Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
September-2020 Volume 20 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2020 Volume 20 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Role of long non‑coding RNA MALAT1 in chronic obstructive pulmonary disease

Retraction in: /10.3892/etm.2024.12740
  • Authors:
    • Tian‑Jun Hu
    • Hong‑Bo Huang
    • Hai‑Bo Shen
    • Wei Chen
    • Zhen‑Hua Yang
  • View Affiliations / Copyright

    Affiliations: Department of Thoracic Surgery, Hwa Mei Hospital, University of Chinese Academy of Sciences, Ningbo, Zhejiang 315012, P.R. China, Zhongyuan Union Clinical Laboratory Co. Ltd., Tianjin 300384, P.R. China
    Copyright: © Hu et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 2691-2697
    |
    Published online on: July 13, 2020
       https://doi.org/10.3892/etm.2020.8996
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Chronic obstructive pulmonary disease (COPD) is a pathological inflammatory condition of the lungs that is associated with high rates of mortality. Although long non‑coding RNAs (lncRNAs) serve a role in lung diseases, their functions in COPD pathogenesis are relatively unknown. The present study aimed to assess the role of differentially expressed lncRNAs in COPD. Expression profile analysis of six lncRNAs in age‑matched COPD and non‑COPD tissues were conducted. Among the six tested lncRNAs, metastasis‑associated in lung adenocarcinoma transcript 1 (MALAT1) was the most consistently overexpressed in COPD lung tissue specimens. To model COPD in vitro, human lung fibroblasts were treated with transforming growth factor‑β (TGF‑β) and MALAT1 was knocked down by small interfering RNA. This promoted cell viability and concurrently inhibited the expression of mesenchymal proteins, fibronectin and α‑smooth muscle actin. In COPD, cell senescence is linked to the activation of mammalian target of rapamycin complex 1 (mTORC1). Upon gene silencing of MALAT1 in non‑TGF‑β‑treated cells, cells demonstrated constitutive activation of mTORC1, which was assessed by the protein expression levels of mTORC1 substrate S6 kinase (S6K1). By contrast, upon MALAT1 silencing in the TGF‑β‑treated cells, mTORC1 activation was not suppressed, despite the mesenchymal cell markers protein expression levels being downregulated. Thus, lncRNA MALAT1 may represent a potent biomarker in COPD patients and may act as a target for both diagnostic and therapeutic purposes.

Introduction

Chronic obstructive pulmonary disease (COPD) is a pathological inflammatory reaction to particle and gas irritants within the lungs (1-3). There are several reasons for the development of COPD, including the inspiration of nocuous particles such as cigarette smoke and destruction of the balance between proteolytic and antiproteolytic molecules (2). It is estimated that COPD has caused >2,500,000 mortalities every year across the globe, and it is the one of the top causes of chronic morbidity and mortality in the United States of America (4,5). Current therapeutic strategies against COPD are largely ineffective; this is partly due to its late detection owing to the absence of bona fide diagnostic and prognostic molecular biomarkers (6). Because of this, it is imperative to discover and validate such markers in COPD that may be effective in therapeutic design.

Transforming growth factor-β (TGF-β) is an effective profibrotic cytokine, which promotes the expression of fibronectin and α-smooth muscle actin (α-SMA). Treatment of lung fibroblasts with TGF-β is used to induce a model for studying COPD in vitro (7). In addition, TGF-β could activate S6 kinase (S6K1) through mTOR complex 1 (mTORC1). Furthermore, in COPD, lung cell senescence is linked to mTOR activity (8).

Non-coding RNAs (ncRNAs), of two types, small (<200 kb) and long (lncRNAs; >200 kb), and are associated with tumor oncogenic and suppressive pathways (9-12). lncRNAs serve numerous functional roles, from regulatory roles in chromatin structure and function, to regulating gene expression and genomic rearrangement (13-16). The abnormal expression of lncRNAs has been reported in numerous human diseases and cancers (17-26). One previous study identified the lncRNA taurine upregulated gene 1 (TUG1) as a potential biomarker in COPD (27); however, the role of lncRNAs in COPD development remain largely unknown. The present study aimed to assess the differential expression of previously identified lncRNAs associated with lung diseases, in COPD and non-COPD lung tissues, and to investigate their potential role in COPD pathogenesis. The lncRNA metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) was demonstrated to be consistently upregulated in COPD lung tissues, and it was revealed to affect in vitro viability and the expression of fibronectin and α-SMA in HFL1 lung fibroblast cells. The results indicated that MALAT1 may serve a significant role in COPD pathogenesis.

Materials and methods

Patient studies

Ethics approval was obtained from the Institutional Review Board of the Hua Mei Hospital, University of Chinese Academy of Sciences (Ningbo, China). Written informed consent was obtained from each participant. Ten age-matched pairs of lung tissue biopsy samples were obtained from patients with COPD (8 males and 2 females; age, 60.7±21.65 years) and healthy controls (4 males and 6 females; age range, 55.7±24.60 years) at the Respiratory Department of Hwa Mei Hospital from January 2018 to December 2018. Freshly harvested tissues were submerged in RNAlater™ Stabilization Solution (Ambion; Thermo Fisher Scientific, Inc.), and then were snap frozen within 30 mins of obtaining the biopsy sample. All samples were stored frozen in liquid nitrogen until required for experimentation purposes.

