Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
September-2018 Volume 16 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2018 Volume 16 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Impact of G-CSF on expressions of Egr-1 and VEGF in acute ischemic cerebral injury

  • Authors:
    • Dian-Gui Zhou
    • Yang-Hong Shi
    • You-Qiang Cui
  • View Affiliations / Copyright

    Affiliations: Department of Neurology, Zhongshan Torch Development Zone Hospital, Zhongshan, Guangdong 528437, P.R. China, Department II of Neurology, The First Hospital of Yulin, Yulin, Shaanxi 719000, P.R. China, Department of Neurosurgery, Qianfoshan Hospital Affiliated to Shandong University, Jinan, Shandong 250014, P.R. China
    Copyright: © Zhou et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 2313-2318
    |
    Published online on: July 19, 2018
       https://doi.org/10.3892/etm.2018.6486
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The aim of the present study was to investigate the protective effect of granulocyte colony-stimulating factor (G-CSF) on acute ischemic cerebral injury, and its mechanism through the impact of G-CSF on early growth response-1 (Egr-1) and vascular endothelial growth factor (VEGF) expressions. Male Sprague-Dawley (SD) rats were divided them into three groups, i.e., the sham, model and G-CSF groups to measure the effect of G-CSF on the volume of cerebral infarction and level of lactate dehydrogenase (LDH) in rats. Hematoxylin and eosin (H&E) staining method was performed for histopathological examination. Reverse transcription‑polymerase chain reaction (RT-PCR) and western blot analysis were used to detect the mRNA and protein expressions of Egr-1 and VEGF in different groups. Furthermore, Statistical Product and Service Solutions (SPSS) 17.0 software was applied to detect the differences in the expression of Egr-1 and VEGF between the two groups. Compared with the sham group, we found that the volume of cerebral infarction and LDH content in the model group were significantly elevated. By contrast, in the model group, those indicators in the G-CSF group were obviously decreased. H&E staining results also showed that G-CSF could decrease the necrotic area in cerebral infarction and the incidence of inflammation, and sustain the integrity of the molecular structure. Immunofluorescence staining results revealed that the protein expressions of Egr-1 and VEGF in the model group were all significantly decreased, while those in the G-CSF group were remarkably elevated. RT-PCR and western blot analysis revealed that the mRNA and protein expressions of Egr-1 and VEGF in the model group were decreased obviously, but those in the G-CSF group were elevated significantly, and the differences between the two groups showed statistical significance (p<0.05). G-CSF manifests a significant protective effect on the acute ischemic cerebral injury, which may be realized through its effect on the expressions of Egr-1 and VEGF.

Introduction

In recent years, acute ischemic cerebral injury has become a kind of disease with an extremely high incidence rate and poor prognosis, and for some severe conditions, it can even be life-threatening (1). Generally, it is originated from the cerebral thrombosis and embolism, and, after onset of ischemia, timely recovery of blood supply is critical to the reduction of apoptosis in neurons and repair of neurological functions. Ischemic angiogenesis is closely related to the progression and outcome of cerebrovascular diseases. However, current treatment method for acute ischemic cerebral injury requires further research and development (2–4).

Granulocyte colony-stimulating factor (G-CSF), as a member of hematopoietic growth factor family, can promote the proliferation, differentiation and survival of hematopoietic stem cells with the obvious protective effect on neurons in peripheral and central nerve system (5). In the present study, we aimed to establish the models of acute ischemic cerebral injury in rats to investigate the changes in early growth response-1 (Egr-1) and vascular endothelial growth factor (VEGF) in cerebral tissues after intervention with G-CSF, thereby exploring the potential mechanism of G-CSF in protecting nerves, and providing new pathways for clinical treatment of acute ischemic cerebral injury.

