Introduction
Congenital clubfoot (CCF) is a common congenital
malformation that seriously endangers children's health (1). The pathogenesis of CCF is unclear.
Previous findings showed that common impacts of multiple factors
lead to the occurrence of CCF (2,3). At
present, an increasing number of studies have focused on CCF. With
the development of genetics and genetic technology, it has been
found that multiple genes play an important role in the occurrence
and development of CCF (4).
Transcription factor homeobox gene (HOX gene)
belongs to the homeobox family, which constitutes genes that
specifically regulate and control biological form and structure in
living organism (5,6). Previous findings have shown that HOX
gene mutation is closely related to the occurrence and development
of CCF (7).
The present study explored the pathogenetic process
of CCF by detecting the levels of iNOS and NO, as well as the
factors associated with inflammation and apoptosis, and the
expression of HOX gene in CCF was detected by RT-PCR and
western blot analysis, in order to provide guidance for genetic
diagnosis, precaution and treatment of CCF.
Patients and methods
Patient data
Patients included in the present study comprised
children who were hospitalized and had undergone operations in
Jiangyang Hospital between April 2009 and May 2015. All the child
patients had clinical symptoms of typical CCF. If combined with
other malformations the patients were excluded by examination and
operational definite diagnosis. The CCF group comprised 35 cases of
children with CCF (male, 18 cases; female, 17 cases), aged 0.6–9
years, with an average age of 3.4 years. Muscle specimens were from
the children who had undergone CCF operations, and 100 mg lower leg
gastrocnemius was collected for the study. The control group
comprised 34 cases of children without congenital malformation who
had trauma operations of lower legs or had taken out internal
fixation after the traumas of lower legs (male, 20 cases; female,
14 cases). These childrend were aged 1.1–10 years, with an average
age of 6.8 years. Approximately 100 mg lower leg gastrocnemius was
collected as muscle specimens from the same location as the CCF
group.
Signed informed consent forms were obtained from the
children's family for the collection and use of the specimens. The
study was approved by the Ethics Committee of the Affiliated
Hospital of Southwest Medical University (Luzhou, China).
Primary reagents
iNOS and NO detection kit (Jiancheng, Nanjing,
China); bicinchoninic acid (BCA) protein assay kit (Biyuntian,
Shanghai, China); TRIzol total RNA extraction kit; reverse
transcription-polymerase chain reaction (RT-PCR) reverse
transcription kit (both from Tiangen, Beijing, China);
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and HOX monoclonal
antibodies and secondary antibodies (CST, Boston, MA, USA) were
used in the study.
Experimental methods
Measurement of iNOS
The serum samples of the patients in the control and
CCF groups were collected. The levels of iNOS and NO in the sera
were measured and the results of the data were analyzed in
accordance with the protocols provided by Nanjing Jiancheng Biology
Co., Ltd.
RT-PCR analysis
RT-PCR analysis was carried out using the following
steps:
a) Extraction of total RNA
The collected tissues were rapidly transferred to
Eppendorf (EP) tubes that contained 1.5 ml RNAiso Plus extracting
solution (the tissues needed homogenizing thoroughly). After 5 min
standing, the samples were disintegrated completely and centrifuged
for 5 min at 12,000 × g at 4°C. The supernatan t was carefully
absorbed to be transferred to new EP tubes. Chloroform (0.2 ml) was
added to the supernatant, and then mixed evenly. After 5 min
standing at room temperature, the samples were centrifuged for 15
min at 12,000 × g at 4°C, the supernatant was absorbed, and then
the same volume of isopropanol was added, mixed evenly, and left to
stand for 10 min at room temperature. The samples were then
centrifuged for 10 min at 12,000 × g at 4°C, the supernatant was
discarded carefully, and the sediment was preserved. Subsequently,
1 ml 75% ethyl alcohol was added, and the samples were mixed
evenly, followed by centrifugation for 5 min at 12,000 × g at 4°C.
The supernatant was carefully discarded, and the process was
repeated. After the RNA sediment was washed, the liquid was
discarded. Finally, when the ethyl alcohol volatilized completely,
the RNase-free water was added.
b) Purity analysis and content
calculation of total RNA
Total RNA solution (4 µl) was diluted with 1 ml
RNase-free water, and the absorbance values were measured at
wavelengths of 260, 280 and 320 nm. If optical density
(OD260/OD280) was between 1.8 and 2.2, it
showed that the purity of sample RNA met the requirement. RNA
concentration (µg/µl) = (OD260-OD320) ×
dilution ratio × 0.04.
c) Reverse transcription
After partial RNA solution was diluted with
RNase-free water to get 1 µg/µl solution, reverse transcription
solution was prepared in accordance with the instructions of the
PrimeScript® RT reagent kit with gDNA eraser kit, into
which the corresponding RNA samples were added, and reverse
transcription was performed to obtain cDNA. The obtained cDNA was
kept at −20°C.
d) qPCR analysis
According to the protocol of the SYBR®
Premix Ex Taq™ II (Tli RNaseH Plus) kit, the levels of mRNA were
measured. Primer sequences of corresponding RNA are shown in
Table I.
 | Table I.Primer sequences of related genes were
analyzed by RT-PCR analysis. |
Table I.
