Open Access

Downregulation of miR‑485‑3p promotes glioblastoma cell proliferation and migration via targeting RNF135

  • Authors:
    • Ye Zhang
    • Rui Sui
    • Yi Chen
    • Haiyang Liang
    • Ji Shi
    • Haozhe Piao
  • View Affiliations

  • Published online on: May 23, 2019     https://doi.org/10.3892/etm.2019.7600
  • Pages: 475-482
  • Copyright: © Zhang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

MicroRNAs (miRNAs) are small non‑coding RNAs that serve pivotal roles in human diseases. Several miRNAs, such as miR‑485‑3p, have been identified as potential biomarkers for predicting overall survival of patients with glioblastoma (GBM). However, the underlying mechanism of miRNAs in promoting GBM progression remains unknown. In the present study, decreased miR‑485‑3p expression was detected in tumor tissues from patients with GBM. Using western blot analysis, reverse transcription‑quantitative PCR and dual luciferase reporter assay, ring finger protein 135 (RNF135) was confirmed as a target gene of miR‑485‑3p in GBM cells. Through silencing of RNF135, miR‑485‑3p inactivated the mitogen‑activated protein kinase/ERK1/2 pathway in GBM cells. Moreover, functional assays demonstrated that miR‑485‑3p inhibited GBM cell proliferation and migration whilst overexpression of RNF135 reversed this effect. Additionally, a negative correlation between miR‑485‑3p and RNF135 mRNA expression was observed in tissues from patients with glioblastoma. In conclusion, the present results demonstrated that miR‑485‑3p functioned as a tumor suppressor which suggested that miR‑485‑3p might have a role in GBM progression.

Introduction

Glioblastoma (GBM) is the most commonly diagnosed type of malignant primary brain tumor (1). GBM is a high-grade tumor (World Health Organization grade IV), and prognosis of patients with GBM is relatively poor compared with other types of brain cancer (2). The median overall survival time is <1 year following diagnosis and the median progression-free survival is ~6 months (3,4). Conventional therapeutic approaches for patients with GBM include chemotherapy, radiotherapy and surgical resection (5). Unfortunately, current treatments are unsatisfactory due to resistance development and cancer recurrence (6). Decades of study on the molecular mechanism of GBM have greatly enhanced our knowledge of GBM pathogenesis and provided new insights for development of targeted therapy (7). For example, it has been demonstrated that GBM cells with strong migration potential exhibit pro-apoptotic stimuli resistance (8) with several publications confirming that inhibitors that target migration-related molecules are effective methods to overcome resistance (9,10). Therefore, further investigation into the molecular mechanism of GBM is still urgently required to meet clinical needs.

MicroRNAs (miRNAs) are a class of small non-coding RNAs first discovered in Caenorhabditis elegans (11). In many eukaryotic cells, miRNAs function as negative regulators of gene expression via directly binding to sites on the 3′untranslated region (UTR) of mRNAs (12). Dysregulation of miRNAs is implicated in the initiation and development of various types of cancer including GBM (13). Several miRNAs have been identified as oncogenes or tumor suppressors in GBM (14,15). In addition, expression of certain miRNAs is a promising predictor of patient GBM outcome and therapy response (16,17). miR-485-3p is mapped to the 14q32.31 chromosome region where mutations are frequently observed in cancers, which suggests that miR-485-3p might demonstrate tumor suppressor potential (18). A recent study determined that levels of miR-485-3p in serum could predict prognosis of patients with GBM (19). The focus of the present study was identifying the role and molecular mechanism of miR-485-3p in GBM cells.

Ring finger protein 135 (RNF135) is a RING finger domain-containing E3 ubiquitin ligase which has a critical role in many cellular biological processes via regulating protein degradation (20). For example, during viral infection, RNF135 ubiquitinates retinoic acid-inducible gene I to promote interferon-β induction (21). Aberrant RNF135 expression results in altered expression of genes leading to several diseases (22,23). In GBM, RNF135 functions as an oncogene through activating the mitogen-activated protein kinase (MAPK)/ERK pathway and controlling expression of key cell cycle regulators, such as cyclin dependent kinase 4, cyclin dependent kinase inhibitor 1A, cyclin dependent kinase inhibitor 1B (24). However, how RNF135 is regulated in GBM cells remains unknown; therefore, the present study aimed to determine the underlying mechanism.