Materials and methods

Materials
Experiment animals and grouping

After Sprague-Dawley (SD) rats (180–220 g) were acclimatized to the environment, they were randomly divided into the sham group (n=10), the model group (n=10) and the G-CSF group (100 µg/kg, n=10). G-CSF was given through neck subcutaneous injection once per day for 7 consecutive days. Subsequently, access of food to rats was forbidden for 12 h but they had free access to water. The rats were kept in cage with controlled temperature and light cycles (24°C and 12/12 light cycles). Longas method was applied to establish the middle cerebral artery occlusion models in rats. The humidity was 60±10%. The study was approved by the Ethics Committee of Zhongshan Torch Development Zone Hospital (Zhongshan, China).

Major reagents

TRIzol extraction kit for total RNA (Tiangen, Co., Ltd., Beijing, China); real-time polymerase chain reaction (RT-PCR) kit for reverse transcription (Tiangen); bicinchoninic acid (BCA) kit for protein quantification (Beyotime Institute of Biotechnology, Shanghai, China); extraction kit for total protein (Nanjing KeyGen Biotech, Co., Ltd., Nanjing, China); immunopreticipation (IP) lysis kit (Beyotime Institute of Biotechnology); lactate dehydrogenase (LDH) kit (Nanjing Jiancheng Biotech Co., Ltd., Nanjing, China); primary anti-glyceraldehyde-phosphate dehydrogenase (GAPDH), Egr-1 monoclonal antibodies and the relevant secondary antibodies (Cell Signaling Technology, Boston, MA, USA) and VEGF monoclonal antibody (ProteinTech Group, Inc., Wuhan, China) were used in the present study.

Experiment methods
Measurement of the volume of cerebral infarction and relevant indicators

After rats in each group were anesthetized, they were immediately sacrificed and brain tissue was removed. Samples were then stained for 30 min at 37°C in the dark in 1% triphenyltetrazolium chloride (TTC), and then fixed in 10% formaldehyde. The infarction area in each layer was then calculated, and LDH content in brain tissues in the three groups was assayed in accordance with the LDH kit.

Histopathological examination

Brain tissues in each group were embedded in paraffin to prepare the paraffin samples which were later sliced into sections of 5 µm. After hematoxylin and eosin (H&E) staining, the sections were placed under a microscope (×100) (Roche Diagnostics, Basel, Switzerland) for histopathological observation.

Immunofluorescence analysis

Paraffin sections of brain tissues were collected from each group, and, after dewaxing with xylene and dehydration using alcohol of gradient concentration, the antigen retrieval was carried out. Sections were then rinsed with 0.01 M phosphate-buffered saline (PBS, pH 7.4) 3 times (5 min/time), and blocked in a wet box containing 10% bull serum albumin (BSA) for 30 min. Subsequently, on sections, fluorescence-labeled antibodies that were diluted appropriately (1:70) were placed in the wet box and the sections were then incubated at 4°C overnight. After sections were rinsed with PBS (pH 7.4) 3 times, fluorescent secondary antibodies (1:100) were added onto the sections in the dark, and placed in the wet box for incubation for 2 h at 37°C. The sections were then observed and photographed under the fluorescent microscopes (Olympus Corporation, Tokyo, Japan).

RT-PCR analysis

Brain tissues that were collected from each group were rapidly transferred to the Eppendorf (EP) tubes containing RNAiso Plus extraction solution and placed at room temperature for 5 min for sufficient lysis. After centrifugation at 12,000 × g and 4°C for 5 min, the supernatant was well mixed with 0.2 ml chloroform and placed at room temperature for 5 min. The solution was centrifuged again at 12,000 × g and 4°C for 15 min, and, isopropanol of the same volume was added and well mixed to the supernatant. After being placed at room temperature for 10 min, it was centrifuged at 12,000 × g and 4°C for 10 min, and sediment was preserved while the supernatant was discarded. In the sediment, 1 ml 75% alcohol was added and mixed well followed by centrifugation at 12,000 × g and 4°C for 5 min, which was repeated once after the supernatant was then removed. After RNA sediment was fully removed through rinsing, the liquid was replaced with RNase-free water. Some of the total RNA solution was extracted and diluted with RNase-free water to a concentration of 1 µg/µl. In accordance with the requirement of the PrimeScript® RT reagent kit with gDNA Eraser, reaction solution for reverse transcription was prepared, and cDNA was obtained through reverse transcription with the RNA samples and preserved at −20°C. Thereafter, according to the instruction of SYBR® Premix Ex Taq™ II (Tli RNaseH Plus), we detected the level of mRNA expression. The relevant RNA primer sequences used in this procedure are shown in Table I.

