Introduction
Nephrotic syndrome is a disease with a complicated
mechanism related to various causes, and it frequently occurs in
women and children (1,2). The pathogenesis of nephrotic syndrome
is related to immune factors (3)
mainly involving glomeruli, thereby causing changes in its
permeability and massive proteinuria, hypoproteinemia and other
symptoms, but the specific mechanism is still unclear. Nephrotic
syndrome can be divided into many pathological types according to
the specific injury sites and causes. The pathogenesis of each type
is relatively different, resulting in complicated and unpredictable
occurrence and progression of the disease (4). Primary nephrotic syndrome is defined
as nephrotic syndrome, excluding diabetes, systemic lupus
erythematosus, adverse drug reactions and other secondary factors.
The secretion imbalance of various cytokines such as interleukin-2
(IL-2) and IL-4 may be an important reason for the occurrence and
progression of primary nephrotic syndrome (5).
Gene polymorphisms refer to the condition that
alleles at the same locus of each biological individual may be
different, which leads to different genotypes, thus affecting the
release of some key substances or important metabolites in the
body, and even changing the individual's susceptibility to certain
diseases (6,7). The importance of gene polymorphisms in
influencing the occurrence of diseases has been proved in various
diseases. For example, rs2108622 of CYP4F2 gene is related to the
susceptibility to hypertension (8),
SEMA3 gene polymorphism is associated with Hirschsprung's disease
(9), and PEAR1 gene polymorphism is
associated with pulmonary embolism (10). Tumor necrosis factor-α (TNF-α) and
IL-10 are important cytokines with a wide range of biological
effects, which affect the immune environment. Their synthesis is
affected by genetic factors (gene polymorphism). The gene
polymorphisms of TNF-α and IL-10 may be related to the
susceptibility and development of immune diseases, but their
correlations with primary nephrotic syndrome have not been
reported.
Polymorphism at rs1799724 and rs1800629 of the TNF-α
gene promoter has been linked to increased TNF transcription,
earlier study showing an increase of TNF-α synthesis and gene
expression in primary nephrotic syndrome (11). IL-10 promoter variants rs1800872 and
rs141219090 were associated with an increased risk of IgAN
(12). Therefore, in this study,
the polymorphisms and haplotypes of TNF-α gene rs1799724 and
rs1800629 and IL-10 gene rs1800872 and rs141219090 in the
peripheral blood nucleated cells of primary nephrotic syndrome
patients before treatment and healthy people were analyzed, and the
correlations of TNF-α and IL-10 gene polymorphisms with
susceptibility and the condition of primary nephrotic syndrome were
explored based on renal function-related clinical indexes of each
research subject.
Patients and methods
General data
A total of 200 patients with primary nephrotic
syndrome (disease group) and 200 healthy people (control group)
from the Physical Examination Center in the hospital from 2017 to
date were taken as the research subjects. The basic and clinical
data of patients, including name, sex, admission ID, age, height,
weight, family history and drug allergy history were collected in
the disease and control group. Disease group included 53 males and
147 females with an average age of 46.12±3.41 years, while control
group included 60 males and 140 females, with an average age of
43.92±4.73 years. There were no statistically significant
differences in age, sex distribution and other general data between
the disease and control group.
Diagnostic criteria for primary nephrotic syndrome
in disease group: 24-h urine protein ≥3.5 g, hypoalbuminemia,
plasma albumin ≤30 g/l, lipid metabolism disorder, hyperlipidemia,
hematuresis, red blood cells detected in urine sediment microscopy,
excluding diabetes, systemic lupus erythematosus, adverse drug
reactions and other secondary factors, and confirmed by
percutaneous renal biopsy, including minimal change disease (n=69),
membranous nephropathy (n=42), focal segmental glomurular sclerosis
(n=39), mesangial proliferative glomerulonephritis (n=30), IgA
nephropathy (n=9) and others (n=11). The study was approved by the
Ethics Committee of Qilu Hospital of Shandong University (Jinan,
China). Signed informed consents were obtained from all
participants before the study.
