Introduction
Diabetic retinopathy (DR) is an important
manifestation of microangiopathy and is one of the most important
causes of blindness in diabetic patients (1). The incidence of retinopathy is as high
as 23% in diabetic patients (2). DR
has become the main cause of adult blindness (3). Pathology of DR is mainly the damage of
retinal capillary endothelial cells, and changes in expression
patterns of angiogenesis, apoptotic and oxidative stress pathway
molecules are usually involved (4,5).
Safflor yellow (SY) is the main component of the
safflower in Compositae. SY has the function of inhibiting platelet
aggregation, antioxidation and tumor growth (6). Recent studies suggest that SY can be
used to effectively treat early retinopathy in patients with type
II diabetes (7,8). Erythropoietin (EPO) can antagonize
oxidation and inhibit apoptosis. On the one hand, EPO reduces
damage of retinal nerve cells, and on the other hand, it can
promote angiogenesis, leading to the development of the disease
(9). Thus, carbamyl erythropoietin
(CEPO) loses its ability to promote angiogenesis, but it still
maintains other functions (10).
In this study, CEPO and SY were used to treat DR
rats and their therapeutic effects were observed. Thus, the
molecular mechanism of the action of CEPO in the treatment of DR
rats was analyzed. Our study provided reference for further
clinical studies.
Materials and methods
Experimental animals
Healthy adult male SD rats (200±20 g) were provided
by China Medical University (Taichung, Taiwan, R.O.C.). The rats
were kept in cage with controlledtemperature and light cycles (24°C
and 12/12 light cycles) with free access to water and food. The
humidity was 60±10%. The study was approved by the Ethics Committee
of The Eye Hospital of Wenzhou Medical University (Wenzhou, China).
The study was approved by the Ethics Committee of The Eye Hospital
of Wenzhou Medical University (Wenzhou, China).
Drugs and main reagents
High-fat and high-sugar food (Beijing Botai Hongda
Biotechnology Co., Ltd., Beijing, China), streptozotocin (Solarbio
Science & Technology Co., Ltd., Beijing, China), CEPO (Jiangsu
Tailida Co., Ltd., Rugao, China), SY (state approval no. Z20050594;
Shanxi Huahui Kaide Pharmaceutical Co., Ltd., Jinzhong, China),
TRIzol (Sangong Pharmaceutical Co., Ltd., Shanghai, China), cDNA
first-strand synthesis kit (Sangong Pharmaceutical Co., Ltd.),
RT-qPCR kit (Takara Bio, Inc., Otsu, Japan). The primer sequences
were synthesized by GenScript (Nanjing, China).
Construction of the diabetes rat
model
SD rats were adaptively fed for 1 week, and then fed
with high-fat and high-sugar diet for 4 weeks. Intraperitoneal
injection of streptozotocin (50 mg/kg) was performed every week
after rats were fasted for 12 h. The last injection was performed
after the rats were fasted for 8 h. Blood was extracted from the
tail vein to detect random blood glucose and blood glucose levels,
which were >17 mmol/l, indicating a successfully established
model. A total of 126 DR model rats were obtained.
Animal grouping and drug
intervention
One hundred twenty-six rat models were randomly
divided into the model (n=42), experimental (n=42) and control
(n=42) groups. The rats in the experimental group were treated with
intraperitoneal injection of CEPO (50 µg/kg·day), the rats in the
control group were treated with intraperitoneal injection of SY (40
mg/kg), and the rats in the control and experimental groups were
treated for 2 weeks. Finally, the rats in the model group were
injected with 1 ml normal saline for 2 weeks.
Measurement of expression levels of
angiogenetic, apoptotic and oxidative stress pathway molecules at
the mRNA level
After being treated for 2 weeks, the rats were
sacrificed and the eyeballs were dissected to obtain retinas.