Materials and methods

Collection of patient tissue

A total of 20 GBM and 20 normal tissues were collected at the Cancer Hospital of China Medical University between October 2014 to January 2017. The patients with GBM (15 males; 5 females; age, 25–48 years old) had undergone surgery, and patients with severe traumatic brain injury (13 males; 7 females; age, 23–56 years old) underwent internal decompression surgery. None of the patients sampled had undergone chemotherapy or radiotherapy prior to having surgery. Fresh tissue samples were histopathologically examined then immediately stored at −80°C prior to RNA extraction. All patients provided written consent and the study was conducted under the supervision of the Ethics Committee of Cancer Hospital of China Medical University.

Bioinformatic analysis

Data for miR-485-3p expression levels in 5 normal tissues and 82 GBM tissues were downloaded from GSE25631 in the Gene Expression Omnibus database (https://www.ncbi.nlm.nih.gov/geo/). The comparison of miR-485-3p expression between normal and GBM tissues was conducted using GraphPad Prism v7.05 (GraphPad Software, Inc.).

U251-MG cell culture

The GBM cell line U251-MG was purchased from the American Type Culture Collection. The cells were cultured in Dulbecco's modified Eagle's medium (Gibco; Thermo Fisher Scientific, Inc.) containing 10% fetal bovine serum (FBS; Hyclone; GE Healthcare Life Sciences) and 1% penicillin-streptomycin solution in a 37°C humidified incubator with 5% CO2.

Reverse transcription-quantitative PCR (RT-qPCR)

miRNeasy Mini kit (Qiagen, Inc.) was used to extract total RNA from patient tissues and U251-MG cells, following the manufacturer's instructions. The concentration and quality of extracted RNA was measured using NanoDrop 2000 (Thermo Fisher Scientific, Inc.). TransScript First-Strand cDNA Synthesis SuperMix (Transgen Biotech Co. Ltd.) was used to reverse transcribe RNA into cDNA, according to the manufacturer's protocol. qPCR was performed using SYBR Premix Ex Taq (Takara Bio, Inc.) on a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad Laboratories, Inc.). The thermocycling conditions were: Predenaturing step at 95°C for 30 sec, followed by denaturing step at 95°C for 5 sec then annealing and elongation at 60°C for 30 sec, repeated for 35 cycles. Gene expression was quantified using the 2−ΔΔCq method (25). The stem-loop method was used to detect miRNA expression. U6 and GAPDH were used as internal controls for miRNA and mRNA, respectively. Sequences of primers are listed in Table I.

Table I.

List of the primer sequences.

Table I.

List of the primer sequences.

PrimerSequence (5′-3′)
Stem-loop primer CTCAACTGGTGTCGTGGAGTCGG
CAATTCAGTTGAGAGAGAGG
miR-485-3p F GCCGAGGUCAUACACGGCUCU
miR-485-3p R CTCAACTGGTGTCGTGGA
RNF135 F CTGCGGAAGAACACGCTACT
RNF135 R GCTCAGTTCGTTGTCTGGTCC
U6 F CTCGCTTCGGCAGCACA
U6 R AACGCTTCACGAATTTGCGT
GAPDH F CCACTCCTCCACCTTTGAC
GAPDH R ACCCTGTTGCTGTAGCCA

[i] miR, microRNA; RNF135, ring finger protein 135; F, forward; R, reverse.

Overexpression of miR-485-3p

miR-485-3p mimic and miR-negative control (NC) mimic were synthesized and purchased from Guangzhou RiboBio Co., Ltd. For the overexpression of miR-485-3p, 10 µl miR-485-3p mimic (50 pmol/µl) was incubated with Lipofectamine 3000 (Invitrogen; Thermo Fisher Scientific, Inc.) in serum-free medium for 15 min and then added to each well in 96-well plates or 6-well plates. Experimentation commenced 48 h following transfection. The miR-485-3p mimic sequence was 5′-GUCAUACACGGCUCUCCUCUCU-3′ and the miR-NC mimic sequence was 5′-UUCUCCGAACGUGUCACGUTT-3′.

