in the plasma control group. There was a significant difference between the experimental group and the control groups (P<0.05). The copy number of the virus in the experimental group was significantly lower than that in the visible light control group and the virus control group following day 7, and a decrease over time was evident in the copy number among the experimental group. There was no significant difference in copy numbers between the virus control and visible light control groups.

Table I.

Detection of serum DHBV-DNA in each group of ducks at different time points (n=10 for each group).

Table I.

Detection of serum DHBV-DNA in each group of ducks at different time points (n=10 for each group).

Groups

ExperimentalVirus controlVisible light control



Time (days)Cq valueLog valueCopy no.Cq valueLog valueCopy no.Cq valueLog valueCopy no.
  2 31.1±0.56a4.63.98E+04 23.3±0.516.63.98E+06 23.7±0.486.53.16E+0
  7 37.6±0.62a3.21.58E+03 15.9±0.428.53.16E+08 16.4 ±0.518.42.51E+08
140a00 14.0±0.329.21.58E+09 13.3±0.419.01E+09
210a00 13.6±0.419.31.99E+09 12.9±0.409.11.26 E+09
280a00 15.6±0.518.75.08E+08 15.2±0.498.63.98E+08

a Indicates that differences in Cq values across groups were statistically significant, P<0.05. DHBV, duck hepatitis B virus.

DHBsAg detection results

Detection of DHBsAg showed that there were no ducks with DHBsAg in the plasma control group. At 7, 14 and 21 days into the experiment, the number of ducks with DHBsAg in the experimental group was significantly smaller than that in the control groups, and there was a significant difference between groups (P<0.05). There was no significant difference in the proportion of ducks with DHBsAg between the two control groups (P>0.05). Specific data on the results are shown in Table II.

Table II.

DHBsAg detection results of each group (n=10 for each group) at different time points.

Table II.

DHBsAg detection results of each group (n=10 for each group) at different time points.

Groups

ExperimentalVirus controlVisible light control



Time (days)Positive (no.)Negative (no.)Positive (no.)Negative (no.)Positive (no.)Negative (no.)
  7010a  82  82
14010a100100
21010a100100

a Indicates that the differences in rates of DHBsAg detection across groups were statistically significant, P<0.05. DHBsAg, duck hepatitis B surface antigen.

Discussion

According to recent statistics, there are approximately 130 million HBV carriers in China and a considerable number of these HBV carriers are likely to develop chronic hepatitis, liver cirrhosis or primary hepatic carcinoma (7). HBV is mainly transmitted by blood or injection and it has become one of the major public health issues in China at the present time.

Although the application of new screening techniques has greatly improved the safety of blood transfusions, the likelihood of false negative due to an infection ‘window phase’ before serum antibody-positive conversion of blood donors constitutes a problem that cannot be ignored. The possibility of transfusion-derived diseases cannot be completely ruled out in clinical blood transfusion and, as such, there remains a risk of HBV infection due to transfusions (7). Previous findings have shown that an effective measure for reducing such a risk is by inactivating the possible viruses that may exist in blood and blood products (8). In China and other countries, cell infection methods and other in vitro experiments are used to evaluate the effectiveness of viral inactivation, and to assess whether the infectivity of a virus strain on host cells is decreased in vitro (9,10). Although in vitro experimentation is an effective means of simulating viral infections in vivo, animal models are more sensitive than in vitro experiments. In the present study, we used a viral infection animal model, and injected the infected blood into the animal after viral inactivation treatment in order to evaluate the viral inactivation effect.

The results showed that the copy number of DHBV-DNA in ducks in the virus control group injected with the blood without treatment with the riboflavin photochemical method was significantly higher than that in the experimental group. The copy number in ducks injected with the blood treated by the riboflavin photochemical method was decreased gradually with the increase of time, indicating that there was still residual DHBV-DNA after treatment with the riboflavin photochemical method, albeit the DHBV has lost its infectivity and could be degraded after a certain period of time. The above results show that the duck infection status in the present study was consistent with the experimental design, indicating that the riboflavin photochemical method can effectively mediate the rupture of DHBV nucleic acid to inactivate the virus. Furthermore, it is evident that the single treatment with visible light does not have an obvious viral inactivation effect, which is consistent with our previous conclusion (11).

The evaluation of blood virus inactivation is divided into three parts: The effectiveness of the viral inactivation, the effect on blood functions and the residual toxicity of the treated blood. The present study and previous studies have shown that riboflavin-induced photochemistry can fully inactivate DHBV in plasma. However, whether the status of DHBV-infected ducks and DHBV-infected humans following treatment demonstrates the same clinical outcomes is worthy of investigation. The effects of riboflavin treatment on the function and viability of blood components and the safety and effectiveness prior to clinical application were not investigated in the present study due to limited experimental conditions, but remain avenues for further supplemental experimentation in the future.

Acknowledgements

The present study was supported by the Xuzhou Science and Technology Funds (grant no. XM13B051) and by the Jiangsu Blood Collecting and Supplying Organizations (grant no. JSCGX201512).