Cell culture, treatment and transfection

Human fetal lung fibroblasts (HFL1; American Type Culture Collection) were cultured in F-12K medium (Thermo Fisher Scientific, Inc.) with 10% FBS (Thermo Fisher Scientific, Inc.), penicillin (100 U/ml) and streptomycin (100 µg/ml) (Thermo Fisher Scientific, Inc.), and incubated at 37˚C in a 5%CO2 incubator. HFL1 cells were pre-treated with TGF-β (5 ng/ml; R&D Systems, Inc.) for 48 h. A total of 4x104 HFL1 cells/well were transiently transfected 1 day post-seeding with non-targeting small interfering (si)RNA scrambled control (siControl; 50 nM) or with siRNA against MALAT1 (siMALAT1; 50 nM; Sigma-Aldrich; Merck KGaA) using Lipofectamine® LTX Transfection reagent (Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. siMALAT1 sequences were as follows: Sense: 5'-GAGCUUGACUUGAUUGUAUtt-3' and antisense: 5'-AUACAAUCAAGUCAAGCUCct-3', where lowercase letters were used to denote the protected region; HLF1 cells were transfected for 48 h before subsequent experimentation.

Reverse transcription-quantitative PCR (RT-qPCR)

Total RNA from the human lung tissues and HLF1 cells was isolated using the RNeasy MinElute Cleanup kit (Qiagen GmbH), according to the manufacturer's protocol. Total RNA (1 µg) was reverse transcribed into cDNA and qPCR was subsequently performed using the KAPA SYBR® FAST One-Step qRT-PCR kit. The following thermocycling conditions were used: Initial denaturation at 95˚C for 5 min; 42 cycles of 95˚C for 5 sec and 60˚C for 30 sec; and a final extension at 72˚C for 5 min. The lncRNA targets were selected based on a literature search for lncRNAs that were associated with lung disease (27-32) and included the following targets: Highly upregulated in liver cancer (HULC), nuclear enriched abundant transcript 1 (NEAT1), HOX transcript antisense RNA (HOTAIR), maternally expressed gene 3 (MEG3), MALAT1 and urothelial cancer associated 1 (UCA1). The primer pairs used for amplification in qPCR are provided in Table I. Triplicates of the assays were repeated for ≥5 times, and the relative lncRNA expression levels were quantified using the 2-ΔΔCq method. The expression levels were normalized to the internal reference gene, 18S ribosomal RNA, and are represented as the mean ± SD of the relative fold change of lncRNA in primary COPD over non-COPD lung tissue specimens.

Table I

List of primers used to amplify long non-coding RNAs.

Table I

List of primers used to amplify long non-coding RNAs.

GenePrimer sequence (5'→3')
MALAT1F: TAGGAAGACAGCAGCAGACAGG
 R: TTGCTCGCTTGCTCCTCAGT
HULCF: TCATGATGGAATTGGAGCCTT
 R: CTCTTCCTGGCTTGCAGATTG
MEG3F: GCCAAGCTTCTTGAAAGGCC
 R: TTCCACGGAGTAGAGCGAGTC
NEAT1F: TGGCTAGCTCAGGGCTTCAG
 R: TCTCCTTGCCAAGCTTCCTTC
UCA1F: CATGCTTGACACTTGGTGCC
 R: GGTCGCAGGTGGATCTCTTC
HOTAIRF: CAGTGGGGAACTCTGACTCG
 R: GTGCCTGGTGCTCTCTTACC

[i] F, forward; HOTAIR, HOX transcript antisense RNA; HULC, highly upregulated in liver cancer; MALAT1, metastasis-associated lung adenocarcinoma transcript 1; MEG3, maternally expressed 3; NEAT1, nuclear enriched abundant transcript 1; R, reverse; UCA1, urothelial cancer-associated 1.

Cell viability assay

Using a previously reported protocol, cell viability was quantified using an MTT assay (Sigma-Aldrich; Merck KGaA) according to the manufacturer's recommendations at 48 h after transfection (33). Results from three independent experiments were represented as mean ± SD.

Immunofluorescence

Immunofluorescence was performed according to a previously published protocol (34). Briefly, 1x106/ml HLF1 cells were seeded in 35-mm cell culture dishes, the cells were fixed with 4% paraformaldehyde in PBS for 20 min and permeabilized with 0.5% Triton X-100 for 5 min at room temperature, before being subsequently blocked with 4% BSA (Invitrogen; Thermo Fisher Scientific, Inc.). The cells were then incubated with the primary antibody against SMA (1:200; cat. no. ab5694; Abcam) at 4˚C for 12 h. Following the primary incubation, the slides were incubated with 2-mg/ml solution of the goat anti-mouse IgG H&L (Alexa Flour® 488) secondary antibody (cat. no. ab150117; Abcam) at 37˚C for 1 h. The nuclei were counterstained with DAPI for 5 min. Images were captured using a Zeiss LSM 510 inverted confocal microscope.

