Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
April-2019 Volume 17 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2019 Volume 17 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Injured pancreatic β cells enhance the release of miR‑375‑3p into the extracellular space

  • Authors:
    • Mitsuru Chiba
    • Ikumi Niiyama
    • Haruka Uehara
    • Haruka Kuwata
  • View Affiliations / Copyright

    Affiliations: Department of Bioscience and Laboratory Medicine, Graduate School of Health Sciences, Hirosaki University, Hirosaki, Aomori 036‑8564, Japan, Department of Medical Technology, School of Health Sciences, Hirosaki University, Hirosaki, Aomori 036‑8564, Japan
  • Pages: 2815-2820
    |
    Published online on: February 13, 2019
       https://doi.org/10.3892/etm.2019.7276
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

miR-375-3p is a highly expressed microRNA in pancreatic β cells. We have previously reported that when mice were exposed to 7 Gy X‑ray irradiation, miR‑375‑3p was increased in the serum and there was cytotoxicity in pancreatic β cells. However, it was unknown whether miR‑375‑3p is then released from injured pancreatic β cells to the extracellular space. The present study investigated the effect of ionizing radiation and streptozotocin (STZ) treatment on the expression of extracellular miR‑375‑3p into culture supernatants using the rat pancreatic β cell line RIN‑5F. Cell growth was reduced, and cell death was increased at 24 h following exposure to 7 Gy irradiation as well as 24 h following treatment with 30 mM STZ compared with the control. Expression levels of miR‑375‑3p were significantly increased 24 h after 30 mM STZ treatment, yet this was only observed at 48 h following exposure to 7 Gy compared with the control. This suggests that the mechanism of cell death in RIN‑5F is different between 7 Gy irradiation and 30 mM STZ treatment. The results of the present study suggest that injured pancreatic β cells enhance the release of miR‑375‑3p from cells into extracellular space.

Introduction

MicroRNAs (miRNAs) are small (18–25 nucleotides) non-coding RNA harboring a post-transcriptional gene regulatory function (1). Currently, miRNAs have been detected in various body fluids, including serum (2), plasma (3), urine (4), cerebrospinal fluid (5), breast milk (6), saliva (7), bronchoalveolar lavage fluid (8), ascites (9), and pleural effusion (10). Noteworthy, miRNAs are stable under non-physiological conditions, whether in body fluids or culture media. Taylor et al (11) reported that plasma miR-21 is stable for at least 28 days at −30°C. We have reported that extracellular small RNAs are stable for 4 weeks at room temperature, after 20 freeze-thaw cycles and exposure to pH 2.0, and are resistant to ribonuclease A degradation (12). In body fluids, miRNAs are present in extracellular vesicles (EVs) (13) or high-density lipoproteins (14) and bind RNA-binding proteins (15). They are proposed to become novel biomarkers of disorders including some cancers and neurodegenerative diseases.

miR-375-3p is expressed in pancreatic β cells (16), where this miRNA is involved in pancreatic development, β cell proliferation, and insulin secretion via gene regulation (17). Overexpression of miR-375-3p suppresses insulin secretion (18), whereas inhibition of endogenous miR-375-3p increases insulin secretion (19). Streptozotocin (STZ) is a nitrosourea alkylating agent that induces tumor shrinkage and hypoglycemia and causes the selective destruction of pancreatic β cells via a glucose transporter 2 (20). Therefore, STZ have been used as a therapeutic drug for the treatment of neuroendocrine tumors in Japan (21). In mice and rats, the administration of STZ induces diabetes after pancreatic β cells are injured (22,23). Erener et al (24) reported that blood miR-375-3p increased in STZ-treated mice.

We have previously shown that mice irradiated with a lethal X-ray dose of 7 Gy present a significant serum increase of miR-375-3p at 72 h after exposure (2). Since miR-375-3p is expressed the highest in the pancreas among 20 types of cells and organs examined, it was inferred that it derived from the pancreas. This research suggested that radiation-induced death of pancreatic β cells is associated with the release of EVs containing miR-375-3p. Although miR-375-3p is expected to be released from injured pancreatic β cells, no evidence has been obtained. Therefore, it is necessary to investigate whether miR-375-3p is released from cells by STZ treatment and 7 Gy X-ray irradiation, which is a different mechanism to injure pancreatic β-cells. In this study, we investigate the expression level of extracellular miR-375-3p released from an insulinoma cell line exposed to 7 Gy X-ray irradiation or STZ treatment.