References

1 

Lewandowska M and Piekarska A: New directions in hepatitis B therapy research. Clin Exp Hepatol. 3:119–126. 2017. View Article : Google Scholar : PubMed/NCBI

2 

Githuku J and Ransom J: Transfusion transmissible infections among walk-in blood donors at Kisumu Regional Blood Transfusion Centre. Kisumu County, Kenya, 2015. Lab Med. Sep 23–2017.(Epub ahead of print).

3 

Zhou ZY and Bi XX: Experimental studies on the inactivation of HBV in blood via riboflavin photochemical treatment. Exp Ther Med. 13:222–224. 2017. View Article : Google Scholar : PubMed/NCBI

4 

Mirshafiee H, Sharifi Z, Hosseini SM, Yari F, Nikbakht H and Latifi H: The effects of ultraviolet light and riboflavin on inactivation of viruses and the quality of platelet concentrates at laboratory scale. Avicenna J Med Biotechnol. 7:57–63. 2015.PubMed/NCBI

5 

Feys HB, Van Aelst B, Devreese K, Devloo R, Coene J, Vandekerckhove P and Compernolle V: Oxygen removal during pathogen inactivation with riboflavin and UV light preserves protein function in plasma for transfusion. Vox Sang. 106:307–15. 2014. View Article : Google Scholar : PubMed/NCBI

6 

Zheng Q, Bai L, Zheng S, Liu M, Zhang J, Wang T, Xu Z, Chen Y, Li J and Duan Z: Efficient inhibition of duck hepatitis B virus DNA by the CRISPR/Cas9 system. Mol Med Rep. 16:7199–7204. 2017.PubMed/NCBI

7 

Corash L: Inactivation of viruses, bacteria, protozoa and leukocytes in platelet concentrates: current research perspectives. Transfus Med Rev. 13:18–30. 1999. View Article : Google Scholar : PubMed/NCBI

8 

Roback JD, Conlan M, Drew WJ, Ljungman P, Nichols WG and Preiksaitis JK: The role of photochemical treatment with amostosalen and UV-A light in the prevention of transfusion-transmitted cytomegalovirus infection. Transfus Med Rev. 20:45–56. 2006. View Article : Google Scholar : PubMed/NCBI

9 

Cocca LHZ, Oliveira TMA, Gotardo F, Teles AV, Menegatti R, Siqueira JP, Mendonça CR, Bataus LAM, Ribeiro AO, Souza TFM, et al: Tetracarboxy-phthalocyanines: From excited state dynamics to photodynamic inactivation against bovine herpesvirus type 1. J Photochem Photobiol B. 175:1–8. 2017. View Article : Google Scholar : PubMed/NCBI

10 

Li Q, Wang D, Yang D, Shan L and Tian P: Binding of Escherichia coli does not protect tulane virus from heat-inactivation regardless the expression of HBGA-Like Molecules. Front Microbiol. 8:17462017. View Article : Google Scholar : PubMed/NCBI

11 

Zhou ZY and Bi XX: Experimental studies on the inactivation of HBV in blood via ribofavin photochemical treatment. Exp Ther Med. 13:222–224. 2017. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhou Z and Bi X: Evaluation of the inactivation effect of riboflavin photochemical method on duck hepatitis B virus. Exp Ther Med 15: 751-754, 2018.
APA
Zhou, Z., & Bi, X. (2018). Evaluation of the inactivation effect of riboflavin photochemical method on duck hepatitis B virus. Experimental and Therapeutic Medicine, 15, 751-754. https://doi.org/10.3892/etm.2017.5507
MLA
Zhou, Z., Bi, X."Evaluation of the inactivation effect of riboflavin photochemical method on duck hepatitis B virus". Experimental and Therapeutic Medicine 15.1 (2018): 751-754.
Chicago
Zhou, Z., Bi, X."Evaluation of the inactivation effect of riboflavin photochemical method on duck hepatitis B virus". Experimental and Therapeutic Medicine 15, no. 1 (2018): 751-754. https://doi.org/10.3892/etm.2017.5507
Copy and paste a formatted citation
x
Spandidos Publications style
Zhou Z and Bi X: Evaluation of the inactivation effect of riboflavin photochemical method on duck hepatitis B virus. Exp Ther Med 15: 751-754, 2018.
APA
Zhou, Z., & Bi, X. (2018). Evaluation of the inactivation effect of riboflavin photochemical method on duck hepatitis B virus. Experimental and Therapeutic Medicine, 15, 751-754. https://doi.org/10.3892/etm.2017.5507
MLA
Zhou, Z., Bi, X."Evaluation of the inactivation effect of riboflavin photochemical method on duck hepatitis B virus". Experimental and Therapeutic Medicine 15.1 (2018): 751-754.
Chicago
Zhou, Z., Bi, X."Evaluation of the inactivation effect of riboflavin photochemical method on duck hepatitis B virus". Experimental and Therapeutic Medicine 15, no. 1 (2018): 751-754. https://doi.org/10.3892/etm.2017.5507
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team