Protein extraction and western blotting

Total protein was extracted from 1x107 HLF1 cells using RIPA buffer [150 mM NaCl, 50 mM Tris-HCl (pH 7.4), 1 mM EDTA, 0.25% Na-deoxycholate, 1% NP-40, 1% protease cocktail inhibitor (cat. no. 78425; Pierce; Thermo Fisher Scientific, Ltd.), 1 mM PMSF (cat. no. 36978; Pierce; Thermo Fisher Scientific, Ltd.), 1 mM Na3VO4 (cat. no. S6508; Sigma-Aldrich; Merck KGaA), and 50 mM NaF (cat. no. S7920; Sigma-Aldrich; Merck KGaA)]. Total protein was quantified using a BCA protein assay kit (Pierce; Thermo Fisher Scientific, Ltd.), according to the manufacturer's protocol. To the loading buffer, 40 µg of protein was added and placed in a 100˚C water bath for 5 min to promote denaturation. The samples were separated by 5% SDS-PAGE. The separated proteins were transferred to PVDF membranes using a Mini Trans-Blot® Electrophoretic Transfer Cell (Bio-Rad Laboratories, Inc.). Subsequently, the PVDF membranes were blocked for 0.5 h in 5% dry fat-free milk in TBS + 0.1% Tween 20 on ice. The membranes were incubated with primary antibodies against α-SMA (cat. no. 19245), phosphorylated (p) ribosomal S6K1 on threonine 389 (p-S6K1; cat. no. 97596; 1:1,000; Cell Signaling Technology, Inc.); S6K1 (cat. no. 2708; 1:1,000; Cell Signaling Technology, Inc.), fibronectin (cat. no. ab32419; 1:1,000; Abcam) and GAPDH (cat. no. ab181602; 1:1,000; Abcam) at room temperature for 1.5 h and were subsequently washed 3 times in 5% TBST for 5 mins. This was followed by incubation with an HRP-conjugated secondary antibody anti-rabbit IgG (cat. no. ZB-2301; 1:2,000; OriGene Technologies) at room temperature for 1 h. Following 3 washes in 5% TBST, protein bands were visualized with Pierce™ ECL Western Blotting substrate (Thermo Fisher Scientific, Inc.) and analyzed by the Image Lab™ Software (Bio-Rad Laboratories, Inc.).

Statistical analysis

Statistical analyses were performed using SPSS 22.0 (IBM Corp.) and figures were produced using GraphPad Prism 7.0 (GraphPad Software, Inc.). Statistical significance was determined using an ANOVA followed by Tukey's post hoc test for the differences in lncRNA expression between paired tissue samples. All experimental data are presented as the mean ± SD of at least three independent experiments. P<0.05 was considered to indicate a statistically significant difference.

Results

LncRNA expression in primary lung disease and matched lymph node metastatic tissues

The expression levels of six lncRNAs (HULC, NEAT1, HOTAIR, MEG3, MALAT1, UCA1), which were previously reported to serve a role in a variety of lung diseases (29-33,35), were determined by RT-qPCR in three pairs of age-matched primary lung tissue obtained from COPD or non-COPD subjects. Of the six lncRNAs examined, MALAT1 (54.67±4.72 vs. 3.33±1.52 fold change in COPD and non-COPD, respectively; P<0.001) and MEG3 (19.67±16.29 vs. 6.00±2.64 fold change in COPD and non-COPD, respectively; P<0.01) were overexpressed in the COPD lung tissues (Fig. 1A), which suggested that the expression of these lncRNAs may be associated with COPD pathogenesis. Of note, the SD of MEG3 expression was high, suggesting highly varied expression levels in the three tissues examined. To further confirm these results, the expression levels of MEG3 and MALAT1 were explored in 10 age-matched COPD and non-COPD subjects. MALAT1 expression was consistently higher in COPD lung tissues compared to non-COPD tissue (Fig. 1A), whereas MEG3 expression varied and even demonstrated reduced expression levels in a number of COPD patients (Fig. 1B). These data indicated that MALAT1 may be a robust biomarker for COPD.

Figure 1

lncRNA MALAT1 is upregulated in the lung tissue of patients with COPD. (A) Gene expression profiles of lncRNAs in age-matched COPD and non-COPD lung tissues. RT-qPCR was performed on six lncRNAs in three pairs of age-matched COPD and non-COPD lung tissues. Data was normalized to 18S rRNA expression and presented as the mean ± SD. (B) Expression of MALAT1 and MEG3 lncRNAs in 10 pairs of age-matched COPD and non-COPD lung tissues, assessed by RT-qPCR. **P<0.01 and ***P<0.001 vs. non-COPD group. COPD, chronic obstructive pulmonary disorder; HOTAIR, HOX transcript antisense RNA; HULC, highly upregulated in liver cancer; lncRNA, long non-coding RNA; MALAT1, metastasis-associated lung adenocarcinoma transcript 1; MEG3, maternally expressed 3; NEAT1, nuclear enriched abundant transcript 1; rRNA, ribosomal RNA; RT-qPCR, reverse transcription-quantitative PCR; UCA1, urothelial cancer associated 1.