Materials and methods

Cell line and culture

The rat pancreatic β cell line (RIN-5F) was purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). RIN-5F cells were cultured in RPMI-1640 medium (Wako, Tokyo, Japan) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific, Inc., Waltham, MA, USA), 100 U/ml of penicillin, and 100 µg/ml of streptomycin (Wako). Cells were cultured at 37°C in a humidified atmosphere with 5% CO2.

X-ray irradiation

RIN-5F cells were exposed to X-rays (MBR-1520R-3 X-ray machine, Hitachi Medical Corporation, Tokyo, Japan) at a dose rate of 1.0 Gy/min (150 kVp, 20 mA, 0.5-mm aluminum, and 0.3-mm copper filters).

STZ treatment

STZ and Dulbecco's phosphate-buffered saline [D-PBS(−), pH 7.2] were purchased from Wako. STZ was diluted in D-PBS(−).

RNA extraction

Total RNAs from RIN-5F cells were extracted using Isogen II reagents (Nippongene, Tokyo, Japan) according to the manufacturer's instruction. Cell culture medium samples were centrifuged at 300 × g at 4°C for 3 min and floating cells removed. Total RNAs from 200 µl culture supernatants added to 5 µl cel-miR-39 (1 nM) were extracted using Isogen II reagents and ethachinmate (Nippongene).

Reverse transcription quantitative polymerase chain reaction (RT-qPCR)

The expression of rat insulin 1 (Ins 1) and β actin (Actb) mRNAs in RIN-5F cells were determined by RT-qPCR. Briefly, total RNAs were isolated from RIN-5F cells. cDNA was synthesized from total RNA using the Applied Biosystems™ High Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific, Inc.), according to the manufacturer's instructions. qPCR was performed using a FastStart Universal SYBR Green Master (Roche Diagnostics, Basel, Switzerland), 10 µM of forward and reverse primer pairs (Table I), and the StepOne Plus Real-time PCR system (Thermo Fisher Scientific, Inc.) in the following conditions: 10 min at 95°C, followed by 40 cycles each of 95°C for 15 sec, and 60°C for 60 sec. Actb was used as internal control. The PCR products were separated by electrophoresis on 4% agarose gel and detected by ethidium bromide staining.

Table I.

Primers for reverse transcription-polymerase chain reaction.

Table I.

Primers for reverse transcription-polymerase chain reaction.

Primer nameAccession no.Sequence (5′-3′)Size (nt)Amplicon size (bp)
Ins1 forward primerNM_019129.3 TCATAGACCATCAGCAAGCAG2195
Ins1 reverse primer CTTGGGCTCCCAGAGGAC18
Actb forward primerNM_031144.3 CCCGCGAGTACAACCTTCT1972
Actb reverse primer CGTCATCCATGGCGAACT18

RT-qPCR was used to determine the expression levels of miR-375-3p in culture supernatants. The cDNAs were synthesized using the TaqMan™ miRNA RT kit and the prescribed 5 × RT primer (both from Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. qPCR for miRNAs was performed using a FastStart TaqMan probe master (Roche Diagnostics), a 20 × probe, and the StepOne Plus Real-Time PCR system (Thermo Fisher Scientific, Inc.) under the following conditions: 10 min at 95°C, followed by 45 cycles at 95°C for 15 sec, and 60°C for 60 sec. Cel-miR-39 was used as an external control. The comparative Ct method was used to determine expression levels.