Western blot analysis

Cell lysates were prepared using radioimmunoprecipitation lysis buffer (Beyotime Institute of Biotechnology). The concentration of protein lysate was determined with Pierce Bicinchoninic Acid Protein Assay kit (Thermo Fisher Scientific, Inc.). A total of 20 µg protein were loaded per lane and separated via SDS-PAGE on an 8% gel. The separated proteins were then transferred to polyvinylidene difluoride membranes and subsequently blocked with 5% non-fat milk at room temperature for 1 h. Then membranes were incubated with primary antibodies anti-RNF135 (cat. no. ab28636; 1:1,000; Abcam), anti-GAPDH (cat. no. G8795; 1:8,000; Sigma-Aldrich; Merck KGaA), ERK1/2 (cat. no. 4695; 1:1,000; Cell Signaling Technology, Inc.) and phosphorylated (p-) ERK1/2 (cat. no. 9101; 1:1,000; Cell Signaling Technology, Inc.) at 4°C overnight. Following primary incubation, membranes were incubated with horseradish peroxidase-labeled secondary mouse antibody (cat. no. AP308P; 1:10,000; Sigma-Aldrich; Merck KGaA) and rabbit antibody (cat. no. SAB3700852; 1:10,000; Sigma-Aldrich; Merck KGaA) at room temperature for 1 h. Subsequently, the bands were visualized using enhanced chemiluminescence western blotting detection reagents (GE Healthcare Life Sciences). Images were captured and analyzed using ImageQuant TL 7.0 (GE Healthcare Life Sciences). GAPDH served as a loading control for protein quantification.

Dual luciferase reporter assay

To investigate whether miR-485-3p directly regulated RNF135, bioinformatic analysis (TargetScan V7.2; www.targetscan.org) was performed to compare the miR-485-3p sequence with the 3UTR of RNF135 mRNA. Dual luciferase assay was performed using the Dual-Luciferase® Reporter Assay System (Promega Corporation). U251-MG cDNA was prepared by isolating RNA from U251-MG cells using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) followed by reverse-transcription into first-strand cDNA using RevertAid RT Reverse Transcription kit (Thermo Fisher Scientific, Inc.) according to manufacturer's protocol. The 3UTR containing putative binding sites of miR-485-3p on RNF135 mRNA was amplified from the U251-MG cDNA and ligated into pGL3-basic vector (Addgene, Inc.) using XbaI enzyme (New England Biolabs, Inc.). The primer sequences of the RNF135 mRNA were: forward, 5′-CTCTAGACCTATCGCTGGAGCTGTGAG-3′ and reverse, 5′-CTCTAGAAGGAATTCGACACCAGCCTG-3′. 3UTR mutant (Mut) 1 and Mut 2 were constructed by introducing 2 site mutations into putative binding site 1 and putative binding site 2 respectively with Q5® Site-Directed Mutagenesis kit (New England BioLabs, Inc.). In brief, U251-MG cells were cultured in 24-well plates and co-transfected with miR-485-3p mimic or miR-NC mimic with pGL3-RNF135 3′UTR-wild type (WT) or pGL3-RNF135 3′UTR-Mut 1 or pGL3-RNF135 3′UTR-Mut 2 and pRL-TK vector (Promega Cooperation) using Lipofectamine 3000 (Invitrogen; Thermo Fisher Scientific, Inc.). Following 48 h, cells were collected and the dual-luciferase activity was examined using Dual Luciferase Reporter Assay system (Promega Cooperation) following the manufacturer's protocol with Renilla luciferase as the internal control.

Construction of plasmid and overexpression of RNF135

The full length RNF135 cDNA from U251-MG cells was cloned into pcDNA3.1 plasmid (Addgene, Inc.) to construct the pcDNA3.1-RNF135 plasmid. For overexpression of RNF135 with or without overexpression of miR-485-3p, 2 µg pcDNA3.1-RNF135 and/or 10 µl miR-485-3p mimics (50 pmol/µl) were transfected into U251-MG cells using Lipofectamine 3000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to manufacturer's protocol.