Gene silencing of MALAT1 affects the viability of HFL1 cells following TGF-β pretreatment

siRNA-mediated silencing of MALAT1 expression was used to determine whether MALAT1 can alter the viability of HFL1 cells. Transient transfection of HFL1 with siMALAT1 decreased MALAT1 expression by 80% 48 h post-transfection compared with the siControl (P<0.001; Fig. 2A). In addition, to determine whether TGF-β treatment could affect cell viability, HFL1 cells were exposed to TGF-β (5 ng/ml) pretreatment for 48 h. The viability of HFL1 cells treated with TGF-β and transfected with siMALAT1 was significantly increased compared with HFL1 cells treated with TGF-β + siControl (P<0.05; Fig. 2B). The above results showed that MALAT1 silencing could improve the viability of HFL1 cells following TGF-β pretreatment.

Figure 2

Gene silencing of lncRNA MALAT1 affects the viability of HFL1 cells following TGF-β pretreatment. (A) Relative expression levels of lncRNA MALAT1 in HFL1 cells transfected with siControl or siMALAT1 were measured by reverse transcription-quantitative PCR. (B) Viability of HFL1 cells transfected with siControl or siMALAT with or without TGF-β pretreatment were detected with the MTT assay. Data were normalized to 18S rRNA expression and presented as the mean ± SD. ***P<0.001 vs. siControl; #P<0.05 vs. siControl + TGF-β group. HFL1, human fetal lung fibroblast 1; lncRNA, long non-coding RNA; MALAT1, metastasis-associated lung adenocarcinoma transcript 1; rRNA, ribosomal RNA; si, small interfering RNA; TGF-β, transforming growth factor-β.

Downregulation of MALAT1 expression attenuates α-SMA and fibronectin protein expression in HFL1 cells

The protein expression levels of α-SMA and fibronectin in siControl- or siMALAT1-transfected HFL1 cells co-treated with or without TGF-β was determined. Immunofluorescence revealed that silencing MALAT1 gene expression markedly decreased α-SMA protein expression following TGF-β treatment of HFL1 cells (Fig. 3). TGF-β treatment induced the protein expression of α-SMA and fibronectin in HFL1 cells, which was attenuated following silencing of MALAT1 gene expression (Fig. 4). Since TGF-β-mediated induction of fibronectin and α-SMA is driven through mTORC1(36), the levels of p-S6K1, a marker of mTORC1 activation, were evaluated. P-S6K1 (T389) protein expression markedly increased in HFL1 cells treated with TGF-β; however, in HFL1 cells transfected with siMALAT1, no change was observed in p-S6K1 protein expression compared with HFL1 cells transfected with siMALAT1 + TGF-β (Fig. 4). These data suggested that MALAT1 gene silencing downregulated α-SMA and fibronectin without inhibiting mTORC1. Notably, p-S6K1 protein expression was detected in HFL1 cells transfected with siMALAT1, but untreated with TGF-β, which indicated that MALAT1 gene silencing may induce mTORC1 activation. The reason for decreased α-SMA and fibronectin protein expression remains to be determined.

Figure 3

Silencing MALAT1 decreases α-SMA protein expression following TGF-β treatment of HFL1 cells. Immunofluorescent staining to detect the relative protein expression of α-SMA in HFL1 cells treated with TGF-β for 48 h and transfected with siControl or siMALAT1. Nuclei were stained with DAPI. Scale bar, 100 µm. Images are representative of ≥10 different images obtained within the experimental set. α-SMA, α-smooth muscle actin; HFL1, human fetal lung fibroblast 1; MALAT1, metastasis associated lung adenocarcinoma transcript 1; siRNA, small interfering RNA; TGF-β, transforming growth factor-β.

Figure 4

Gene silencing of MALAT1 suppresses the protein expression levels of α-SMA and fibronectin in HFL1 cells. (A) siMALAT1 transfection inhibited the expression levels of α-SMA and fibronectin protein, whereas TGF-β promoted the expression levels of α-SMA and fibronectin protein. (B) The relative expression levels of α-SMA and fibronectin normalized to GAPDH, and the ratio of P-S6K1 (T389) to total S6K1 formalized to GAPDH. GAPDH was used as a loading control and for normalization. *P<0.05 and ***P<0.001 vs. siControl; #P<0.05 vs. siControl + TGF-β group. α-SMA, α-smooth muscle actin; MALAT1, metastasis-associated lung adenocarcinoma transcript 1; p, phosphorylated; S6K1, mTOR complex 1 S6 kinase; si, small interfering RNA; T, total; TGF-β, transforming growth factor-β.