Immunofluorescence staining

Immunofluorescence staining was performed for detection of insulin in RIN-5F cells. RIN-5F cells were plated in 8-well chamber slides at a density of 2×104 cells per well in culture media. After 48 h, the cells were washed three times with D-PBS(−) and treated with 0.2% Triton X-100 in D-PBS(−) at room temperature for 5 min. After washing three times in D-PBS(−), the cells were incubated in an Image-iT FX signal enhancer solution (Thermo Fisher Scientific, Inc.) at room temperature for 30 min. Next, the cells were incubated with a primary rabbit monoclonal antibody raised against insulin (C27C9) (no. 3014; Cell Signaling Technology, Inc., Danvers, MA, USA) at 1:100 dilution in Immunostain Solution A (Toyobo, Osaka, Japan) at room temperature for 60 min. After five times washing with D-PBS(−), cells were incubated at room temperature for 60 min with an anti-rabbit IgG Alexa Fluor 488-conjugated secondary antibody (no. 4412; Cell Signaling Technology, Inc.) at 1:200 dilution in Immunostain Solution B. The cells were washed five times with D-PBS(−), and the nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI) in ProLong Gold Antifade Reagent (Thermo Fisher Scientific, Inc.). The cells were visualized under a confocal laser scanning microscope LSM710 (Carl Zeiss, Oberkochen, Germany).

Flow cytometry

RIN-5F cells were plated on 3-cm dishes at a density of 2×106 cells per dish in culture medium. After 96 h, culture medium was discarded, the cells were washed three times in D-PBS(−), and 10 ml culture medium was added to each dish. Then, RIN-5F cells were exposed to none or 7 Gy of X-rays at a dose rate of 1.0 Gy/min and treated with STZ of a concentration of 0, 1, 3, 10, or 30 mM. The RIN-5F cells were collected and were stained by propidium iodide (PI) solution. PI-positive cells were detected using a Cytomics FC500 (Beckman Coulter, Brea, CA, USA).

Cell proliferation assay

RIN-5F cells were seeded at the density of 2×104 cells per well of a 96-well flat-bottomed microplate. After pre-culture for 48 h, media were discarded and the cells washed with D-PBS(−). The cells were incubated with STZ diluted in medium at various concentrations (0, 1, 3, 10, or 30 mM) for 0, 24, or 48 h. The cells irradiated with 7 Gy of X-rays and control cells not irradiated were cultured for 0, 24, 48, or 72 h after irradiation. Viable cells were detected using the alamarBlue® cell viability reagent (Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. The fluorescence intensity was measured after 6 h at an excitation wavelength of 544 nm and an emission wavelength of 590 nm using a Fluoroskan Ascent™ system (Thermo Fisher Scientific, Inc.).

Statistical analysis

Statcel 3 software (OMS Publishing Inc., Saitama, Japan) was used to perform all statistical analyses. Student's t-test was performed to compare the results of the two groups. One-way analysis of variance (ANOVA) was performed followed by Tukey-Kramer multiple comparisons test. P<0.05 was considered to indicate a statistically significant difference.

Results

RIN-5F cells express insulin

To confirm the pancreatic β cells characteristics of RIN-5F cells, the expression of insulin mRNA was determined by RT-qPCR. Both Ins1 and Actb mRNAs were detected (Fig. 1A). In addition, insulin proteins were detected in RIN-5F cells by immunofluorescence analysis using confocal laser scanning microscopy (Fig. 1B). These results indicate that RIN-5F cells expressing insulin process characteristics of pancreatic β cells.

Figure 1.

The expression of insulin in RIN-5F cells. (A) The expression of Ins1 and Actb mRNAs determined by RT-qPCR. PCRs with or without reverse transcription (RT) were performed in the RT-qPCR reaction mixture for amplification of Ins1 and Actb mRNAs using total RNA from RIN-5F cells and the primer pair that does not allow amplification of fragments from the genomic DNA. The PCR products were separated by electrophoresis on 4% agarose gel and detected by ethidium bromide staining. RT(−) was performed to examine the amplification from template RNA and/or genomic DNA. (B) Representative immunofluorescence image of insulin in RIN-5F cells. Green, Insulin; Blue, Nuclei. Scale bar represents 100 µm. RT, reverse transcription; DIC, differential interference contrast; DAPI, 4′,6-diamidino-2-phenylindole; NC, negative control.

X-ray irradiation and STZ treatment suppress cell proliferation in RIN-5F cells

To assess the sensitivity of RIN-5F cells to irradiation and STZ treatment, a cell proliferation assay was performed. Cell proliferation of RIN-5F cells was significantly suppressed at 24, 48, and 72 h after 7 Gy irradiation (Fig. 2A) and by treatment of 10 or 30 mM STZ at 24 h (Fig. 2B) compared with controls. These results indicate that cells exposed to 7 Gy irradiation and high concentration of STZ cannot further proliferate.