TRIzol was used to extract total RNA from the retinal tissue
according to the protocol, and then cDNA was synthesized according
to the instructions of the cDNA first-strand synthesis kit. Reverse
transcription-quantitative PCR (RT-qPCR) reactions were performed
using β-actin as endogenous control. Expression of
angiogenesis-promoting molecules [hypoxia-inducible factor-1α
(HIF-1α), vascular endothelial growth factor (VEGF), angiopoietin
(Ang-1)], angiogenesis-inhibiting molecules [tissue kallikrein
(TKLK), and pigment epithelium-derived factor (PEDF)],
apoptosis-promoting molecules [Bcl-2 related X protein (Bax) and
cysteine aspartate specific protease (caspase-3)],
apoptosis-inhibiting molecules (Bcl-2 and survivin), oxidative
stress pathway molecules [nuclear factor erythroid 2 (NFE2)-related
factor 2 (Nrf2), heme oxygenase-1 (HO-1) and NAD(P)H quinone
dehydrogenase 1 (NQO1)] was detected. RT-qPCR reaction system
consisted of 10 µl of SYBR-Green Master Mix (Takara Bio, Inc.,
Otsu, Japan), 0.5 µl of upstream and downstream primers, 1 µl of
cDNA, and 8 µl ddH2O was added to make a total volume of
20 µl. RT-qPCR reaction conditions were: 95°C for 3 min, followed
by 40 cycles of 95°C for 30 sec and 55–61°C (depending on specific
genes) for 1 min. The primer sequences used in PCR reactions are
listed in Table I.
 | Table I.Primer sequences used in PCR
reactions. |
Table I.
Primer sequences used in PCR
reactions.
| Genes | Primer sequences
(5′3′) | TM (°C) |
|---|
| HIF-1α |
F:GAACCCATTTTCTACTCAGGACACAG | 55 |
|
|
R:CCACTTTCATCCATTGATTGCCC |
|
| VEGF |
F:CGAGACCCTGGTGGACAT | 58 |
|
|
R:ACAAATGCTTTCTCCGCT |
|
| Ang-1 |
F:AGACCAGTACAACACAAAC | 58 |
|
|
R:CGGTCTGAGAGAGGAGGCT |
|
| TKLK |
F:TCATCAATGAAGACCTATGCG | 56 |
|
|
R:AGCATCAGGTCATTGCTGTA |
|
| PEDF |
F:CTACAGGTGCGCGCCAAC | 61 |
|
|
R:CTAAGGCGCACACATTTG |
|
| Bax |
F:GCGAATTGGAGATGAACTGG | 56 |
|
|
R:GTGAGCGAGGCGGTGAGGAC |
|
| Caspase-3 |
F:GAAGCGAATCAATGGACTCTG | 58 |
|
|
R:GCACAAAGCGACTGGATGAA |
|
| Bcl-2 |
F:CTGGTGGACAACATCGCTCTG | 58 |
|
|
R:GGTCTGCTGACCTCACTTGTG |
|
| Survivin |
F:ATCCACTGCCCTACCGAGAAC | 58 |
|
|
R:TGCTCCTCTATCGGGTTGTCAT |
|
| Nrf-2 |
F:TCCTCTGCTGCCATTAGTCA | 58 |
|
|
R:GTGCCTTCAGTGTGCTTCT |
|
| HO-1 |
F:CAGGAGCTGCTGACCCATGA | 58 |
|
|
R:AGCAACTGTCGCCACCAGAA |
|
| NQO-1 |
F:GGATTGGACCGAGCTGGAA | 58 |
|
|
R:AATTGCAGTGAAGATGAAGGCAAC |
|
| β-actin |
F:GACCCAGATCATGTTTGAGACCTT | 58 |
|
|
R:GACTCGTCATACTCCTGCTTGC |
|
Statistical analysis
SPSS 17.0 (Beijing Xinmeijiahong Technology Co.,
Ltd., Beijing, China) was used for all statistical analyses.
Measurement data were expressed as mean ± SD, and analysis of
variance was used for comparisons among groups and the post hoc was
Least Significant Difference test. P<0.05 was considered to
indicate a statistically significant difference.