Discussion

Previous studies have demonstrated that lncRNAs serve a vital role in gene regulatory processes, and that they can affect normal and transformed cellular functions (36,37). Although lncRNAs do not encode proteins, numerous studies have revealed that they regulate the process of transcription (38,39), indicating that differences detected in the expression of lncRNAs between normal and diseased tissues are not a secondary readout for physiological changes. Given the symptomatic exacerbation observed in COPD patients, and the high cost-of-burden of the disease, it is of vital importance to gain a better understanding of the underlying mechanisms of COPD pathogenesis (40-43). ncRNAs can negatively regulate gene expression at the post-transcriptional level and serve crucial regulatory roles in a number of biological processes, and the altered expression of these ncRNAs has been demonstrated to lead to inflammation and COPD (44). However, there is inadequate data on the expression profile of lncRNAs in COPD (26). A previous study reported that the lncRNAs AJ005396 and S69206 are overexpressed in fibrotic lung tissue (45), and that lncRNAs, such as X inactive specific transcript, HOTAIR and MALAT1, are aberrantly expressed in the bronchial epithelium of cystic fibrosis patients (46). MALAT1 is reportedly overexpressed in, and contributes to the poor prognosis of, non-small cell lung cancer (47). Bi et al (48) compared the lncRNA expression profile in lung tissue from non-smokers and smokers with or without COPD; 120 lncRNAs were revealed to be upregulated and 43 downregulated in smokers with COPD compared with smokers without COPD. However, the study is limited owing to a small sample size and the use of male subjects only. Thus, additional larger studies with both sexes are warranted. lncRNAs associated with COPD are largely unknown; thus, the present study profiled the expression of six lncRNAs (HULC, NEAT1, HOTAIR, MEG3, MALAT1, and UCA1) based on those that were previously demonstrated to be associated with a variety of lung diseases (30-35), and MALAT1 was identified as a potential biomarker of COPD.

The mechanism by which MALAT1 facilitates the pathogenesis of COPD with TGF-β induction may be similar to a previous study that examined the lncRNA TUG1 in COPD patients (28). Thus, it would be worthwhile to determine the effect of MALAT1 in combination with TUG1 and its effect on COPD diagnosis. In addition, previous studies revealed that the aggressive malignant characteristics of lung cancer are attributed to lncRNAs, such as MALAT1 (24,47). Thus, these studies clearly link MALAT1 with lung disease.

TGF-β signaling participates in COPD pathogenesis (49). α-SMA and fibronectin are both mesenchymal markers that are stimulated by TGF-β in vitro (27), and were demonstrated in the present study to decrease in HFL1 cells when MALAT1 gene expression was silenced. Notably, the results indicated that the TGF-β-mediated induction of these proteins occurred alongside mTORC1 activation. However, the downregulation of α-SMA and fibronectin that was observed following MALAT1 silencing occurred independently of mTORC1, because p-S6K1 protein expression was not affected. In fact, the silencing of MALAT1 induced the phosphorylation of S6K1 in the HFL1 cells which were not treated with TGF-β, suggesting that the loss of MALAT1 expression might permit mTORC1 signaling in the absence of TGF-β. This indicated the potential existence of a complicated upstream interaction between TGF-β signaling, MALAT1 regulation and mTORC1 activation. This mechanism warrants further investigation in the setting of COPD, because there is evidence in other diseases that MALAT1 is a crucial player in disease processes; for example, in bladder cancer, MALAT1 downregulation inhibits the viability and invasive properties of bladder cancer cells by attenuating autophagy via the regulation of the AMP-activated protein kinase/mTOR pathway (50).

In conclusion, lncRNA MALAT1 is upregulated in patients with COPD, and the downregulation of MALAT1 induced cellular viability following TGF-β stimulation in HFL1 cells. MALAT1 was indicated to serve a regulatory role in the mTOR pathway, and is related to the mesenchymal protein expression. Together, these data suggested that MALAT1 may serve as a target for understanding the pathogenesis of COPD. Although further investigations are required to assess the function of MALAT1, and its target genes and associated regulatory mechanism in COPD, the present study provides a foundation for further exploration into the role of this lncRNA in COPD.

Acknowledgements

Not applicable.

Funding

No funding was received.

Availability of data and materials

The datasets used and analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

TJH and ZHY designed the experiments; HBH and WC performed the experiments; and HBS collected the samples used in the studies. The manuscript was prepared by TJH. The final manuscript was read and approved by all the authors.

Ethics approval and consent to participate

Ethics approval was obtained from the Institutional Review Board of the Hua Mei Hospital, University of Chinese Academy of Sciences (Ningbo, China). Written informed consent was obtained from all participants.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Demedts IK, Demoor T, Bracke KR, Joos GF and Brusselle GG: Role of apoptosis in the pathogenesis of COPD and pulmonary emphysema. Respir Res. 7(53)2006.PubMed/NCBI View Article : Google Scholar

2 

Demedts IK, Brusselle GG, Bracke KR, Vermaelen KY and Pauwels RA: Matrix metalloproteinases in asthma and COPD. Curr Opin Pharmacol. 5:257–263. 2005.PubMed/NCBI View Article : Google Scholar

3 

Barnes PJ, Shapiro SD and Pauwels RA: Chronic obstructive pulmonary disease: Molecular and cellularmechanisms. Eur Respir J. 22:672–688. 2003.PubMed/NCBI View Article : Google Scholar

4 

Pauwels RA, Buist AS, Calverley PM, Jenkins CR and Hurd SS: GOLD Scientific Committee. Global strategy for the diagnosis, management, and prevention of chronic obstructive pulmonary disease. NHLBI/WHO global initiative for chronic obstructive lung disease (GOLD) workshop summary. Am J Respir Crit Care Med. 163:1256–1276. 2001.PubMed/NCBI View Article : Google Scholar

5 

Pauwels RA and Rabe KF: Burden and clinical features of chronic obstructive pulmonary disease (COPD). Lancet. 364:613–620. 2004.PubMed/NCBI View Article : Google Scholar