Figure 2.

The effects of X-ray irradiation and STZ treatment on cell proliferation in RIN-5F cells. Cell proliferation assay was performed using an alamarBlue cell viability reagent. (A) Cell proliferation profiles after 0 and 7 Gy irradiation. Statistical comparisons were determined using Student's t-test. **P<0.01. (B) Cell proliferation profiles after treatment with 0, 1, 3, 10, and 30 mM STZ. The horizontal axis represents time after irradiation or treatment (h), whereas the vertical axis represents fluorescence intensity (Excitation, 544 nm; Emission, 590 nm). Statistical comparisons were determined using the one-way ANOVA with Tukey's multiple comparisons. **P<0.01. All bars, mean ± standard deviations. Each 8 sample was used.

X-ray irradiation and STZ treatment induce cell death in RIN-5F cells

To evaluate cell death induced by 7 Gy irradiation or STZ treatment in RIN-5F cells, we performed a flow cytometry analysis in PI-stained RIN-5F cells. The number of PI-positive cells significantly increased at 24, 48, and 72 h after 7 Gy irradiation compared with non-irradiated (0 Gy) cells (Fig. 3A). PI-positive cells were significantly increased at 24 h after treatment with 30 mM STZ and at 48 h after treatment with 3, 10, or 30 mM STZ compared with control cells (Fig. 3B). These results indicate that within 24 h, cell death is induced in RIN-5F cells either exposed to 7 Gy irradiation or 30 mM STZ treatment.

Figure 3.

The effects of X-ray irradiation or STZ treatment on cell death in RIN-5F cells. (A) Cell death detection by PI-positive RIN-5F cell quantification following 0 and 7 Gy irradiation. Statistical comparisons were determined using Student's t-test. **P<0.01. (B) Cell death detection by PI-positive RIN-5F cell quantification following 0, 1, 3, 10 and 30 mM STZ treatment. Statistical comparisons were determined using the one-way ANOVA with Tukey's multiple comparisons. *P<0.05 and **P<0.01. All bars, mean ± standard deviations. Each 4 sample was used. PI-positive RIN-5F cells were quantified using Cytomics FC500 (Beckman Coulter). The horizontal axis represents time after irradiation or treatment (h), whereas the vertical axis represents the rate of PI-positive cells within a gate (%).

X-ray irradiation and STZ treatment enhance the release of miR-375-3p in RIN-5F cells

To examine the impairmentassociated release of miR-375-3p from RIN-5F cells, we performed RT-qPCR on culture supernatants of RIN-5F cells that were exposed to 7 Gy irradiation or STZ treatment. The expression of miR-375-3p increased significantly at 48 or 72 h after 7 Gy irradiation (Fig. 4A) and at 24 or 48 h after treatment of 30 mM STZ compared with control supernatants (Fig. 4B). These results suggest that 7 Gy irradiation and STZ treatment trigger the release of miR-375-3p from RIN-5F cells into cell culture supernatants.

Figure 4.

The effects of X-ray irradiation and STZ treatment on miR-375-3p released from RIN-5F cells. (A) The expression of miR-375-3p in culture supernatants of RIN-5F cells after 0 and 7 Gy irradiation. Statistical comparisons were determined using Student's t-test. **P<0.01. (B) The expression of miR-375-3p in culture supernatants of RIN-5F cells treated with 0, 1, 3, 10, and 30 mM STZ. Statistical comparisons were determined using the one-way ANOVA with Tukey's multiple comparisons. *P<0.05 and **P<0.01. All bars, mean ± standard deviations. Each 4 sample was used. The expression of miR-375-3p in culture supernatants of RIN-5F cells were determined by RT-qPCR. The horizontal axis represents time after irradiation or treatment (h), whereas the vertical axis represents relative expression of miR-375-3p. Cel-miR-39 was used for as an external control.

Discussion

We have previously shown that miR-375-3p increases in the serum of mice exposed to 7 Gy X-rays causing cytotoxicity in pancreatic β cells (2). However, the direct relationship between miR-375-3p level increases in the blood and the cytotoxicity caused by 7 Gy irradiation remained to be clarified. In this study, employing an in vitro cell culture model of pancreatic β cells, we investigated the direct release of miR375-3p from damaged cells.