Table I.

Primer sequences of relevant genes in RT-PCR analysis.

Table I.

Primer sequences of relevant genes in RT-PCR analysis.

Gene namePrimer sequence
Egr-15′-3′ TCGGCTCCTTTCCTCACTCA
3′-5′ CTCATAGGGTTGTTCGCTCGG
VEGF5′-3′ ATGGCAGAAGGAGGAGGG
3′-5′ CGAAACGCTGAGGGAGGCT
β-actin5′-3′ GAGCCGGGAAATCGTGCGT
3′-5′ GGAAGGAAGGCTGGAAGATG
Western blotting assay

Brain tissues collected from all the groups were rinsed with icy normal saline followed by measurement of protein concentration with BCA kit and preservation at −80°C for later use. According to the instructions of total protein extraction kit, the IP lysis buffer supplemented with phenylmethanesulfonyl fluoride (PMSF) and protease inhibitor was added in the tissues which were later ground on ice. Tissue samples were then centrifuged at 4°C and 12,000 × g for 10 min of homogenization, and the supernatant was taken for centrifugation at 4°C and 12,000 × g for 20 min. With the supernatant, protein samples containing the same content of total protein, after protein quantification according to the relevant kit instruction, were loaded in the sampling holes for electrophoresis under a constant voltage of 220 V. Electrophoresis was stopped until the bromophenol blue reached the bottom of gel. Based on the molecular weight of targeting proteins, gel was trimmed and placed in the transfer buffer. Polyvinylidene fluoride (PVDF) membrane was also trimmed in accordance with the size of the gel, and then soaked in methanol for 10 sec. The PVDF membrane and filter paper were placed in the transfer buffer, and later, those materials were all placed in the transfer machine in the following sequence: positive electrode, filter paper, PVDF membrane, gel, filter paper and negative electrode. Membrane transfer was then carried out under a constant voltage of 110 V for appropriate time until the protein on the gel was transferred on the PVDF membrane. Thereafter, PVDF membrane with protein was blocked in 5% skimmed milk on a shaker for 3 h, and the rabbit anti-rat Egr-1, and GAPDH monoclonal antibodies (1:1,000; cat. nos. 4154 and 2118), rabbit anti-rat VEGF monoclonal antibody (1:1,000; cat. no. 19003-1-AP) was added on the membrane for incubation at 4°C overnight. The next day, membrane was sufficiently washed by Tween-20 + Tris-buffer saline (TTBS) 3 times (10 min/time), and then incubated with goat anti-rabbit secondary polyclonal antibody (1:2,000; cat. no. 7074) for 1 h at room temperature. Enhanced chemiluminescence (ECL) reagent was added for color development and photographing after the membrane was washed with TTBS 3 times (10 min/time).

Statistical analysis

Statistical Product and Service Solutions (SPSS) 17.0 software (SPSS, Inc., Chicago, IL, USA) was applied in statistical analysis, and experiment data were presented as mean ± standard deviation (SD). Data analysis was carried out through analysis of variance and the post hoc test was LSD test for multiple comparisons or t-test for intergroup comparisons. P<0.05 suggested that the difference had statistical significance.