Primer sequences of related genes were
analyzed by RT-PCR analysis.
| Gene names | Primer sequences |
|---|
| IL-1β | 5′-3′
CTGAGCACCTTCTTTCCCTTCA |
|
| 3′-5′
TGGACCAGACATCACCAAGCT |
| IL-6 | 5′-3′
TGGCTGAAAAAGATGGATGCT |
|
| 3′-5′
TCTGCACAGCTCGGCTTGT |
| TNF-α | 5′-3′
TGTAGCCCATGTTGTAGCAAACC |
|
| 3′-5′
GAGGACCTGGGAGTAGATGAGGTA |
| Fas | 5′-3′
ACATGGACAAGAACCATTATGCTGA |
|
| 3′-5′
CTGGTTTGCACTTGCACTTGGTA |
| FasL | 5′-3′
CATGCAGCAGCCCATGAATTAC |
|
| 3′-5′
CTCTAGGCCCACAAGATGGACAG |
| Bax | 5′-3′
CAGGATGCGTCCACCAAGAA |
|
| 3′-5′
CGTGTCCACGTCAGCAATCA |
| HOX | 5′-3′
GTGATCTGTAATCCCTATGAG |
|
| 3′-5′
TFGTTACCCTGCATTACGATG |
| β-actin | 5′-3′
GAGCCGGGAAATCGTGCGT |
|
| 3′-5′
GGAAGGAAGGCTGGAAGATG |
Western blot analysis
The collected tissues of the control and CCF groups
were washed respectively with ice-cold physiological saline. The
protein concentrations were measured by BCA protein assay kit, and
preserved for standby application after being packed separately at
−80°C. The procedure was performed according to the protocol of the
total protein extration kit. Immunoprecipitation (IP) lysate
containing phenylmethanesulfonyl fluoride (PMSF) and protease
inhibitor was added, and the tissues were placed on ice for full
grinding. After tissue homogenate was centrifuged for 10 min at 4°C
and 12,000 × g, the supernatant was taken; after it was centrifuged
for 20 min again at 4°C and 12,000 × g, the supernatant was taken.
Then, after the supernatant and protein qualification were carried
out according to the protocol of the protein kit, the protein
samples containing an equal quantity of total protein were loaded
and placed onto sample loading wells, and electrophoresed at
constant voltage of 220 V, and the electrophoresis stopped when the
bromophenol blue reached the bottom of the gel. According to
molecular weight of target protein, the gel was cut and placed into
transfer buffer. Polyvinylidene fluoride (PVDF) membrane was cut to
keep the target band only, and the PVDF membrane was soaked in
methyl alcohol for 10 sec. The PVDF membrane and filter paper were
placed in a transfer buffer and then a transmembrane device in the
order of positive electrode, filter paper, PVDF membrane, gel,
filter paper, negative electrode, and PVDF membrane was transferred
for appropriate time at constant voltage of 110 V, for the protein
of the gel to transfer to the PVDF membrane. The PVDF membrane to
which protein was adhered was placed in 5% skim milk powder, and
then agitated and sealed for 3 h at room temperature. The membrane
was then placed in rabbit anti-human GAPDH monoclonal antibody
(dilution, 1:1,000; cat. no. 2118) and rabbit anti-human HOX
primary monoclonal antibodies (dilution, 1:1,000; cat. no. 90944)
for incubation overnight at 4°C. The next day, the PVDF membrane
was completely washed with Tween-20/Tris-buffered salt (TTBS) (10
min/time, 3 times), and then goat anti-rabbit secondary polyclonal
antibody (dilution, 1:2,000; cat. no 7074) were added and incubated
for 1 h at room temperature. After washing with TTBS (10 min/time,
3 times), enhanced chemiluminescence (ECL) color-substrate solution
was added dropwise for color development photography.
Statistical analysis
Experimental data were expressed with mean ±
standard deviation, and statistical analysis for experimental
results was made by Statistical Product and Service Solutions 17.0
(SPSS 17.0; Chicago, IL, USA). Mean comparison between the two
groups were obtained using the Student's t-test. For mean
comparisons among the groups one-way analysis of variance (ANOVA)
was used. SNK test was used as post hoc test. Statistical
significance was set at P<0.05.