6 

Lahzami S and Aubert JD: Lung transplantation for COPD-evidence-based. Swiss Med Wkly. 139:4–8. 2009.PubMed/NCBI

7 

Chilosi M, Poletti V and Rossi A: The pathogenesis of COPD and IPF: Distinct horns of the same devil? Respir Res. 13(3)2012.PubMed/NCBI View Article : Google Scholar

8 

Houssaini A, Breau M, Kebe K, Abid S, Marcos E, Lipskaia L, Rideau D, Parpaleix A, Huang J, Amsellem V, et al: mTOR pathway activation drives lung cell senescence and emphysema. JCI Insight. 3(pii: 93203)2018.PubMed/NCBI View Article : Google Scholar

9 

Malone CD and Hannon GJ: Small RNAs as guardians of the genome. Cell. 136:656–668. 2009.PubMed/NCBI View Article : Google Scholar

10 

Moazed D: Small RNAs in transcriptional gene silencing and genome defence. Nature. 457:413–420. 2009.PubMed/NCBI View Article : Google Scholar

11 

Brosnan CA and Voinnet O: The long and the short of noncoding RNAs. Curr Opin Cell Biol. 21:416–425. 2009.PubMed/NCBI View Article : Google Scholar

12 

Mattick JS: Non-coding RNAs: The architects of eukaryotic complexity. EMBO Rep. 2:986–991. 2001.PubMed/NCBI View Article : Google Scholar

13 

Rinn JL, Kertesz M, Wang JK, Squazzo SL, Xu X, Brugmann SA, Goodnough LH, Helms JA, Farnham PJ, Segal E and Chang HY: Functional demarcation of active and silent chromatin domains in human HOX loci by noncoding RNAs. Cell. 129:1311–1323. 2007.PubMed/NCBI View Article : Google Scholar

14 

Kim A, Zhao H, Ifrim I and Dean A: Beta-globin intergenic transcription and histone acetylation dependent on an enhancer. Mol Cell Biol. 27:2980–2986. 2007.PubMed/NCBI View Article : Google Scholar

15 

Managadze D, Rogozin IB, Chernikova D, Shabalina SA and Koonin EV: Negative correlation between expression level and evolutionary rate of long intergenic noncoding RNAs. Genome Biol Evol. 3:1390–1404. 2011.PubMed/NCBI View Article : Google Scholar

16 

Krangel MS: T cell development: Better living through chromatin. Nat Immunol. 8:687–694. 2007.PubMed/NCBI View Article : Google Scholar

17 

Srikantan V, Zou Z, Petrovics G, Xu L, Augustus M, Davis L, Livezey JR, Connell T, Sesterhenn IA, Yoshino K, et al: PCGEM1, a prostate-specific gene, is overexpressed in prostate cancer. Proc Natl Acad Sci USA. 97:12216–12221. 2000.PubMed/NCBI View Article : Google Scholar

18 

Bussemakers MJ, van Bokhoven A, Verhaegh GW, Smit FP, Karthaus HF, Schalken JA, Debruyne FM, Ru N and Isaacs WB: DD3: A new prostate-specific gene, highly overexpressed in prostate cancer. Cancer Res. 59:5975–5979. 1999.PubMed/NCBI

19 

Petrovics G, Zhang W, Makarem M, Street JP, Connelly R, Sun L, Sesterhenn IA, Srikantan V, Moul JW and Srivastava S: Elevated expression of PCGEM1, a prostate-specific gene with cell growth-promoting function, is associated with high-risk prostate cancer patients. Oncogene. 23:605–611. 2004.PubMed/NCBI View Article : Google Scholar

20 

Iacoangeli A, Lin Y, Morley EJ, Muslimov IA, Bianchi R, Reilly J, Weedon J, Diallo R, Böcker W and Tiedge H: BC200 RNA in invasive and preinvasive breast cancer. Carcinogenesis. 25:2125–2133. 2004.PubMed/NCBI View Article : Google Scholar

21 

Gupta RA, Shah N, Wang KC, Kim J, Horlings HM, Wong DJ, Tsai MC, Hung T, Argani P, Rinn JL, et al: Long non-coding RNA HOTAIR reprograms chromatin state to promote cancer metastasis. Nature. 464:1071–1076. 2010.PubMed/NCBI View Article : Google Scholar

22 

Taft RJ, Pang KC, Mercer TR, Dinger M and Mattick JS: Non-coding RNAs: Regulators of disease. J Pathol. 220:126–139. 2010.PubMed/NCBI View Article : Google Scholar

23 

Klattenhoff CA, Scheuermann JC, Surface LE, Bradley RK, Fields PA, Steinhauser ML, Ding H, Butty VL, Torrey L, Haas S, et al: Braveheart, a long noncoding RNA required for cardiovascular lineage commitment. Cell. 152:570–583. 2013.PubMed/NCBI View Article : Google Scholar

24 

Gutschner T, Hämmerle M, Eissmann M, Hsu J, Kim Y, Hung G, Revenko A, Arun G, Stentrup M, Gross M, et al: The noncoding RNA MALAT1 is a critical regulator of the metastasis phenotype of lung cancer cells. Cancer Res. 73:1180–1189. 2013.PubMed/NCBI View Article : Google Scholar