Results
Analysis expression of retinal
angiogenesis-related molecules at the mRNA level
After the SY treatment, expression levels of HIF-1α,
VEGF and Ang-1 mRNAs in the control group were significantly lower
than those in the model and experimental groups (P<0.05).
However, there was no significant difference in the expression
levels of the genes in the CEPO-treated experimental and model
groups (P>0.05; Table II). The
expression levels of TKLK and PEDF in the control group were
significantly higher than those in the model and experimental
groups (P<0.05; Table III),
while no significant differences were observed between the model
and experimental groups (P<0.05; Table III).
| Table II.Expression levels of
angiogenesis-promoting molecules in the rat retina at the mRNA
level (n=42, mean ± SD). |
Table II.
Expression levels of
angiogenesis-promoting molecules in the rat retina at the mRNA
level (n=42, mean ± SD).
| Groups | HIF-1α | VEGF | Ang-1 |
|---|
| Model | 2.42±0.33 | 2.35±0.30 | 1.80±0.22 |
| Experimental | 2.40±0.31 | 2.38±0.28 | 1.83±0.25 |
| Control |
1.85±0.13a |
1.68±0.15a |
1.32±0.15a |
| F | 7.748 | 8.761 | 9.331 |
| P-value | 0.049 | 0.042 | 0.038 |
| Table III.Expression levels of
angiogenesis-inhibiting molecules in the rat retina at the mRNA
level (n=42, mean ± SD). |
Table III.
Expression levels of
angiogenesis-inhibiting molecules in the rat retina at the mRNA
level (n=42, mean ± SD).
| Groups | TKLK | PEDF |
|---|
| Model | 0.45±0.08 | 0.38±0.05 |
| Experimental | 0.48±0.06 | 0.35±0.07 |
| Control |
0.88±0.10a |
0.76±0.03a |
| F | 33.823 | 140.691 |
| P-value | 0.004 | <0.001 |
Analysis of expression of the
apoptosis-related molecules in the retina
The expression levels of the apoptosis-promoting
molecules Bax and caspase-3 in the retinal tissue of DR rats in the
control and experimental groups were significantly lower than those
in the model group (P<0.05), and were significantly lower in the
experimental group than in the control group (P<0.05; Table IV). The expression levels of the
apoptosis inhibitors Bcl-2 and survivin were significantly higher
in the control and experimental groups than in the model group
(P<0.05), and were significantly higher in the experimental
group than in the control group (P<0.05; Table V).
| Table IV.Analysis of apoptosis-promoting
molecules in the rat retina at the mRNA level (n=42, mean ±
SD). |
Table IV.
Analysis of apoptosis-promoting
molecules in the rat retina at the mRNA level (n=42, mean ±
SD).
| Groups | Bax | Caspase-3 |
|---|
| Model | 2.88±0.32 | 2.51±0.35 |
| Control |
2.01±0.29a |
2.09±0.24a |
| Experimental |
1.58±0.18a,b |
1.70±0.22a,b |
| F | 23.632 | 6.463 |
| P-value | 0.001 | 0.032 |
| Table V.Analysis of apoptosis-inhibiting
molecules in the rat retina at the mRNA level (n=42, mean ±
SD). |
Table V.
Analysis of apoptosis-inhibiting
molecules in the rat retina at the mRNA level (n=42, mean ±
SD).
| Groups | Bcl-2 | Survivin |
|---|
| Model | 0.41±0.05 | 0.35±0.04 |
| Control |
0.61±0.08a |
0.58±0.03a |
| Experimental |
0.73±0.08a,b |
0.68±0.03a,b |
| F | 15.373 | 75.794 |
| P-value | 0.004 | <0.001 |
Analysis of the oxidative stress
pathway-related molecules in the retina
After treatment, the expression levels of Nrf-2,
HO-1, and NQO-1 in the retina were significantly higher in the
control and experimental groups than in the model group
(P<0.05), and were also significantly higher in the experimental
group than in the control group (P<0.05; Table VI).
| Table VI.Analysis of the oxidative stress
pathway-related molecules in the rat retina at the mRNA level
(n=42, mean ± SD). |
Table VI.