Cell proliferation assay

Cell proliferation was measured using Cell Counting kit-8 (CCK-8; Dojindo Molecular Technologies, Inc.) according to manufacturer's protocol. In brief, 2,000 U251-MG cells were seeded into 96-well plates then incubated under standard conditions. The next day, cells were transfected with pcDNA3.1-RNF135 with or without miR-485-3p mimic. At 0, 24, 48 and 72 h post transfection, 10 µl CCK-8 solution was added to each well and the cells were incubated for another 2 h at 37°C. The absorbance at 450 nm was detected using a microplate reader (Bio-Rad Laboratories, Inc.) to determine the number of cells.

Cell migration assay

Cell migration ability was detected using a wound-healing assay. U251-MG cells (1×106) were seeded into 6-well plates and cultured under standard conditions until 90% confluence. The cells were then transfected with miR-485-3p mimic with or without pcDNA3.1-RNF135. The following day, a wound area was made by scratching the center of each well with a 10 µl pipette tip. The wells were washed with PBS then culture medium containing 1% FBS was added. At 0 and 20 h, images of the scratch area were captured. Subsequently, the percentage of the relative wound closure area was analyzed using Image Pro Plus 6 (Media Cybernetics, Inc.).

Statistical analysis

All statistical analyses were carried out using GraphPad Prism 7 software (GraphPad Software, Inc.). Data were presented as the mean ± standard deviation. Student's t-test was used to compare 2 groups and multiple groups were compared using one-way analysis of variance followed by the Newman-Keuls post hoc test. P<0.05 was considered to indicate statistical significance.

Results

miR-485-3p is downregulated in GBM compared with normal brain tissues

Decreased expression of miR-485-3p has been identified in several cancer types (26,27) including GBM (19). To evaluate the expression of miR-485-3p in GBM tissues, miR-485-3p expression data was downloaded from GSE25631 which contained miRNA microarray data for 5 normal brain tissues and 82 GBM tissues. Compared with the normal brain group, miR-485-3p levels were significantly decreased in GBM tissues (Fig. 1A). To further validate this finding, RT-qPCR was performed to compare miR-485-3p expression in 20 GBM tissues and 20 normal brain tissues collected at our institution. Significant downregulation of miR-485-3p was detected in GBM tissues compared with normal brain tissues (Fig. 1B), which suggested that miR-485-3p may have a tumor suppressor role in GBM.

Overexpression of miR-485-3p decreases RNF135 expression and inactivates the MAPK/ERK pathway in GBM cells

RNF135 is a recently identified GBM oncogene (24). Transfection of miR-485-3p mimic increased miR-485-3p expression in U251-MG cells (Fig. 2A), accompanied with a decreased expression of RNF135 mRNA (Fig. 2B). Western blot analysis demonstrated that overexpression of miR-485-3p also decreased RNF135 protein expression (Fig. 2C). Overactivation of MAPK/ERK signaling promotes GBM progression, which is regulated by RNF135 (21). In addition to downregulation of RNF135, overexpression of miR-485-3p also decreased p-ERK1/2 levels, indicating an inactivation of MAPK/ERK signaling (Fig. 2C). These results suggested that miR-485-3p negatively regulated RNF135 to inhibit GBM cells.

RNF135 is a target gene of miR-485-3p

There were two putative binding sites between miR-485-3p and 3UTR of RNF135 (Fig. 3A). Dual luciferase reporter assays demonstrated that overexpression of miR-485-3p significantly decreased luciferase activity of RNF135 3UTR-WT in U251-MG cells (Fig. 3B and C). Additionally, miR-485-3p mimic induced decreased luciferase activity of RNF135 3UTR-Mut2 but not RNF135 3UTR-Mut1, which suggested that site 1 was a direct binding site for miR-485-3p on the 3UTR of RNF135 in GBM cells (Fig. 3B and C).