25 

Johnson R: Long non-coding RNAs in Huntington's disease neurodegeneration. Neurobiol Dis. 46:245–254. 2012.PubMed/NCBI View Article : Google Scholar

26 

Congrains A, Kamide K, Oguro R, Yasuda O, Miyata K, Yamamoto E, Kawai T, Kusunoki H, Yamamoto H, Takeya Y, et al: Genetic variants at the 9p21 locus contribute to atherosclerosis through modulation of ANRIL and CDKN2A/B. Atherosclerosis. 220:449–455. 2012.PubMed/NCBI View Article : Google Scholar

27 

Tang W, Shen Z, Guo J and Sun S: Screening of long non-coding RNA and TUG1 inhibits proliferation with TGF-β induction in patients with COPD. Int J Chron Obstruct Pulmon Dis. 11:2951–2964. 2016.PubMed/NCBI View Article : Google Scholar

28 

Li JY, Chen XX, Lu XH, Zhang CB, Shi QP and Feng L: Elevated RBP4 plasma levels were associated with diabetic retinopathy in type 2 diabetes. Biosci Rep. 38(pii: BSR20181100)2018.PubMed/NCBI View Article : Google Scholar

29 

Li S, Mei Z, Hu HB and Zhang X: The lncRNA MALAT1 contributes to non-small cell lung cancer development via modulating miR-124/STAT3 axis. J Cell Physiol. 233:6679–6688. 2018.PubMed/NCBI View Article : Google Scholar

30 

Sun C, Li S, Zhang F, Xi Y, Wang L, Bi Y and Li D: Long non-coding RNA NEAT1 promotes non-small cell lung cancer progression through regulation of miR-377-3p-E2F3 pathway. Oncotarget. 7:51784–51814. 2016.PubMed/NCBI View Article : Google Scholar

31 

Nie W, Ge HJ, Yang XQ, Sun X, Huang H, Tao X, Chen WS and Li B: LncRNA-UCA1 exerts oncogenic functions in non-small cell lung cancer by targeting miR-193a-3p. Cancer Lett. 371:99–106. 2016.PubMed/NCBI View Article : Google Scholar

32 

Loewen G, Jayawickramarajah J, Zhuo Y and Shan B: Functions of lncRNA HOTAIR in lung cancer. J Hematol Oncol. 7(90)2014.PubMed/NCBI View Article : Google Scholar

33 

Yu G, Liu J, Xu K and Dong J: Uncoupling protein 2 mediates resistance to gemcitabine-induced apoptosis in hepatocellular carcinoma cell lines. Biosci Rep. 35(pii: e00231)2015.PubMed/NCBI View Article : Google Scholar

34 

Xia S, Ji R and Zhan W: Long noncoding RNA papillary thyroid carcinoma susceptibility candidate 3 (PTCSC3) inhibits proliferation and invasion of glioma cells by suppressing the Wnt/β-catenin signaling pathway. BMC Neurol. 17(30)2017.PubMed/NCBI View Article : Google Scholar

35 

Zhong Y, Chen Z, Guo S, Liao X, Xie H, Zheng Y, Cai B, Huang P, Liu Y, Zhou Q, et al: TUG1, SPRY4-IT1, and HULC as valuable prognostic biomarkers of survival in cancer: A PRISMA-compliant meta-analysis. Medicine (Baltimore). 96(e8583)2017.PubMed/NCBI View Article : Google Scholar

36 

Perez DS, Hoage TR, Pritchett JR, Ducharme-Smith AL, Halling ML, Ganapathiraju SC, Streng PS and Smith DI: Long, abundantly expressed non-coding transcripts are altered in cancer. Hum Mol Genet. 17:642–655. 2008.PubMed/NCBI View Article : Google Scholar

37 

Guttman M, Donaghey J, Carey BW, Garber M, Grenier JK, Munson G, Young G, Lucas AB, Ach R, Bruhn L, et al: lincRNAs act in the circuitry controlling pluripotency and differentiation. Nature. 477:295–300. 2011.PubMed/NCBI View Article : Google Scholar

38 

Ponting CP, Oliver PL and Reik W: Evolution and functions of long noncoding RNAs. Cell. 136:629–641. 2009.PubMed/NCBI View Article : Google Scholar

39 

Moseley ML, Zu T, Ikeda Y, Gao W, Mosemiller AK, Daughters RS, Chen G, Weatherspoon MR, Clark HB, Ebner TJ, et al: Bidirectional expression of CUG and CAG expansion transcripts and intranuclear polyglutamine inclusions in spinocerebellar ataxia type 8. Nat Genet. 38:758–769. 2006.PubMed/NCBI View Article : Google Scholar

40 

Standards for the diagnosis and care of patients with chronic obstructive pulmonary disease. American Thoracic Society. Am J Respir Crit Care Med 152: S77-S121, 1995.