Analysis of the oxidative stress
pathway-related molecules in the rat retina at the mRNA level
(n=42, mean ± SD).
| Groups | Nrf-2 | HO-1 | NQO-1 |
|---|
| Model | 1.87±0.22 | 1.65±0.20 | 1.98±0.23 |
| Control |
2.54±0.19a |
2.88±0.29a |
2.49±0.22a |
| Experimental |
2.92±0.25a,b |
3.23±0.28a,b |
2.91±0.32a,b |
| F | 17.304 | 30.606 | 9.583 |
| P-value | 0.003 | 0.001 | 0.014 |
Discussion
The mechanism of DR is complicated, and it often
causes apoptosis of the retinal ganglion cells and damages the
nerve function during the disease progression. During the disease
development, hypoxia triggers the activation of oxidative stress to
further damage the nerve cells. In addition, hypoxia also triggers
neovascularization to cause retinal damage, and activates the
retinal mitochondrial pathway to induce cell apoptosis and further
damages the retina.
Long-term high blood glucose leads to imbalance
between pro-angiogenic factors (HIF-1α, VEGF and Ang-1) and
anti-angiogenic factors (TKLK and PEDF) (11,12). In
particular, the increased level of VEGF promotes the proliferation
of the retinal pigment epithelial cells, resulting in increased
vascular permeability and retinal exudation, hemorrhage as well as
edema (13,14). In this study, SY and CEPO were used
to treat DR rats. Results showed that expression levels of HIF-1α,
VEGF, and Ang-1 were significantly lower, while the levels of TKLK
and PEDF were significantly higher in the SY-treated control group
than in the model group (P<0.05), indicating that SY has a
certain regulatory effect on the generation of blood vessels. Song
et al (15) confirmed that SY
may alter the expression of VEGF and PDGF, regulating the process
of angiogenesis. There was no significant difference in the
expression levels of HIF-1α, VEGF, Ang-1, TKLK and PEDF between the
experimental group treated with CEPO and the model group,
indicating that CEPO did not affect the angiogenesis of the retina
during treatment, thus, resolving the disadvantages of EPO
(16).
Retinal hypoxia induces apoptosis by regulating the
expression of apoptosis-promoting factors (Bax and caspase-3) and
apoptosis-inhibiting factors Bcl-2 and survivin (17,18).
Wang et al (17) showed that
Bax may increase the release of cytochrome c from
mitochondria into cytoplasm and exert a pro-apoptotic effect. Bcl-2
antagonizes Bax by reducing cytochrome c release. In
addition, some studies have shown that caspase-3 is a key molecule
at the downstream of cytochrome c (19). Survivin inhibits cell apoptosis by
antagonizing the apoptosis cascade mediated by multiple caspase
molecules (18). Results of this
study showed that compared with the model group, the expression
levels of the apoptosis-promoting factors Bax and caspase-3 were
significantly decreased in the experimental and control groups than
in the model group, and were also significantly lower in the
experimental group than in the control group. The expression levels
of Bcl-2 and survivin were significantly higher in the experimental
and control groups than in the model group, and were also
significantly higher in the experimental group than in the control
group, indicating that both SY and CEPO may improve DR by
regulating the expression of apoptosis-related factors, and the
effects of CEPO are stronger than those of SY.
In addition, retinal hypoxia also triggers the
activation of the oxidative stress pathways to increase the levels
of oxygen-free radicals, which in turn, damages the nerve cells
(19). Nrf acts as a receptor for
oxidative stress and plays a major role in the defense against
oxidative stress. Nrf2 has 6 highly conserved domains that can
specifically recognize and bind to ARE to form Nrf-2/ARE
antioxidant pathway (20), and
activation of Nrf2 forms a positive feedback to enhance the
regulation of antioxidative stress (21). The binding of Nrf-2 to ARE can
activate HO-1 and NQO-1 to remove excess oxygen-free radicals, and
reduce stress injury (22). The
results of this study showed that the expression levels of
oxidative stress molecules were significantly higher in the
experimental and control groups than in the model group, indicating
that both SY and CEPO may improve the disease conditions by
regulating the oxidative stress pathway. The expression level of
each oxidative stress molecule in the experimental group was
significantly higher than that in the control group, indicating
that CEPO is more effective in scavenging oxygen-free radicals than
SY.