First, we confirmed that RIN-5F cells have traits characteristics of pancreatic β cells. Pancreatic β cells are insulin-producing cells and are known to express miR-375-3p (16). The expression of insulin mRNA was confirmed by RT-PCR, and insulin was detected by fluorescent immunostaining (Fig. 1). In this study, RIN-5F cells had traits of pancreatic β cells including expression of insulin.

Next, we investigated the effects of 7 Gy X-ray irradiation on cell proliferation and cell death in RIN-5F cells. The suppression of cell proliferation and the increase of PI-positive cells were observed at 24 h after irradiation (Figs. 2A and 3A). Although the expression of extracellular miR-375-3p was not significantly different after 24 h of irradiation, it was significantly increased after 48 and 72 h (Fig. 4A), suggesting that miR-375-3p requires over 24 h after irradiation to be released in the medium. On the other hand, 30 mM STZ treatment inhibited cell proliferation and increased cell death at 24 or 48 h, when treated with 30 mM STZ (Figs. 2B and 3B), and the expression of extracellular miR-375-3p was concomitantly and significantly increased at these times (Fig. 4B). Therefore, the mechanism of miR-375-3p release may be different after X-ray irradiation compared with after STZ treatment.

STZ causes the selective destruction of pancreatic β cells via a glucose transporter 2 (20). The release of miR-375-3p from cellular to extracellular space is enhanced by the treatment of STZ (22,23). Therefore, STZ have been used as a therapeutic drug for the treatment of insulinoma (21). We propose that the miR-375-3p increase in blood is due to leakage from damaged pancreatic β cells caused by STZ. High-dose irradiation induces a programmed cell death called apoptosis (25). Apoptotic cell death minimizes leakage of cell contents by forming EVs such as apoptotic bodies (26). In Fig. 4A, extracellular miR-375-3p did not increase at 24 h after 7 Gy irradiation compared with control probably due to cell death by apoptosis. To clarify whether extracellular miR-375-3p is contained in EVs such as apoptotic bodies of culture supernatant after X-ray irradiation and STZ treatment, we aim to analyze in detail apoptosis and EV contents following X-ray irradiation and STZ treatment in the future.

In this study, we clarified that pancreatic β-cell injury induced an extracellular miR-375-3p increase. PI is only taken up by the cell when the membrane is damaged and decreased metabolism, and binds to the nuclear DNA. Therefore, cells undergoing late apoptosis or necrosis can be detected with PI. In the future, it is necessary to assess the degree of membrane injury using Annexin V staining binding to membrane phospholipid.

Acknowledgements

Not applicable.

Funding

This work was supported in part by JSPS KAKENHI (grant nos. JP25670264, JP17H04761, and JP17K19779), and a grant from the Takeda Science Foundation.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

MC was a major contributor in performing experiments and writing the manuscript. IN, HU, and HK helped perform experiments. MC was the leader of this study. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Lee RC, Feinbaum RL and Ambros V: The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 75:843–854. 1993. View Article : Google Scholar : PubMed/NCBI

2 

Chiba M, Monzen S, Iwaya C, Kashiwagi Y, Yamada S, Hosokawa Y, Mariya Y, Nakamura T and Wojcik A: Serum miR-375-3p increase in mice exposed to a high dose of ionizing radiation. Sci Rep. 8:13022018. View Article : Google Scholar : PubMed/NCBI

3 

Wen Y, Han J, Chen J, Dong J, Xia Y, Liu J, Jiang Y, Dai J, Lu J, Jin G, et al: Plasma miRNAs as early biomarkers for detecting hepatocellular carcinoma. Int J Cancer. 137:1679–1690. 2015. View Article : Google Scholar : PubMed/NCBI

4 

Ben-Dov IZ, Tan YC, Morozov P, Wilson PD, Rennert H, Blumenfeld JD and Tuschl T: Urine microRNA as potential biomarkers of autosomal dominant polycystic kidney disease progression: Description of miRNA profiles at baseline. PLoS One. 9:e868562014. View Article : Google Scholar : PubMed/NCBI

5 

Akers JC, Ramakrishnan V, Kim R, Phillips S, Kaimal V, Mao Y, Hua W, Yang I, Fu CC, Nolan J, et al: miRNA contents of cerebrospinal fluid extracellular vesicles in glioblastoma patients. J Neurooncol. 123:205–216. 2015. View Article : Google Scholar : PubMed/NCBI