Sample collection and processing
A total of ~6-8 ml of peripheral blood was collected
from patients in disease group and control group by nurses on duty
in our department. Then the blood was centrifuged at 4̊C, 3,450 x g
for 8 min within 2 h to separate the upper serum and the nucleated
cells in the middle layer into new centrifuge tubes, respectively.
Serum in the upper layer was stored in liquid nitrogen for
detection, and the genomic deoxyribonucleic acids (DNAs) were
extracted from the nucleated cells in the middle layer.
Genomic DNA extraction
Genomic DNAs in the peripheral blood in disease
group and control group were extracted using Tiangen blood genomic
extraction kit (Tiangen Biotech). All steps were strictly carried
out according to the standard operation of the kit as follows: The
centrifuge tube was added with an appropriate amount of protein K
solution according to the sample volume, peripheral blood samples
and buffer GE. Then mixed evenly using a vortex oscillator for 30
sec, and the samples were incubated at 65˚C for 8 min. Then the
samples were added with 2 ml of anhydrous ethanol, mixed well and
transferred to the adsorption column. After that, 2 ml of the
buffer was added to the adsorption column for centrifugation at
4̊C, 3,850 x g for 1 min. Subsequently, 200 µl of elution buffer
was added to the adsorption column, and the obtained solution was
the genomic DNA of research subjects.
Polymerase chain reaction (PCR)
amplification and analysis of TNF-α and IL-10 gene
polymorphisms
The polymorphic regions at rs1799724 and rs1800629
of TNF-α gene and at rs1800872 and rs141219090 of IL-10 gene were
amplified using PCR apparatus. The total PCR system was 25 µl,
including primers (1 µl each), template DNAs (0.5 µl),
high-fidelity thermostable Taq enzymes (12.5 µl) and
dH2O (10 µl). PCR conditions: 96˚C for 5 min, (96˚C for
30 sec, 56˚C for 45 sec and 72˚C for 35 sec) x 45 cycles and 72˚C
for 5 min. Primers for polymorphic loci: TNF-α gene rs1799724: F:
(5'→3')'CCTCTCTCTAATCAGCCCTCTG' and R:
(5'→3')'GAGGACCTGGGAGTAGATGAG', TNF-α gene rs1800629: F:
(5'→3')'GAGGCCAAGCCCTGGTATG' and R: (5'→3')'CGGGCCGATTGATCTCAGC',
IL-10 gene rs1800872: F: (5'→3')'CAGGCGGTGCCTATGTCTC' and R:
(5'→3')'CGATCACCCCGAAGTTCAGTAG', and IL-10 gene rs141219090: F:
(5'→3')'CTGAACTTCGGGGTGATCGG' and R:
(5'→3')'GGCTTGTCACTCGAATTTTGAGA'. PCR products were sent to
Zhejiang Biotechnology Co., Ltd. for sequencing via Sanger
technology, and the genotype and allele frequencies were obtained
by comparing the sequence with reference sequence using Seqman
software in DNAStar software. TNF-α and IL-10 gene polymorphisms in
disease group and control group were obtained.
Detection of plasma TNF-α and
IL-10
Plasma TNF-α and IL-10 levels in the peripheral
blood of patients in disease group and control group were detected
by enzyme-linked immunosorbent assay (ELISA) (R&D Systems,
Inc.). Plasma TNF-α and IL-10 levels were detected using commercial
ELISA kit (R&D Systems, Inc.). The experimental procedures were
strictly carried out in accordance with the kit instructions, and
standard wells were set, with 3 replicates for each patient. After
the experiment, the absorbance value in the 96-well plate was read
using a microplate reader (Bio-Rad), and the plasma TNF-α and IL-10
concentrations of each research subject were converted according to
the standard curve.
Detection of clinical indicators
Clinical indicators, 24-h urine protein, plasma
albumin and creatinine of patients in disease group and control
group were detected in the Clinical Laboratory of the hospital.