Results

Effect of G-CSF on the volume of cerebral infarction and LDH content in brain tissues in rats

As shown in Fig. 1 in comparison with the sham group, the volume of cerebral infarction in rats of the model group was significantly enlarged. By contrast, compared with the model group, a significant decrease was identified in the volume of cerebral infarction in rats of the G-CSF group. In addition, G-CSF could reduce the level of LDH in brain tissues significantly.

Figure 1.

Effect of G-CSF on the volume of cerebral infarction and LDH content in brain tissues in rats. In comparison with the sham group, the volume of cerebral infarction in rats of the model group is significantly enlarged (##P<0.01). By contrast, compared with the model group, a significant decrease is identified in the volume of cerebral infarction in rats of the G-CSF group (**P<0.01).

Effect of G-CSF on the histopathological examination of rats with acute ischemic cerebral injury

The H&E staining results of histopathological examination of brain tissues are shown in Fig. 2. In the sham group, the brain structure of rats appeared to be integral, while rats in the model group manifested massive necrotic cells, and destructed molecular structures. Compared with the model group, we found that the necrotic area was reduced in the G-CSF group, suggesting the cerebral injury was ameliorated.

Figure 2.

H&E staining results of the effect of G-CSF on MCAO rats (magnification, ×100).

Immunofluorescent staining results of Egr-1 and VEGF

The immunofluorescence analysis revealed that compared with the sham group, the protein expressions of Egr-1 and VEGF in brain tissues of rats in the model group were reduced significantly, while those in the G-CSF group were increased evidently (P<0.01) (Fig. 3).

Figure 3.

Immunofluorescence staining results of the effect of G-CSF on the expressions of Egr-1 and VEGF of MCAO rats (magnification, ×100).

RT-PCR results of the effect of G-CSF on mRNA expression of Egr-1 and VEGF in MCAO rats

As shown in Fig. 4, the RT-PCR results revealed that compared with the sham group, the mRNA expressions of Egr-1 and VEGF in brain tissues of rats in the model group were reduced significantly. By contrast, in comparison with the model group, the mRNA expression of Egr-1 and VEGF was increased significantly in brain tissues of rats in the G-CSF group.

Figure 4.

RT-PCR results of the effect of G-CSF on mRNA expression of Egr-1 and VEGF in MCAO rats. Compared with the sham group, the mRNA expression of Egr-1 and VEGF in brain tissues of rats in the model group are significantly reduced (##P<0.01). Compared with the model group, the mRNA expression of Egr-1 and VEGF are increased significantly in brain tissues of rats in the G-CSF group (**P<0.01).

Western blot analysis results of the effect of G-CSF on the protein expression of Egr-1 and VEGF in MCAO rats

In Fig. 5, the western blot analysis revealed that in comparison with the sham group, protein expression of Egr-1 and VEGF in the brain tissues of rats in the model group was significantly reduced. Compared with the model group, the protein expression of Egr-1 and VEGF in brain tissues of rats in the G-CSF group was significantly elevated. This result confirmed that G-CSF can ameliorate the acute ischemic cerebral injury by regulating the expressions of Egr-1 and VEGF.

Figure 5.

Western blot analysis results of the effect of G-CSF on the protein expression of Egr-1 and VEGF in MCAO rats. In comparison with the sham group, the protein expression of Egr-1 and VEGF in the brain tissues of rats in the model group are significantly reduced (##P<0.01). Compared with the model group, the protein expression of Egr-1 and VEGF in brain tissues of rats in the G-CSF group are significantly elevated (**P<0.01).

Discussion

Acute ischemic cerebral injury has gradually become a global killer with characteristics including high incidence rate, high mortality rate and high morbidity rate (6,7). Cerebral ischemia can damage the brain cells, and once the blood perfusion is recovered, ischemic injury is further aggravated, known as cerebral ischemia-reperfusion injury (8–10). Pathogenesis leading to acute ischemic cerebral injury remains elusive, which makes the search for effective, reliable and feasible treatment methods for this disease more urgent. In recent years, G-CSF has gained more and more attention of researchers for its special effect (11).