Results
Measured results of iNOS and NO
As shown in Fig. 1,
the levels of iNOS and NO between the control and CCF groups were
significantly different. The levels of iNOS and NO in the CCF group
were significantly higher than those in the control group, which
indicated that obvious oxidative damage occurred in the CCF
group.
RT-PCR results of the factors
associated with inflammation
Total RNA was extracted respectively from tissue
samples of the control and CCF groups. After RT-PCR, the expression
of IL-1β, IL-6 and TNF-α in CCF group was significantly higher than
those in control group (Fig. 2). It
could thus be seen that excessive expression of inflammatory
factors generated serious inflammatory reaction in pathogenic
process of CCF.
RT-PCR results of the factors
associated with apoptosis
As shown in Fig. 3,
the expression of Fas, FasL and Bax in CCF group was significantly
higher than that in the control group. Thus, the excessive
expression of the factors related to apoptosis resulted in serious
tissue apoptosis and damage in pathogenic process of CCF.
RT-PCR result of HOX mRNA
The expression of HOX RNA in tissue samples of the
control and CCF groups was detected, and the results are shown in
Fig. 4. As shown the expression
quantity of HOX in CCF group was significantly higher than that in
the control group, which indicated that the expression of HOX mRNA
in CCF was very high and was associated with the development of
CCF.
Expression of HOX protein in the
control and CCF groups
Results of the western blot analysis revealed the
expression of HOX protein in the tissues of the control and CCF
groups. As shown in Fig. 5, HOX
protein was expressed highly in the tissues of CCF group, and the
expression quantity was greater than that in control group.
Discussion
CCF is a common congenital malformation that
threatens children's health and seriously impacts on foot function
(8). At present, the pathogenesis of
CCF is not very clear, there are main theories such as germplasm
defect theory, developmental block theory, theories of neurogenic
myogenic and angiogenic abnormality in embryonic period and theory
of fiber curliness denaturation (9–11).
Currently, the most respected theory is the theory of neuromuscular
lesion (12). In recent years, with
the rapid development of epidemiologic studies, we identified that
genetic factors play an important role (13) in the pathogenesis process of CCF.
The development process of limbs is a very complex
process regulated and controlled by multiple genes (14). The development process refers to the
sequence of successive expression of multiple genes within
different periods and different spaces (15). Transcription factor HOX gene
is an effective gene in the development of limbs that has been
extensively studied (16).
HOX gene plays a very important role in many parts of the
body, including nerves, muscles, bones and blood vessels. Thus,
diseases on limbs can be caused once HOX gene has mutations
or abnormal expression (17). The
occurrence of CCF may be the abnormal expression of HOX gene
in the development process of limbs, and then abnormal embryonic
development is caused to lead to CCF (18). Some studies showed that HOX
gene adjusted the factors associated with apoptosis, thus it
indicates that HOX gene may be the important susceptibility
gene of CCF (19,20).
This study included 35 cases of child patients with
CCF as the CCF group, and 34 cases of children with congenital
malformation as the control group. iNOS and NO kits were used to
measure the levels of iNOS in the sera of the control and CCF
groups. IL-1β, IL-6, TNF-α, Fas, FasL, Bax and the expression of
HOX mRNA in the tissues of both groups were detected by RT-PCR. The
expression of HOX in the control and CCF groups was detected via
western blot analysis. Experimental results showed that oxidative
damage, inflammatory factors and apoptotic factors appeared in CCF
group. RT-PCR and western blot analysis showed that, HOX was highly
expressed in CCF group, where the expression quantity of HOX was
significantly higher than that in normal tissues.
In conclusion, the present study made some progress
in determining the aetiological agent of CCF and genetic expression
of HOX. However, more follow-up studies should be conducted because
the pathogenesis of CCF is very complex on its genetic aspects. We
expect to discover other susceptibility genes, study the
association between HOX and other genes, and further study on
interaction mechanism among multiple genes is required. We believe
that HOX is of great significance in gene therapy and HOX indicates
a new direction for the diagnosis and treatment of CCF in the
future based on this study.
Acknowledgements
Not applicable.
Funding
No funding was received.
Availability data and materials
The datasets used and/or analyzed during the current
study are available from the corresponding author on reasonable
request.
Author's contributions
YW wrote the manuscript, performed RT-PCR and
western blot analysis.
Ethics approval and consent to
participate
Signed informed consent forms were obtained from the
children's family. The study was approved by the Ethics Committee
of The Affiliated Hospital of Southwest Medical University (Luzhou,
China).
Consent for publication
Not applicable.
Competing interests
Authors declare that they have no competing
interests.