6 

Rubio M, Bustamante M, Hernandez-Ferrer C, Fernandez-Orth D, Pantano L, Sarria Y, Piqué-Borras M, Vellve K, Agramunt S, Carreras R, et al: Circulating miRNAs, isomiRs and small RNA clusters in human plasma and breast milk. PLoS One. 13:e01935272018. View Article : Google Scholar : PubMed/NCBI

7 

Wang Z, Zhang J, Wei W, Zhou D, Luo H, Chen X and Hou Y: Identification of saliva using MicroRNA biomarkers for forensic purpose. J Forensic Sci. 60:702–706. 2015. View Article : Google Scholar : PubMed/NCBI

8 

Molina-Pinelo S, Suárez R, Pastor MD, Nogal A, Márquez-Martín E, Martín-Juan J, Carnero A and Paz-Ares L: Association between the miRNA signatures in plasma and bronchoalveolar fluid in respiratory pathologies. Dis Markers. 32:221–230. 2012. View Article : Google Scholar : PubMed/NCBI

9 

Záveský L, Jandáková E, Weinberger V, Minář L, Hanzíková V, Dušková D, Drábková LZ, Svobodová I and Hořínek A: Ascites-derived extracellular microRNAs as potential biomarkers for ovarian cancer. Reprod Sci. Jan 1–2018.(Epub ahead of print). View Article : Google Scholar

10 

Han HS, Yun J, Lim SN, Han JH, Lee KH, Kim ST, Kang MH, Son SM, Lee YM, Choi SY, et al: Downregulation of cell-free miR-198 as a diagnostic biomarker for lung adenocarcinoma-associated malignant pleural effusion. Int J Cancer. 133:645–652. 2013. View Article : Google Scholar : PubMed/NCBI

11 

Taylor DD and Gercel-Taylor C: MicroRNA signatures of tumor-derived exosomes as diagnostic biomarkers of ovarian cancer. Gynecol Oncol. 110:13–21. 2008. View Article : Google Scholar : PubMed/NCBI

12 

Chiba M, Kimura M and Asari S: Exosomes secreted from human colorectal cancer cell lines contain mRNAs, microRNAs and natural antisense RNAs, that can transfer into the human hepatoma HepG2 and lung cancer A549 cell lines. Oncol Rep. 28:1551–1558. 2012. View Article : Google Scholar : PubMed/NCBI

13 

Xu R, Greening DW, Zhu HJ, Takahashi N and Simpson RJ: Extracellular vesicle isolation and characterization: Toward clinical application. J Clin Invest. 126:1152–1162. 2016. View Article : Google Scholar : PubMed/NCBI

14 

Wagner J, Riwanto M, Besler C, Knau A, Fichtlscherer S, Röxe T, Zeiher AM, Landmesser U and Dimmeler S: Characterization of levels and cellular transfer of circulating lipoprotein-bound microRNAs. Arterioscler Thromb Vasc Biol. 33:1392–1400. 2013. View Article : Google Scholar : PubMed/NCBI

15 

Wang K, Zhang S, Weber J, Baxter D and Galas DJ: Export of microRNAs and microRNA-protective protein by mammalian cells. Nucleic Acids Res. 38:7248–7259. 2010. View Article : Google Scholar : PubMed/NCBI

16 

Kloosterman WP, Lagendijk AK, Ketting RF, Moulton JD and Plasterk RH: Targeted inhibition of miRNA maturation with morpholinos reveals a role for miR-375 in pancreatic islet development. PLoS Biol. 5:e2032007. View Article : Google Scholar : PubMed/NCBI

17 

Li X: MiR-375, a microRNA related to diabetes. Gene. 533:1–4. 2014. View Article : Google Scholar : PubMed/NCBI

18 

Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P and Stoffel M: A pancreatic islet-specific microRNA regulates insulin secretion. Nature. 432:226–230. 2004. View Article : Google Scholar : PubMed/NCBI

19 

Eliasson L: The small RNA miR-375-a pancreatic islet abundant miRNA with multiple roles in endocrine beta cell function. Mol Cell Endocrinol. 456:95–101. 2017. View Article : Google Scholar : PubMed/NCBI