G-CSF, as a kind of cytokine in hematopoietic stem cells, can promote the survival, proliferation and maturity of neutrophilic cell lines. G-CSF exists mostly in the bone marrow stem cell of patients (12–14). Previous findings have shown that G-CSF has a promising protective effect on nerves, and it can promote angiogenesis and exert an anti-inflammatory effect by regulating varying molecular mechanisms, such as mobilizing the generation of hematopoietic stem cells, inhibiting their apoptosis, facilitating the differentiation of neurons and antagonizing the inflammatory responses (15–18). Previous findings have shown that Egr-1 and VEGF have key roles in the regulation of growth and development of vessels, and are also critical to ischemic diseases. Additionally, they can facilitate the migration of hematopoietic stem cells with protective effects on nerves (19,20).

In this study, male SD rats used as subjects, were divided the sham, model and G-CSF groups to measure the effect of G-CSF on the volume of cerebral infarction and level of LDH in rats. The H&E staining method was performed for histopathological examination. Through RT-PCR and western blot analysis, we detected the mRNA and protein expressions of Egr-1 and VEGF in different groups. Furthermore, SPSS 17.0 software was applied to detect the differences in expression of Egr-1 and VEGF between the two groups. Results showed that compared with the sham group, the volume of cerebral infarction and LDH content in the model group were significantly elevated, whereas in the model group, those indicators in the G-CSF group were obviously decreased. H&E staining results also showed that G-CSF could decrease the necrotic area in cerebral infarction and the incidence of inflammation, and sustain the integrity of molecular structure. Immunofluorescence staining results revealed that the protein expression of Egr-1 and VEGF in the model group were all significantly decreased, while those in the G-CSF group were significantly elevated. RT-PCR and western blot analysis revealed that the mRNA and protein expression of Egr-1 and VEGF in the model group was decreased obviously, but those in the G-CSF group were elevated significantly.

Taken together, G-CSF manifests a significant protective effect on acute ischemic cerebral injury, which is generated through its impact on the expression of Egr-1 and VEGF. The results of this study are expected to provide new therapeutic procedures for treatment of acute ischemic cerebral injury, and other effects of G-CSF on acute ischemic cerebral injury require more in-depth studies.

Acknowledgements

Not applicable.

Funding

No funding was received.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

DGZ measured the volume of cerebral infarction and relevant indicators. YHS helped with histopathological examination. DGZ and YQC were reponsible for immunofluorescence, analysis and PCR. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The study was approved by the Ethics Committee of Zhongshan Torch Development Zone Hospital (Zhongshan, China).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Du H, Naqvi H and Taylor HS: Ischemia/reperfusion injury promotes and granulocyte-colony stimulating factor inhibits migration of bone marrow-derived stem cells to endometrium. Stem Cells Dev. 21:3324–3331. 2012. View Article : Google Scholar : PubMed/NCBI

2 

Fan L, Chen L, Chen X and Fu F: A meta-analysis of stem cell mobilization by granulocyte colony-stimulating factor in the treatment of acute myocardial infarction. Cardiovasc Drugs Ther. 22:45–54. 2008. View Article : Google Scholar : PubMed/NCBI

3 

Dai W, Hale SL, Martin BJ, Kuang JQ, Dow JS, Wold LE and Kloner RA: Allogeneic mesenchymal stem cell transplantation in postinfarcted rat myocardium: Short- and long-term effects. Circulation. 112:214–223. 2005. View Article : Google Scholar : PubMed/NCBI

4 

Fuchs S, Baffour R, Zhou YF, Shou M, Pierre A, Tio FO, Weissman NJ, Leon MB, Epstein SE and Kornowski R: Transendocardial delivery of autologous bone marrow enhances collateral perfusion and regional function in pigs with chronic experimental myocardial ischemia. J Am Coll Cardiol. 37:1726–1732. 2001. View Article : Google Scholar : PubMed/NCBI