References
|
1
|
Ponseti IV: Treatment of congenital club
foot. J Bone Joint Surg Am. 74:448–454. 1992. View Article : Google Scholar : PubMed/NCBI
|
|
2
|
Dobbs MB and Gurnett CA: Update on
clubfoot: Etiology and treatment. Clin Orthop Relat Res.
467:1146–1153. 2009. View Article : Google Scholar : PubMed/NCBI
|
|
3
|
Stewart SF: Club-foot: Its incidence,
cause, and treatment; an anatomical-physiological study. J Bone
Joint Surg Am. 33-A:577–590. 1951. View Article : Google Scholar : PubMed/NCBI
|
|
4
|
Kite JH: Principles involved in the
treatment of congenital clubfoot. J Bone Joint Surg Am. 21:595–606.
1939.
|
|
5
|
Beeman RW, Stuart JJ, Haas MS and Denell
RE: Genetic analysis of the homeotic gene complex (HOM-C) in the
beetle Tribolium castaneum. Dev Biol. 133:196–209. 1989.
View Article : Google Scholar : PubMed/NCBI
|
|
6
|
Krumlauf R: Hox genes in vertebrate
development. Cell. 78:191–201. 1994. View Article : Google Scholar : PubMed/NCBI
|
|
7
|
Bienz M: Homeotic genes and positional
signalling in the Drosophila viscera. Trends Genet.
10:22–26. 1994. View Article : Google Scholar : PubMed/NCBI
|
|
8
|
Kite JH: The classic. Principles involved
in the treatment of congenital clubfoot by J. Hiram Kite, M.D.
reprinted from J. Bone Joint Surg. 21:595-606, 1939. Clin Orthop
Relat Res. 84:4–8. 1972.PubMed/NCBI
|
|
9
|
Ponseti IV: Common errors in the treatment
of congenital clubfoot. Int Orthop. 21:137–141. 1997. View Article : Google Scholar : PubMed/NCBI
|
|
10
|
Ponseti IV and Smoley EN: Congenital club
foot: The results of treatment. J Bone Joint Surg Am. 45:261–344.
1963. View Article : Google Scholar
|
|
11
|
Gerlach DJ, Gurnett CA, Limpaphayom N,
Alaee F, Zhang Z, Porter K, Kirchhofer M, Smyth MD and Dobbs MB:
Early results of the Ponseti method for the treatment of clubfoot
associated with myelomeningocele. J Bone Joint Surg Am.
91:1350–1359. 2009. View Article : Google Scholar : PubMed/NCBI
|
|
12
|
Pirani S, Zeznik L and Hodges D: Magnetic
resonance imaging study of the congenital clubfoot treated with the
Ponseti method. J Pediatr Orthop. 21:719–726. 2001. View Article : Google Scholar : PubMed/NCBI
|
|
13
|
Boehm S, Limpaphayom N, Alaee F, Sinclair
MF and Dobbs MB: Early results of the Ponseti method for the
treatment of clubfoot in distal arthrogryposis. J Bone Joint Surg
Am. 90:1501–1507. 2008. View Article : Google Scholar : PubMed/NCBI
|
|
14
|
Laaveg SJ and Ponseti IV: Long-term
results of treatment of congenital club foot. J Bone Joint Surg Am.
62:23–31. 1980. View Article : Google Scholar : PubMed/NCBI
|
|
15
|
Cummings RJ, Davidson RS, Armstrong PF and
Lehman WB: Congenital clubfoot. J Bone Joint Surg Am. 84-A:290–308.
2002. View Article : Google Scholar : PubMed/NCBI
|
|
16
|
Zákány J and Duboule D: Hox genes in digit
development and evolution. Cell Tissue Res. 296:19–25. 1999.
View Article : Google Scholar : PubMed/NCBI
|
|
17
|
Arenas-Mena C, Cameron AR and Davidson EH:
Spatial expression of Hox cluster genes in the ontogeny of a sea
urchin. Development. 127:4631–4643. 2000.PubMed/NCBI
|
|
18
|
Arenas-Mena C, Martinez P, Cameron RA and
Davidson EH: Expression of the Hox gene complex in the indirect
development of a sea urchin. Proc Natl Acad Sci USA.
95:13062–13067. 1998. View Article : Google Scholar : PubMed/NCBI
|
|
19
|
Finnerty JR, Pang K, Burton P, Paulson D
and Martindale MQ: Origins of bilateral symmetry: Hox and dpp
expression in a sea anemone. Science. 304:1335–1337. 2004.
View Article : Google Scholar : PubMed/NCBI
|
|
20
|
Castelli-Gair J and Akam M: How the Hox
gene Ultrabithorax specifies two different segments: The
significance of spatial and temporal regulation within metameres.
Development. 121:2973–2982. 1995.PubMed/NCBI
|