41 

Buist AS: Guidelines for the management of chronic obstructive pulmonary disease. Respir Med. 96 (Suppl C):S11–S16. 2002.PubMed/NCBI View Article : Google Scholar

42 

Jones PW, Quirk FH, Baveystock CM and Littlejohns P: A self-complete measure of health status for chronic airflow limitation. The St. George's Respiratory Questionnaire. Am Rev Respir Dis. 145:1321–1327. 1992.PubMed/NCBI View Article : Google Scholar

43 

Seemungal TA, Donaldson GC, Paul EA, Bestall JC, Jeffries DJ and Wedzicha JA: Effect of exacerbation on quality of life in patients with chronic obstructive pulmonary disease. Am J Respir Crit Care Med. 157:1418–1422. 1998.PubMed/NCBI View Article : Google Scholar

44 

De Smet EG, Mestdagh P, Vandesompele J, Brusselle GG and Bracke KR: Non-coding RNAs in the pathogenesis of COPD. Thorax. 70:782–791. 2015.PubMed/NCBI View Article : Google Scholar

45 

Cao G, Zhang J, Wang M, Song X, Liu W, Mao C and Lv C: Differential expression of long non-coding RNAs in bleomycin-induced lung fibrosis. Int J Mol Med. 32:355–364. 2013.PubMed/NCBI View Article : Google Scholar

46 

McKiernan PJ, Molloy K, Cryan SA, McElvaney NG and Greene CM: Long noncoding RNA are aberrantly expressed in vivo in the cystic fibrosis bronchial epithelium. Int J Biochem Cell Biol. 52:184–191. 2014.PubMed/NCBI View Article : Google Scholar

47 

Ji P, Diederichs S, Wang W, Böing S, Metzger R, Schneider PM, Tidow N, Brandt B, Buerger H, Bulk E, et al: MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer. Oncogene. 22:8031–8041. 2003.PubMed/NCBI View Article : Google Scholar

48 

Bi H, Zhou J, Wu D, Gao W, Li L, Yu L, Liu F, Huang M, Adcock IM, Barnes PJ and Yao X: Microarray analysis of long non-coding RNAs in COPD lung tissue. Inflamm Res. 64:119–126. 2015.PubMed/NCBI View Article : Google Scholar

49 

Borovikova LV, Ivanova S, Zhang M, Yang H, Botchkina GI, Watkins LR, Wang H, Abumrad N, Eaton JW and Tracey KJ: Vagus nerve stimulation attenuates the systemic inflammatory response to endotoxin. Nature. 405:458–462. 2000.PubMed/NCBI View Article : Google Scholar

50 

Qi JD, Chu YF, Zhang GY, Li HJ, Yang DD and Wang Q: Down-regulated LncR-MALAT1 suppressed cell proliferation and migration by inactivating autophagy in bladder cancer. RSC Adv. 8:31019–31027. 2018.

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Hu TJ, Huang HB, Shen HB, Chen W and Yang ZH: Role of long non‑coding RNA MALAT1 in chronic obstructive pulmonary disease Retraction in /10.3892/etm.2024.12740. Exp Ther Med 20: 2691-2697, 2020.
APA
Hu, T., Huang, H., Shen, H., Chen, W., & Yang, Z. (2020). Role of long non‑coding RNA MALAT1 in chronic obstructive pulmonary disease Retraction in /10.3892/etm.2024.12740. Experimental and Therapeutic Medicine, 20, 2691-2697. https://doi.org/10.3892/etm.2020.8996
MLA
Hu, T., Huang, H., Shen, H., Chen, W., Yang, Z."Role of long non‑coding RNA MALAT1 in chronic obstructive pulmonary disease Retraction in /10.3892/etm.2024.12740". Experimental and Therapeutic Medicine 20.3 (2020): 2691-2697.
Chicago
Hu, T., Huang, H., Shen, H., Chen, W., Yang, Z."Role of long non‑coding RNA MALAT1 in chronic obstructive pulmonary disease Retraction in /10.3892/etm.2024.12740". Experimental and Therapeutic Medicine 20, no. 3 (2020): 2691-2697. https://doi.org/10.3892/etm.2020.8996
Copy and paste a formatted citation
x
Spandidos Publications style
Hu TJ, Huang HB, Shen HB, Chen W and Yang ZH: Role of long non‑coding RNA MALAT1 in chronic obstructive pulmonary disease Retraction in /10.3892/etm.2024.12740. Exp Ther Med 20: 2691-2697, 2020.
APA
Hu, T., Huang, H., Shen, H., Chen, W., & Yang, Z. (2020). Role of long non‑coding RNA MALAT1 in chronic obstructive pulmonary disease Retraction in /10.3892/etm.2024.12740. Experimental and Therapeutic Medicine, 20, 2691-2697. https://doi.org/10.3892/etm.2020.8996
MLA
Hu, T., Huang, H., Shen, H., Chen, W., Yang, Z."Role of long non‑coding RNA MALAT1 in chronic obstructive pulmonary disease Retraction in /10.3892/etm.2024.12740". Experimental and Therapeutic Medicine 20.3 (2020): 2691-2697.
Chicago
Hu, T., Huang, H., Shen, H., Chen, W., Yang, Z."Role of long non‑coding RNA MALAT1 in chronic obstructive pulmonary disease Retraction in /10.3892/etm.2024.12740". Experimental and Therapeutic Medicine 20, no. 3 (2020): 2691-2697. https://doi.org/10.3892/etm.2020.8996
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team