5 

Schneider A, Krüger C, Steigleder T, Weber D, Pitzer C, Laage R, Aronowski J, Maurer MH, Gassler N, Mier W, et al: The hematopoietic factor G-CSF is a neuronal ligand that counteracts programmed cell death and drives neurogenesis. J Clin Invest. 115:2083–2098. 2005. View Article : Google Scholar : PubMed/NCBI

6 

Schäbitz WR, Kollmar R, Schwaninger M, Juettler E, Bardutzky J, Schölzke MN, Sommer C and Schwab S: Neuroprotective effect of granulocyte colony-stimulating factor after focal cerebral ischemia. Stroke. 34:745–751. 2003. View Article : Google Scholar : PubMed/NCBI

7 

Kawamoto A, Gwon HC, Iwaguro H, Yamaguchi JI, Uchida S, Masuda H, Silver M, Ma H, Kearney M, Isner JM, et al: Therapeutic potential of ex vivo expanded endothelial progenitor cells for myocardial ischemia. Circulation. 103:634–637. 2001. View Article : Google Scholar : PubMed/NCBI

8 

Murry CE, Soonpaa MH, Reinecke H, Nakajima H, Nakajima HO, Rubart M, Pasumarthi KBS, Virag JI, Bartelmez SH, Poppa V, et al: Haematopoietic stem cells do not transdifferentiate into cardiac myocytes in myocardial infarcts. Nature. 428:664–668. 2004. View Article : Google Scholar : PubMed/NCBI

9 

Olivetti G, Capasso JM, Meggs LG, Sonnenblick EH and Anversa P: Cellular basis of chronic ventricular remodeling after myocardial infarction in rats. Circ Res. 68:856–869. 1991. View Article : Google Scholar : PubMed/NCBI

10 

Park KI, Hack MA, Ourednik J, Yandava B, Flax JD, Stieg PE, Gullans S, Jensen FE, Sidman RL, Ourednik V, et al: Acute injury directs the migration, proliferation, and differentiation of solid organ stem cells: Evidence from the effect of hypoxia-ischemia in the CNS on clonal ‘reporter’ neural stem cells. Exp Neurol. 199:156–178. 2006. View Article : Google Scholar : PubMed/NCBI

11 

Pastuszko P1, Liu H, Mendoza-Paredes A, Schultz SE, Markowitz SD, Greeley WJ, Wilson DF and Pastuszko A: Regulatory pathways to neuronal injury or survival are dependent on the rate of low flow cardiopulmonary bypass following circulatory arrest in newborn piglets. Eur J Cardiothorac Surg. 31:899–905. 2007. View Article : Google Scholar : PubMed/NCBI

12 

Rosenstrauch D, Poglajen G, Zidar N and Gregoric ID: Stem celltherapy for ischemic heart failure. Tex Heart Inst J. 32:339–347. 2005.PubMed/NCBI

13 

Tang YL, Zhao Q, Qin X, Shen L, Cheng L, Ge J and Phillips MI: Paracrine action enhances the effects of autologous mesenchymal stem cell transplantation on vascular regeneration in rat model of myocardial infarction. Ann Thorac Surg. 80:229–236, discussion 236–237. 2005. View Article : Google Scholar : PubMed/NCBI

14 

Xiao BG, Lu CZ and Link H: Cell biology and clinical promise of G-CSF: Immunomodulation and neuroprotection. J Cell Mol Med. 11:1272–1290. 2007. View Article : Google Scholar : PubMed/NCBI

15 

Pastuszko P, Schears GJ, Pirzadeh A, Greeley WJ, Wilson DF and Pastuszko A: Effect of granulocyte colony stimulating factor (G-CSF) on expression of select proteins involved in apoptosis in a neonatal piglet brain following cardiopulmonary bypass (CPB) and deep hypothermic circulatory arrest (DHCA). J Thorac Cardiovasc Surg. 143:1436–1442. 2012. View Article : Google Scholar : PubMed/NCBI