Overexpression of miR-485-3p inhibits GBM cell proliferation and migration via targeting RNF135

Recombinant RNF135 was constructed and co-transfected with miR-485-3p mimic to study the functions of miR-485-3p/RNF135 in GBM cells. Transfection with miR-485-3p mimic decreased RNF135 protein expression whereas co-transfection of recombinant RNF135 and miR-485-3p mimic rescued RNF135 expression in U251-MG cells (Fig. 4A). In the cell proliferation assay, overexpression of miR-485-3p decreased the cell viability compared with control, whilst overexpression of RNF135 partially recovered the cell viability (Fig. 4B). These results suggested that miR-485-3p inhibited GBM cell proliferation via repression of RNF135. In the cell migration assay, overexpression of miR-485-3p inhibited cell migration. Transfection with recombinant RNF135 attenuated this inhibitory effect (Fig. 5A and B). These results demonstrated that miR-485-3p inhibited GBM cell proliferation and migration via repression of RNF135.

Expression of miR-485-3p is negatively correlated with RNF135 in GBM tissues

Next, the potential association between miR-485-3p and RNF135 in GBM tissues was investigated. RT-qPCR was performed on the 20 GBM and 20 normal tissues collected in the present study, to detect RNF135 mRNA levels. Significant upregulation of RNF135 mRNA levels were observed in GBM tissues compared with normal tissues (Fig. 6A). Crucially, Pearson correlation analysis demonstrated that miR-485-3p expression was negatively correlated with RNF135 mRNA levels in GBM tissues (r=−0.58; P<0.01; Fig. 6B).

Discussion

GBM is a lethal cancer type (28) and aberrant expression of miRNAs is experimentally identified as a major step towards development of the disease (29). miR-485-3p, mapped to chromosome 14q32.31 region, is a well-characterized tumor suppressor in several cancer types (30). Recently, miRNA microarray data of 14 GBM tissues identified miR-485-3p as one of the significantly downregulated miRNAs in tissues from short-survival patients compared with long-survival patients (31). Low expression of serum miR-485-3p predicts poor overall survival in patients with GBM (19). The present study determined that miR-485-3p was downregulated in GBM. RT-qPCR and western blot analysis demonstrated that RNF-135 was negatively regulated by miR-485-3p. Dual luciferase assay confirmed RNF135 as a target gene of miR-485-3p. Functional assays indicated that miR-485-3p inhibited cell proliferation and migration of GBM cells via repression of RNF135. The present findings suggested that miR-485-3p was a tumor suppressor in GBM.

In order to investigate the role of miR-485-3p in GBM, analysis of miRNA expression in normal brain tissues and GBM tissues from a previously published microarray dataset was performed. Results determined that miR-485-3p expression was significantly lower in GBM tissues compared with normal tissues. To validate this result, the present study collected and analyzed 20 pairs of normal brain and GBM tissues. Therefore, in addition to the reported decreased miR-485-3p expression in serum and tissues of short-survival patients (19,31), the present study identified miR-485-3p as a downregulated miRNA in GBM tissues compared with normal brain tissues. In addition, functional analysis of miR-485-3p demonstrated that miR-485-3p overexpression inhibited cell proliferation and migration of GBM cells. GBM is highly aggressive with cells displaying strong proliferative capacity (28) therefore the current findings suggested that miR-485-3p may be involved in the development of GBM.

E3 ubiquitin ligases regulate turnover of many target genes via protease degradation (32). In GBM, dysregulation of E3 ligases results in accumulation of oncogenes or downregulation of tumor suppressors, leading to GBM progression (33,34). RNF135 is a member of E3 ubiquitin ligases and regulates protein stability (24). High expression of RNF135 is associated with poor prognosis for GBM patients (24). RNF135 activates the MAPK/ERK signaling pathway and facilitates progression of the GBM cell cycle to promote proliferation (24). The present study identified that overexpression of miR-485-3p decreased RNF135 expression in GBM cells. Bioinformatic analysis and the dual luciferase reporter assay predicted and confirmed RNF135 as a target gene of miR-485-3p. In GBM tissues, a significant negative correlation between RNF135 mRNA and miR-485-3p expression was identified. RNF135 function has been previously reported to be regulated by mutation (20,35). The present findings demonstrated that RNF135 was also regulated by miRNA. Crucially, cell proliferation and migration inhibition induced by miR-485-3p mimic was reversed by overexpression of RNF135, which indicated that miR-485-3p exerted its tumor suppressive function through RNF135.