24-h urine protein was detected in the clinical examination room
within 24 h using the urine of subjects, while plasma albumin and
creatinine were detected in the biochemical room using plasma.
Statistical analysis
Statistical Product and Service Solutions (SPSS)
23.0 (IBM Corp.) was adopted for statistical analysis. Comparisons
of count data were conducted by the χ2 test, and
Hardy-Weinberg equilibrium analysis was carried out. The haplotype
analysis was conducted on line through SHEsis website. Comparisons
of quantitative data among multiple groups was performed using
one-way analysis of variance test followed by Bonferroni as the
post hoc test, and P<0.05 suggested that the difference was
statistically significant.
Results
Allele distributions at rs1799724 and
rs1800629 of TNF-α gene and at rs1800872 and rs141219090 of IL-10
gene
Allele distributions at rs1799724 and rs1800629 of
TNF-α gene and at rs1800872 and rs141219090 of IL-10 gene are shown
in Table I. It was found that
allele distributions at rs1799724 (P=0.003) and rs1800629 (P=0.011)
of TNF-α gene and at rs1800872 (P=0.033) of IL-10 gene in disease
group were different from those in the control group. Among them,
in disease group, allele C frequency at rs1799724 and allele A
frequency at rs1800629 of TNF-α gene and allele T frequency at
rs1800872 of IL-10 gene were higher.
 | Table IAllele distributions at rs1799724 and
rs1800629 of TNF-α gene and at rs1800872 and rs141219090 of IL-10
gene. |
Table I
Allele distributions at rs1799724 and
rs1800629 of TNF-α gene and at rs1800872 and rs141219090 of IL-10
gene.
| Gene | Locus | Allele | Control group | Disease group | OR | 95% CI | χ2
value | P-value |
|---|
| TNF-α | rs1799724 | C | 184 (0.460) | 226 (0.565) | 1.52 | 1.15-2.01 | 8.82 | 0.003 |
| | | T | 216 (0.540) | 174 (0.435) | | | | |
| | rs1800629 | G | 206 (0.515) | 170 (0.425) | 1.43 | 1.08-1.89 | 6.51 | 0.011 |
| | | | 194 (0.485) | 230 (0.575) | | | | |
| IL-10 | rs1800872 | G | 203 (0.507) | 173 (0.432) | 0.73 | 0.55-0.97 | 4.51 | 0.033 |
| | | T | 197 (0.492) | 227 (0.568) | | | | |
| | rs141219090 | G | 201 (0.502) | 212 (0.530) | 0.89 | 0.67-1.18 | 0.61 | 0.431 |
| | | A | 199 (0.497) | 188 (0.470) | | | | |
Genotype distributions at rs1799724
and rs1800629 of TNF-α gene and at rs1800872 and rs141219090 of
IL-10 gene
The genotype distributions at rs1799724 and
rs1800629 of TNF-α gene and at rs1800872 and rs141219090 of IL-10
gene are shown in Table II. The
genotype distributions at rs1800872 (P=0.108) and rs141219090
(P=0.304) of IL-10 gene in disease group were not different from
those in control group, but there was a difference between
rs1799724 (P=0.007) and rs1800629 (P=0.002) of TNF-α gene. Besides,
the frequencies of CC genotype at rs1799724 and AA genotype at
rs1800629 of TNF-α gene were higher in the disease group.
| Table IIGenotype distributions at rs1799724
and rs1800629 of TNF-α gene and at rs1800872 and rs141219090 of
IL-10 gene. |
Table II
Genotype distributions at rs1799724
and rs1800629 of TNF-α gene and at rs1800872 and rs141219090 of
IL-10 gene.