16 

Gibson CL, Bath PM and Murphy SP: G-CSF reduces infarct volume and improves functional outcome after transient focal cerebral ischemia in mice. J Cereb Blood Flow Metab. 25:431–439. 2005. View Article : Google Scholar : PubMed/NCBI

17 

Lee ST, Chu K, Jung KH, Ko SY, Kim EH, Sinn DI, Lee YS, Lo EH, Kim M and Roh JK: Granulocyte colony-stimulating factor enhances angiogenesis after focal cerebral ischemia. Brain Res. 1058:120–128. 2005. View Article : Google Scholar : PubMed/NCBI

18 

Tang YL, Zhao Q, Zhang YC, Cheng L, Liu M, Shi J, Yang YZ, Pan C, Ge J and Phillips MI: Autologous mesenchymal stem cell transplantation induce VEGF and neovascularization in ischemic myocardium. Regul Pept. 117:3–10. 2004. View Article : Google Scholar : PubMed/NCBI

19 

Cheng Z, Liu X, Ou L, Zhou X, Liu Y, Jia X, Zhang J, Li Y and Kong D: Mobilization of mesenchymal stem cells by granulocyte colony-stimulating factor in rats with acute myocardial infarction. Cardiovasc Drugs Ther. 22:363–371. 2008. View Article : Google Scholar : PubMed/NCBI

20 

Su H, Lu R and Kan YW: Adeno-associated viral vector-mediated vascular endothelial growth factor gene transfer induces neovascular formation in ischemic heart. Proc Natl Acad Sci USA. 97:13801–13806. 2000. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhou D, Shi Y and Cui Y: Impact of G-CSF on expressions of Egr-1 and VEGF in acute ischemic cerebral injury. Exp Ther Med 16: 2313-2318, 2018.
APA
Zhou, D., Shi, Y., & Cui, Y. (2018). Impact of G-CSF on expressions of Egr-1 and VEGF in acute ischemic cerebral injury. Experimental and Therapeutic Medicine, 16, 2313-2318. https://doi.org/10.3892/etm.2018.6486
MLA
Zhou, D., Shi, Y., Cui, Y."Impact of G-CSF on expressions of Egr-1 and VEGF in acute ischemic cerebral injury". Experimental and Therapeutic Medicine 16.3 (2018): 2313-2318.
Chicago
Zhou, D., Shi, Y., Cui, Y."Impact of G-CSF on expressions of Egr-1 and VEGF in acute ischemic cerebral injury". Experimental and Therapeutic Medicine 16, no. 3 (2018): 2313-2318. https://doi.org/10.3892/etm.2018.6486
Copy and paste a formatted citation
x
Spandidos Publications style
Zhou D, Shi Y and Cui Y: Impact of G-CSF on expressions of Egr-1 and VEGF in acute ischemic cerebral injury. Exp Ther Med 16: 2313-2318, 2018.
APA
Zhou, D., Shi, Y., & Cui, Y. (2018). Impact of G-CSF on expressions of Egr-1 and VEGF in acute ischemic cerebral injury. Experimental and Therapeutic Medicine, 16, 2313-2318. https://doi.org/10.3892/etm.2018.6486
MLA
Zhou, D., Shi, Y., Cui, Y."Impact of G-CSF on expressions of Egr-1 and VEGF in acute ischemic cerebral injury". Experimental and Therapeutic Medicine 16.3 (2018): 2313-2318.
Chicago
Zhou, D., Shi, Y., Cui, Y."Impact of G-CSF on expressions of Egr-1 and VEGF in acute ischemic cerebral injury". Experimental and Therapeutic Medicine 16, no. 3 (2018): 2313-2318. https://doi.org/10.3892/etm.2018.6486
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team