In conclusion, the present study provided evidence to suggest that miR-485-3p may have a role as a tumor suppressor in GBM via regulation of RNF135.

Acknowledgements

Not applicable.

Funding

The study was funded by the Clinical Capability Construction Project for Liaoning Provincial Hospitals (grant no. LNCCC-B04-2015).

Availability of data and materials

The datasets generated and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

Clinical sample collection was performed by JS and HL. The study was designed by HP and RS. Data acquisition and analysis were performed by HP, YZ and YC. The manuscript was prepared, edited and reviewed by HP and JS.

Ethics approval and consent to participate

All patients provided written informed consent and the Ethic Committee of Cancer Hospital of China Medical University approved the present study.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Siegel RL, Miller KD and Jemal A: Cancer statistics, 2018. CA Cancer J Clin. 68:7–30. 2018. View Article : Google Scholar : PubMed/NCBI

2 

Wick W and Platten M: Understanding and treating glioblastoma. Neurol Clin. 36:485–499. 2018. View Article : Google Scholar : PubMed/NCBI

3 

Buckner JC: Factors influencing survival in high-grade gliomas. Semin Oncol. 30:10–14. 2003. View Article : Google Scholar : PubMed/NCBI

4 

Das S and Marsden PA: Angiogenesis in glioblastoma. N Engl J Med. 369:1561–1563. 2013. View Article : Google Scholar : PubMed/NCBI

5 

Fine HA: The basis for current treatment recommendations for malignant gliomas. J Neurooncol. 20:111–120. 1994. View Article : Google Scholar : PubMed/NCBI

6 

Wick W, Osswald M, Wick A and Winkler F: Treatment of glioblastoma in adults. Ther Adv Neurol Disord. 11:17562864187904522018. View Article : Google Scholar : PubMed/NCBI

7 

Nguyen HS, Shabani S, Awad AJ, Kaushal M and Doan N: Molecular markers of therapy-resistant glioblastoma and potential strategy to combat resistance. Int J Mol Sci. 19(pii): E17652018. View Article : Google Scholar : PubMed/NCBI

8 

Osswald M, Jung E, Sahm F, Solecki G, Venkataramani V, Blaes J, Weil S, Horstmann H, Wiestler B, Syed M, et al: Brain tumour cells interconnect to a functional and resistant network. Nature. 528:93–98. 2015. View Article : Google Scholar : PubMed/NCBI

9 

Lefranc F, Le Rhun E, Kiss R and Weller M: Glioblastoma quo vadis: Will migration and invasiveness reemerge as therapeutic targets? Cancer Treat Rev. 68:145–154. 2018. View Article : Google Scholar : PubMed/NCBI

10 

Onken J, Torka R, Korsing S, Radke J, Krementeskaia I, Nieminen M, Bai X, Ullrich A, Heppner F and Vajkoczy P: Inhibiting receptor tyrosine kinase AXL with small molecule inhibitor BMS-777607 reduces glioblastoma growth, migration and invasion in vitro and in vivo. Oncotarget. 9:9876–9889. 2016.

11 

Lee RC, Feinbaum RL and Ambros V: The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 75:843–854. 1993. View Article : Google Scholar : PubMed/NCBI

12 

Bartel DP: MicroRNAs: Genomics, biogenesis, mechanism and function. Cell. 116:281–297. 2004. View Article : Google Scholar : PubMed/NCBI

13 

Sumazin P, Yang X, Chiu HS, Chung WJ, Iyer A, Llobet-Navas D, Rajbhandari P, Bansal M, Guarnieri P, Silva J and Califano A: An extensive microRNA-mediated network of RNA-RNA interactions regulates established oncogenic pathways in glioblastoma. Cell. 147:370–381. 2011. View Article : Google Scholar : PubMed/NCBI