| Gene | Locus | Genotype | Control group | Disease group | OR | 95% CI | χ2
value | P-value |
|---|
| TNF-α | rs1799724 | CC | 41 (0.205) | 68 (0.340) | 1.24 | 1.09-1.56 | 9.71 | 0.007 |
| | | CT | 102 (0.510) | 90 (0.450) | | | | |
| | | TT | 57 (0.285) | 42 (0.210) | | | | |
| | rs1800629 | GG | 51 (0.255) | 46 (0.230) | 1.51 | 1.25-1.89 | 11.91 | 0.002 |
| | | GA | 104 (0.520) | 78 (0.390) | | | | |
| | | AA | 45 (0.225) | 76 (0.380) | | | | |
| IL-10 | rs1800872 | GG | 52 (0.260) | 38 (0.190) | 0.82 | 0.56-0.97 | 4.44 | 0.108 |
| | | GT | 99 (0.495) | 97 (0.485) | | | | |
| | | TT | 49 (0.245) | 65 (0.325) | | | | |
| | rs141219090 | GG | 55 (0.275) | 54 (0.270) | 0.67 | 0.45-0.77 | 2.37 | 0.304 |
| | | GA | 91 (0.455) | 104 (0.520) | | | | |
| | | AA | 54 (0.270) | 42 (0.210) | | | | |
Analysis of TNF-α gene polymorphisms
(rs1799724 and rs1800629) and IL-10 gene polymorphisms (rs1800872
and rs141219090)
Results of TNF-α gene polymorphisms (rs1799724 and
rs1800629) and IL-10 gene polymorphisms (rs1800872 and rs141219090)
are shown in Table III. The
frequency of the recessive model of TNF-α gene rs1799724 in disease
group was different from that in control group (P=0.043), and the
frequency of recessive model CT+TT was obviously lower. In
addition, there was a difference in the frequency of dominant model
of TNF-α gene rs1800629 between disease group and control group
(P=0.035), and the frequency of dominant model GG+GA was remarkably
lower in the disease group.
| Table IIIPolymorphism analysis and model
construction. |
Table III
Polymorphism analysis and model
construction.
| Model | Gene | Type | Genotype | Control group | Disease group | χ2
value | P-value |
|---|
| Dominant model | TNF-α | rs1799724 | CC+CT | 143 (0.715) | 158 (0.790) | 0.96 | 0.845 |
| | | | TT | 57 (0.285) | 42 (0.210) | | |
| | | rs1800629 | GG+GA | 155 (0.775) | 124 (0.620) | 6.63 | 0.035 |
| | | | AA | 45(0.225) | 76 (0.380) | | |
| | IL-10 | rs1800872 | GG+GT | 151 (0.755) | 135 (0.675) | 2.65 | 0.531 |
| | | | TT | 49 (0.245) | 65 (0.325) | | |
| | | rs141219090 | GG+GA | 146 (0.730) | 158 (0.790) | 3.15 | 0.241 |
| | | | AA | 54 (0.270) | 42 (0.210) | | |
| Recessive
model | TNF-α | rs1799724 | CC | 41 (0.205) | 68 (0.340) | 5.35 | 0.043 |
| | | | CT+TT | 159 (0.795) | 132 (0.660) | | |
| | | rs1800629 | GG | 51 (0.255) | 46 (0.230) | 3.86 | 0.135 |
| | | | GA+AA | 149 (0.745) | 154 (0.770) | | |
| | IL-10 | rs1800872 | GG | 52 (0.260) | 38 (0.190) | 1.39 | 0.736 |
| | | | GT+TT | 148 (0.740) | 162 (0.810) | | |
| | | rs141219090 | GG | 55 (0.275) | 54 (0.270) | 2.84 | 0.463 |
| | | | GA+AA | 145 (0.225) | 146 (0.730) | | |
| Heterozygous
model | TNF-α | rs1799724 | CC | 41 (0.205) | 68 (0.340) | 3.98 | 0.093 |
| | | | CT | 102 (0.510) | 90 (0.450) | | |
| | | rs1800629 | GG | 51 (0.255) | 46 (0.230) | 1.83 | 0.673 |
| | | | GA | 104 (0.520) | 78 (0.390) | | |
| | IL-10 | rs1800872 | GG | 52 (0.260) | 38 (0.190) | 3.64 | 0.103 |