In conclusion, the therapeutic effect of CEPO in
treating DR is better than that of SY. CEPO may inhibit cell
apoptosis and oxidative stress damage in the retinal tissues of
diabetic rats without affecting angiogenesis.
Acknowledgements
Not applicable.
Funding
No funding was received.
Availability of data and materials
The datasets used and/or analyzed during the present
study are available from the corresponding author on reasonable
request.
Authors' contributions
XX drafted this manuscript and helped construction
of diabetes rat model. YC and YY performed RT-qPCR. All authors
read and approved the final study.
Ethics approval and consent to
participate
The study was approved by the Ethics Committee of
The Eye Hospital of Wenzhou Medical University (Wenzhou,
China).
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing
interests.
References
|
1
|
Alinia C, Mohammadi SF, Lashay A and
Rashidian A: Impact of diabetic retinopathy on health-related
quality of life in Iranian diabetics. Iran J Public Health.
46:55–65. 2017.PubMed/NCBI
|
|
2
|
Liu L, Wu X, Liu L, Geng J, Yuan Z, Shan Z
and Chen L: Prevalence of diabetic retinopathy in mainland China: A
meta-analysis. PLoS One. 7:e452642012. View Article : Google Scholar : PubMed/NCBI
|
|
3
|
Bunce C and Wormald R: Leading causes of
certification for blindness and partial sight in England &
Wales. BMC Public Health. 6:582006. View Article : Google Scholar : PubMed/NCBI
|
|
4
|
Behl T, Kaur I and Kotwani A: Implication
of oxidative stress in progression of diabetic retinopathy. Surv
Ophthalmol. 61:187–196. 2016. View Article : Google Scholar : PubMed/NCBI
|
|
5
|
Calderon GD, Juarez OH, Hernandez GE,
Punzo SM and De la Cruz ZD: Oxidative stress and diabetic
retinopathy: Development and treatment. Eye (Lond). 31:1122–1130.
2017. View Article : Google Scholar : PubMed/NCBI
|
|
6
|
Takahashi Y, Miyasaka N, Tasaka S, Miura
I, Urano S, Ikura M, Hikichi K, Matsumoto T and Wada M:
Constitution of two coloring matters in the flower petals of
Carthamus tinctorius L. Tetrahedron Lett. 23:5163–5166.
1982. View Article : Google Scholar
|
|
7
|
Gella L, Raman R, Kulothungan V, Pal
Saumya S, Ganesan S and Sharma T: Retinal sensitivity in subjects
with type 2 diabetes mellitus: Sankara Nethralaya Diabetic
Retinopathy Epidemiology and Molecular Genetics Study (SN-DREAMS
II, Report No. 4). Br J Ophthalmol. 100:808–813. 2016. View Article : Google Scholar : PubMed/NCBI
|
|
8
|
Farshchi A, Aghili R, Oskuee M, Rashed M,
Noshad S, Kebriaeezadeh A, Kia M and Esteghamati A: Biphasic
insulin Aspart 30 vs. NPH plus regular human insulin in type 2
diabetes patients; a cost-effectiveness study. BMC Endocr Disord.
16:352016. View Article : Google Scholar : PubMed/NCBI
|
|
9
|
Jo HR, Kim YS and Son H: Erythropoietin
and carbamylated erythropoietin promote histone deacetylase 5
phosphorylation and nuclear export in rat hippocampal neurons.
Biochem Biophys Res Commun. 470:220–225. 2016. View Article : Google Scholar : PubMed/NCBI
|
|
10
|
Ding J, Wang J, Li QY, Yu JZ, Ma CG, Wang
X, Lu CZ and Xiao BG: Neuroprotection and CD131/GDNF/AKT pathway of
carbamylated erythropoietin in hypoxic neurons. Mol Neurobiol.