14 

Yue S, Wang L, Zhang H, Min Y, Lou Y, Sun H, Jiang Y, Zhang W, Liang A, Guo Y, et al: miR-139-5p suppresses cancer cell migration and invasion through targeting ZEB1 and ZEB2 in GBM. Tumour Biol. 36:6741–6749. 2015. View Article : Google Scholar : PubMed/NCBI

15 

Zhou X, Ren Y, Moore L, Mei M, You Y, Xu P, Wang B, Wang G, Jia Z, Pu P, et al: Downregulation of miR-21 inhibits EGFR pathway and suppresses the growth of human glioblastoma cells independent of PTEN status. Lab Invest. 90:144–155. 2010. View Article : Google Scholar : PubMed/NCBI

16 

Li W, Guo F, Wang P, Hong S and Zhang C: miR-221/222 confers radioresistance in glioblastoma cells through activating Akt independent of PTEN status. Curr Mol Med. 14:185–195. 2014. View Article : Google Scholar : PubMed/NCBI

17 

Xiong X, Deng J, Zeng C, Jiang Y, Tang S and Sun X: MicroRNA-141 is a tumor regulator and prognostic biomarker in human glioblastoma. Oncol Lett. 14:4455–4460. 2017. View Article : Google Scholar : PubMed/NCBI

18 

Avet-Loiseau H, Facon T, Grosbois B, Magrangeas F, Rapp MJ, Harousseau JL, Minvielle S and Bataille R; Intergroupe Francophone du Myélome, : Oncogenesis of multiple myeloma: 14q32 and 13q chromosomal abnormalities are not randomly distributed, but correlate with natural history, immunological features, and clinical presentation. Blood. 99:2185–2191. 2002. View Article : Google Scholar : PubMed/NCBI

19 

Wang ZQ, Zhang MY, Deng ML, Weng NQ, Wang HY and Wu SX: Low serum level of miR-485-3p predicts poor survival in patients with glioblastoma. PLoS One. 12:e01849692017. View Article : Google Scholar : PubMed/NCBI

20 

Tastet J, Decalonne L, Marouillat S, Malvy J, Thépault RA, Toutain A, Paubel A, Tabagh R, Bénédetti H, Laumonnier F, et al: Mutation screening of the ubiquitin ligase gene RNF135 in French patients with autism. Psychiatr Genet. 25:263–267. 2015. View Article : Google Scholar : PubMed/NCBI

21 

Oshiumi H, Matsumoto M, Hatakeyama S and Seya T: Riplet/RNF135, a RING finger protein, ubiquitinates RIG-I to promote interferon-beta induction during the early phase of viral infection. J Biol Chem. 284:807–817. 2009. View Article : Google Scholar : PubMed/NCBI

22 

Jin J, Zhao L and Li Z: The E3 ubiquitin ligase RNF135 regulates the tumorigenesis activity of tongue cancer SCC25 cells. Cancer Med. 5:3140–3146. 2016. View Article : Google Scholar : PubMed/NCBI

23 

Tastet J, Decalonne L, Marouillat S, Malvy J, Thépault RA, Toutain A, Paubel A, Tabagh R, Bénédetti H, Laumonnier F, et al: Mutation screening of the ubiquitin ligase gene RNF135 in French patients with autism. Psychiat Genet. 6:263–267. 2015. View Article : Google Scholar

24 

Liu Y, Wang F, Liu Y, Yao Y, Lv X, Dong B, Li J, Ren S, Yao Y and Xu Y: RNF135, RING finger protein, promotes the proliferation of human glioblastoma cells in vivo and in vitro via the ERK pathway. Sci Rep. 6:206422016. View Article : Google Scholar : PubMed/NCBI

25 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

26 

Lou C, Xiao M, Cheng S, Lu X, Jia S, Ren Y and Li Z: MiR-485-3p and miR-485-5p suppress breast cancer cell metastasis by inhibiting PGC-1α expression. Cell Death Dis. 7:e21592016. View Article : Google Scholar : PubMed/NCBI