| | | | GT | 99 (0.495) | 97 (0.485) | | |
| | | rs141219090 | GG | 55 (0.275) | 54 (0.270) | 2.71 | 0.323 |
| | | | GA | 91 (0.455) | 104 (0.520) | | |
| Homozygous
model | TNF-α | rs1799724 | CC | 41 (0.205) | 68 (0.340) | 1.45 | 0.548 |
| | | | TT | 57 (0.285) | 42 (0.210) | | |
| | | rs1800629 | GG | 51 (0.255) | 46 (0.230) | 3.42 | 0.231 |
| | | | AA | 45 (0.225) | 76 (0.380) | | |
| | IL-10 | rs1800872 | GG | 52 (0.260) | 38 (0.190) | 2.04 | 0.575 |
| | | | TT | 49 (0.245) | 65 (0.325) | | |
| | | rs141219090 | GG | 55 (0.275) | 54 (0.270) | 2.21 | 0.513 |
| | | | AA | 54 (0.270) | 42 (0.210) | | |
Haplotype analysis of TNF-α gene
rs1799724 and rs1800629 and IL-10 gene rs1800872 and
rs141219090
The haplotype analysis results of TNF-α gene
rs1799724 and rs1800629 and IL-10 gene rs1800872 and rs141219090
are displayed in Table IV. The
frequencies of CA haplotype at rs1799724 and rs1800629 of TNF-α
gene in disease group were markedly higher than those in the
control group (P<0.001, OR=1.972). Furthermore, disease group
had notably lower frequencies of GG haplotype (P=0.041, OR=0.719)
and markedly higher frequencies of TG haplotype (P=0.003, OR=1.624)
at rs1800872 and rs141219090 of IL-10 gene than the control
group.
| Table IVHaplotype analysis of TNF-α gene
rs1799724 and rs1800629 and IL-10 gene rs1800872 and
rs141219090. |
Table IV
Haplotype analysis of TNF-α gene
rs1799724 and rs1800629 and IL-10 gene rs1800872 and
rs141219090.
| Gene | Haplotype | Control group | Disease group | OR | 95% CI | χ2
value | P-value |
|---|
| TNF-α | CA | 92.50 (0.231) | 148.93 (0.372) | 1.972 | 1.449-2.684 | 18.889 | <0.001 |
| | CG | 91.50 (0.229) | 77.07 (0.193) | 0.805 | 0.572-1.131 | 1.565 | 0.211 |
| | TA | 101.50 (0.254) | 81.07 (0.203) | 0.748 | 0.536-1.042 | 2.962 | 0.085 |
| | TG | 114.50 (0.286) | 92.93 (0.232) | 0.755 | 0.549-1.037 | 3.029 | 0.082 |
| IL-10 | GA | 85.31 (0.213) | 80.74 (0.202) | 0.933 | 0.663-1.313 | 0.159 | 0.690 |
| | GG | 117.69 (0.294) | 92.26 (0.231) | 0.719 | 0.524-0.987 | 4.175 | 0.041 |
| | TA | 113.69 (0.284) | 107.26 (0.268) | 0.923 | 0.677-1.258 | 0.258 | 0.611 |
| | TG | 83.31 (0.208) | 119.74 (0.299) | 1.624 | 1.176-2.242 | 8.758 | 0.003 |
Correlation analysis of genotypes at
rs1799724 and rs1800629 of TNF-α gene and at rs1800872 and
rs141219090 of IL-10 gene with plasma TNF-α and IL-10
The results of the correlation analysis of genotypes
at rs1799724 and rs1800629 of TNF-α gene and at rs1800872 and
rs141219090 of IL-10 gene with plasma TNF-α and IL-10 are shown in
Figs. 1-4. It was discovered that TT genotype at rs1799724 of
TNF-α gene was obviously related to the plasma TNF-α level
(P<0.05), and the plasma TNF-α level was evidently increased in
the disease group. AA genotype at rs141219090 of IL-10 gene had a
notable correlation with the plasma IL-10 level (P<0.05), and
the plasma IL-10 level in disease group was markedly raised.