54:5051–5060. 2017. View Article : Google Scholar : PubMed/NCBI
|
|
11
|
Coucha M, Elshaer SL, Eldahshan WS, Mysona
BA and El-Remessy AB: Molecular mechanisms of diabetic retinopathy:
Potential therapeutic targets. Middle East Afr J Ophthalmol.
22:135–144. 2015. View Article : Google Scholar : PubMed/NCBI
|
|
12
|
Hampton BM, Schwartz SG, Brantley MA Jr
and Flynn HW Jr: Update on genetics and diabetic retinopathy. Clin
Ophthalmol. 9:2175–2193. 2015.PubMed/NCBI
|
|
13
|
Liew G, Klein R and Wong TY: The role of
genetics in susceptibility to diabetic retinopathy. Int Ophthalmol
Clin. 49:35–52. 2009. View Article : Google Scholar : PubMed/NCBI
|
|
14
|
Hollborn M, Vogler S, Reichenbach A,
Wiedemann P, Bringmann A and Kohen L: Regulation of the
hyperosmotic induction of aquaporin 5 and VEGF in retinal pigment
epithelial cells: involvement of NFAT5. Mol Vis. 21:360–377.
2015.PubMed/NCBI
|
|
15
|
Song Y, Long L, Zhang N and Liu Y:
Inhibitory effects of hydroxysafflor yellow A on PDGF BB induced
proliferation and migration of vascular smooth muscle cells via
mediating Akt signaling. Mol Med Rep. 10:1555–1560. 2014.
View Article : Google Scholar : PubMed/NCBI
|
|
16
|
Li D, Deng L, Xie X, Yang Z and Kang P:
Evaluation of the osteogenesis and angiogenesis effects of
erythropoietin and the efficacy of deproteinized bovine
bone/recombinant human erythropoietin scaffold on bone defect
repair. J Mater Sci Mater Med. 27:1012016. View Article : Google Scholar : PubMed/NCBI
|
|
17
|
Wang XL, Yu T, Yan QC, Wang W, Meng N, Li
XJ and Luo YH: AGEs promote oxidative stress and induce apoptosis
in retinal pigmented epithelium cells RAGE-dependently. J Mol
Neurosci. 56:449–460. 2015. View Article : Google Scholar : PubMed/NCBI
|
|
18
|
Liu N, Zhao N, Chen L and Cai N: Survivin
contributes to the progression of diabetic retinopathy through
HIF-1α pathway. Int J Clin Exp Pathol. 8:9161–9167. 2015.PubMed/NCBI
|
|
19
|
Olivares-Gonzalez L, de la Camara
Martinez-Fernandez C, Hervas D, Marin MP, Lahoz A, Millan JM and
Rodrigo R: cGMP-phosphodiesterase inhibition prevents
hypoxia-induced cell death activation in porcine retinal explants.
PLoS One. 11:e01667172016. View Article : Google Scholar : PubMed/NCBI
|
|
20
|
Lu MC, Ji JA, Jiang ZY and You QD: The
keap1-Nrf2-ARE pathway as a potential preventive and therapeutic
target: An Update. Med Res Rev. 36:924–963. 2016. View Article : Google Scholar : PubMed/NCBI
|
|
21
|
Stewart D, Killeen E, Naquin R, Alam S and
Alam J: Degradation of transcription factor Nrf2 via the
ubiquitin-proteasome pathway and stabilization by cadmium. J Biol
Chem. 278:2396–2402. 2003. View Article : Google Scholar : PubMed/NCBI
|
|
22
|
Park SY, Kim YH and Park G: Cucurbitacins
attenuate microglial activation and protect from neuroinflammatory
injury through Nrf2/ARE activation and STAT/NF-κB inhibition.
Neurosci Lett. 609:129–136. 2015. View Article : Google Scholar : PubMed/NCBI
|