20 

Lenzen S: The mechanisms of alloxan- and streptozotocin-induced diabetes. Diabetologia. 51:216–226. 2008. View Article : Google Scholar : PubMed/NCBI

21 

Okusaka T, Ueno H, Morizane C, Kondo S, Sakamoto Y, Takahashi H, Ohno I, Shimizu S, Mitsunaga S and Ikeda M: Cytotoxic chemotherapy for pancreatic neuroendocrine tumors. J Hepatobiliary Pancreat Sci. 22:628–633. 2015. View Article : Google Scholar : PubMed/NCBI

22 

Latreille M, Herrmanns K, Renwick N, Tuschl T, Malecki MT, McCarthy MI, Owen KR, Rülicke T and Stoffel M: miR-375 gene dosage in pancreatic β-cells: Implications for regulation of β-cell mass and biomarker development. J Mol Med (Berl). 93:1159–1169. 2015. View Article : Google Scholar : PubMed/NCBI

23 

Bathina S, Srinivas N and Das UN: Streptozotocin produces oxidative stress, inflammation and decreases BDNF concentrations to induce apoptosis of RIN5F cells and type 2 diabetes mellitus in Wistar rats. Biochem Biophys Res Commun. 486:406–413. 2017. View Article : Google Scholar : PubMed/NCBI

24 

Erener S, Mojibian M, Fox JK, Denroche HC and Kieffer TJ: Circulating miR-375 as a biomarker of β-cell death and diabetes in mice. Endocrinology. 154:603–608. 2013. View Article : Google Scholar : PubMed/NCBI

25 

Meyn RE, Stephens LC and Milas L: Programmed cell death and radioresistance. Cancer Metastasis Rev. 15:119–131. 1996. View Article : Google Scholar : PubMed/NCBI

26 

Mathivanan S, Ji H and Simpson RJ: Exosomes: Extracellular organelles important in intercellular communication. J Proteomics. 73:1907–1920. 2010. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Chiba M, Niiyama I, Uehara H and Kuwata H: Injured pancreatic β cells enhance the release of miR‑375‑3p into the extracellular space. Exp Ther Med 17: 2815-2820, 2019.
APA
Chiba, M., Niiyama, I., Uehara, H., & Kuwata, H. (2019). Injured pancreatic β cells enhance the release of miR‑375‑3p into the extracellular space. Experimental and Therapeutic Medicine, 17, 2815-2820. https://doi.org/10.3892/etm.2019.7276
MLA
Chiba, M., Niiyama, I., Uehara, H., Kuwata, H."Injured pancreatic β cells enhance the release of miR‑375‑3p into the extracellular space". Experimental and Therapeutic Medicine 17.4 (2019): 2815-2820.
Chicago
Chiba, M., Niiyama, I., Uehara, H., Kuwata, H."Injured pancreatic β cells enhance the release of miR‑375‑3p into the extracellular space". Experimental and Therapeutic Medicine 17, no. 4 (2019): 2815-2820. https://doi.org/10.3892/etm.2019.7276
Copy and paste a formatted citation
x
Spandidos Publications style
Chiba M, Niiyama I, Uehara H and Kuwata H: Injured pancreatic β cells enhance the release of miR‑375‑3p into the extracellular space. Exp Ther Med 17: 2815-2820, 2019.
APA
Chiba, M., Niiyama, I., Uehara, H., & Kuwata, H. (2019). Injured pancreatic β cells enhance the release of miR‑375‑3p into the extracellular space. Experimental and Therapeutic Medicine, 17, 2815-2820. https://doi.org/10.3892/etm.2019.7276
MLA
Chiba, M., Niiyama, I., Uehara, H., Kuwata, H."Injured pancreatic β cells enhance the release of miR‑375‑3p into the extracellular space". Experimental and Therapeutic Medicine 17.4 (2019): 2815-2820.
Chicago
Chiba, M., Niiyama, I., Uehara, H., Kuwata, H."Injured pancreatic β cells enhance the release of miR‑375‑3p into the extracellular space". Experimental and Therapeutic Medicine 17, no. 4 (2019): 2815-2820. https://doi.org/10.3892/etm.2019.7276
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team