Correlation of genotypes at rs1799724
and rs1800629 of TNF-α gene and at rs1800872 and rs141219090 of
IL-10 gene with renal function indexes
Correlation of genotypes at rs1799724 and rs1800629
of TNF-α gene and at rs1800872 and rs141219090 of IL-10 gene with
renal function indexes (24-h urine protein, plasma albumin and
creatinine) were analyzed (Table
V), which revealed that CT genotype at rs1799724 of TNF-α gene
was related to the 24-h urine protein level (P=0.035), GG genotype
at rs1800872 of IL-10 gene was associated with the plasma albumin
level (P=0.031), and GG genotype at rs141219090 of IL-10 gene was
related to the serum creatinine level (P=0.047).
| Table VCorrelation of genotypes at rs1799724
and rs1800629 of TNF-α gene and at rs1800872 and rs141219090 of
IL-10 gene with renal function indexes. |
Table V
Correlation of genotypes at rs1799724
and rs1800629 of TNF-α gene and at rs1800872 and rs141219090 of
IL-10 gene with renal function indexes.
| | 24-h urine protein
(g) Normal range (<0.15 g) | Plasma albumin
(g/l) Normal range (35-55 g/l) | Creatinine (µmol/l)
Normal range (44-133 µmol/l) |
|---|
| Gene | Locus | Genotype | Control group | Disease group | P-value | Control group | Disease group | P-value | Control group | Disease group | P-value |
|---|
| TNF-α | rs1799724 | CC | 0.1 | 3.6 | 0.035 | 42.31 | 24.42 | 0.351 | 52.34 | 145.35 | 0.175 |
| | | CT | 0.3 | 5.2 | | 45.51 | 29.52 | | 64.14 | 148.54 | |
| | | TT | 0.1 | 3.7 | | 39.16 | 25.42 | | 63.42 | 132.46 | |
| | rs1800629 | GG | 0.1 | 3.8 | 0.381 | 47.72 | 24.15 | 0.311 | 58.36 | 145.42 | 0.113 |
| | | GA | 0.2 | 3.6 | | 44.11 | 24.32 | | 68.47 | 137.45 | |
| | | AA | 0.1 | 4.1 | | 42.95 | 22.16 | | 53.25 | 142.36 | |
| IL-10 | rs1800872 | GG | 0.1 | 3.9 | 0.473 | 36.17 | 18.52 | 0.031 | 69.57 | 137.13 | 0.234 |
| | | GT | 0.2 | 4.2 | | 47.13 | 26.42 | | 56.35 | 156.43 | |
| | | TT | 0.1 | 3.7 | | 45.53 | 25.46 | | 58.42 | 144.31 | |
| | rs141219090 | GG | 0.1 | 3.5 | 0.274 | 38.36 | 21.35 | 0.212 | 68.41 | 184.98 | 0.047 |
| | | GA | 0.1 | 4.6 | | 43.44 | 23.71 | | 50.32 | 132.25 | |
| | | AA | 0.2 | 4.3 | | 42.72 | 22.86 | | 54.28 | 141.54 | |
Discussion
Nephrotic syndrome is a disease with a complicated
pathogenesis caused by heredity, infection and other factors, in
which the immune microenvironment is often out of balance (13,14).
Primary nephrotic syndrome is nephrotic syndrome without definite
cause. Disorders of various cytokines and inflammatory factors such
as IL-17A cause glomerulus to be damaged and its permeability to be
increased, triggering various symptoms (15).
TNF-α, primarily secreted by mononuclear
macrophages, has an outstanding function of killing tumor cells,
thus protecting the body from the infringement of tumor cells.