27 

Xiong D, Sheng Y, Ding S, Chen J, Tan X, Zeng T, Qin D, Zhu L, Huang A and Tang H: LINC00052 regulates the expression of NTRK3 by miR-128 and miR-485-3p to strengthen HCC cells invasion and migration. Oncotarget. 7:47593–47608. 2016. View Article : Google Scholar : PubMed/NCBI

28 

Batash R, Asna N, Schaffer P, Francis N and Schaffer M: Glioblastoma multiforme, diagnosis and treatment; recent literature review. Curr Med Chem. 24:3002–3009. 2017. View Article : Google Scholar : PubMed/NCBI

29 

Ahir BK, Ozer H, Engelhard HH and Lakka SS: MicroRNAs in glioblastoma pathogenesis and therapy: A comprehensive review. Crit Rev Oncol Hematol. 120:22–33. 2017. View Article : Google Scholar : PubMed/NCBI

30 

Formosa A, Markert EK, Lena AM, Italiano D, Finazzi-Agro' E, Levine AJ, Bernardini S, Garabadgiu AV, Melino G and Candi E: MicroRNAs, miR-154, miR-299-5p, miR-376a, miR-376c, miR-377, miR-381, miR-487b, miR-485-3p, miR-495 and miR-654-3p, mapped to the 14q32.31 locus, regulate proliferation, apoptosis, migration and invasion in metastatic prostate cancer cells. Oncogene. 33:5173–5182. 2014. View Article : Google Scholar : PubMed/NCBI

31 

Henriksen M, Johnsen KB, Olesen P, Pilgaard L and Duroux M: MicroRNA expression signatures and their correlation with clinicopathological features in glioblastoma multiforme. Neuromolecular Med. 16:565–577. 2014. View Article : Google Scholar : PubMed/NCBI

32 

Sun Y: Targeting E3 ubiquitin ligases for cancer therapy. Cancer Biol Ther. 2:623–629. 2003. View Article : Google Scholar : PubMed/NCBI

33 

Xu T, Wang H, Jiang M, Yan Y, Li W, Xu H, Huang Q, Lu Y and Chen J: The E3 ubiquitin ligase CHIP/miR-92b/PTEN regulatory network contributes to tumorigenesis of glioblastoma. Am J Cancer Res. 7:289–300. 2017.PubMed/NCBI

34 

Qi Z, Cai S, Cai J, Chen L, Yao Y, Chen L and Mao Y: miR-491 regulates glioma cells proliferation by targeting TRIM28 in vitro. BMC Neurol. 16:2482016. View Article : Google Scholar : PubMed/NCBI

35 

Douglas J, Cilliers D, Coleman K, Tatton-Brown K, Barker K, Bernhard B, Burn J, Huson S, Josifova D, Lacombe D, et al: Mutations in RNF135, a gene within the NF1 microdeletion region, cause phenotypic abnormalities including overgrowth. Nat Genet. 39:963–965. 2007. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

July-2019
Volume 18 Issue 1

Print ISSN: 1792-0981
Online ISSN:1792-1015

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Zhang Y, Sui R, Chen Y, Liang H, Shi J and Piao H: Downregulation of miR‑485‑3p promotes glioblastoma cell proliferation and migration via targeting RNF135. Exp Ther Med 18: 475-482, 2019
APA
Zhang, Y., Sui, R., Chen, Y., Liang, H., Shi, J., & Piao, H. (2019). Downregulation of miR‑485‑3p promotes glioblastoma cell proliferation and migration via targeting RNF135. Experimental and Therapeutic Medicine, 18, 475-482. https://doi.org/10.3892/etm.2019.7600
MLA
Zhang, Y., Sui, R., Chen, Y., Liang, H., Shi, J., Piao, H."Downregulation of miR‑485‑3p promotes glioblastoma cell proliferation and migration via targeting RNF135". Experimental and Therapeutic Medicine 18.1 (2019): 475-482.
Chicago
Zhang, Y., Sui, R., Chen, Y., Liang, H., Shi, J., Piao, H."Downregulation of miR‑485‑3p promotes glioblastoma cell proliferation and migration via targeting RNF135". Experimental and Therapeutic Medicine 18, no. 1 (2019): 475-482. https://doi.org/10.3892/etm.2019.7600