However, TNF-α also exerts lethal effects on normal tissues and
cells. High-level TNF-α may lead to autoimmune diseases and damage
different tissues. Gene polymorphisms may influence TNF-α secretion
and disease susceptibility. In addition, TNF-α has been proved to
be related to various diseases, such as schistosomiasis, periportal
fibrosis (16) and diabetic
nephropathy (17). IL-10 is also a
cytokine exerting pro-inflammatory effects, and it originates from
numerous cells, with a complex mechanism of action. IL-10 gene
polymorphism can influence the occurrence of diseases, such as
viral infection (18) and ischemic
stroke (19). Electron microscopy
with podocyte detachment plays an increasingly important role in
the diagnosis and classification of kidney diseases. Unfortunately,
the role of TNF-α and IL-10 in nephrotic syndrome has not been
confirmed by electron microscopy as far as we know. It was found in
this study that allele distributions at rs1799724 (P=0.003) and
rs1800629 (P=0.011) of TNF-α gene and at rs1800872 (P=0.033) of
IL-10 gene in disease group were different from those in control
group. Among them, in disease group, allele C frequency at
rs1799724 and allele A frequency at rs1800629 of TNF-α gene and
allele T frequency at rs1800872 of IL-10 gene were higher. It can
be concluded that allele C at rs1799724 and allele A at rs1800629
of TNF-α gene and allele T at rs1800629 and rs1800872 of IL-10 gene
are susceptible factors for primary nephrotic syndrome. However,
there were differences between rs1799724 (P=0.007) and rs1800629
(P=0.002) of TNF-α gene, and the frequency of CC genotype at
rs1799724 and AA genotype at rs1800629 of TNF-α gene were higher in
the disease group. The above results prove that the gene
polymorphisms (rs1799724 and rs1800629) of TNF-α gene may have
strong correlation with the occurrence of primary nephrotic
syndrome.
Through polymorphism analysis and recessive or the
dominant model construction, it was discovered that the frequency
of recessive model of TNF-α gene rs1799724 in disease group was
different from that in control group (P=0.043), and the frequency
of the recessive model (CT+TT) was significantly lower. In
addition, there was a difference in the frequency of dominant model
of TNF-α gene rs1800629 between disease group and control group
(P=0.035), and the frequency of dominant model GG+GA was remarkably
lower. The above results imply that TNF-α gene may affect the
occurrence of primary nephrotic syndrome through the combination of
two genotypes at a single locus. Besides, the frequencies of CA
haplotype at rs1799724 and rs1800629 of TNF-α gene in disease group
were markedly higher than those in control group (P<0.001,
OR=1.972). Furthermore, disease group had evidently lower
frequencies of GG haplotype (P=0.041, OR=0.719) and markedly higher
frequencies of TG haplotype (P=0.003, OR=1.624) at rs1800872 and
rs141219090 of IL-10 gene than control group, indicating that TNF-α
gene and IL-10 gene may affect the susceptibility of primary
nephrotic syndrome through two loci. It can be concluded that gene
polymorphisms may exert a holistic effect on primary nephrotic
syndrome, rather than a unilateral effect of a single locus or
genotype of gene, which contributes to the understanding of the
disease.
Analysis of gene polymorphisms and the levels of
plasma TNF-α and IL-10 demonstrated that TT genotype at rs1799724
of TNF-α gene was significantly related to the plasma TNF-α level
(P<0.05), and the plasma TNF-α level was significantly increased
in disease group. AA genotype at rs141219090 of IL-10 gene had a
notable correlation with the plasma IL-10 level (P<0.05), and
the plasma IL-10 level in disease group was markedly raised. The
above results indicate that TNF-α and IL-10 gene polymorphisms not
only affect the susceptibility of primary nephrotic syndrome, but
also may promote the development of the disease by affecting plasma
cytokine levels. Further research confirmed that CT genotype at
rs1799724 of TNF-α gene was related to the 24-h urine protein level
(P=0.035), GG genotype at rs1800872 of IL-10 gene was associated
with the plasma albumin level (P=0.031), and GG genotype at
rs141219090 of IL-10 gene was related to the serum creatinine level
(P=0.047), implying that TNF-α and IL-10 gene polymorphisms can
indeed affect the development of primary nephrotic syndrome, and
the disease condition can be evaluated and predicted by detecting
the gene polymorphism of patients. However, there are still some
limitations in the present study. This was single center
retrospective study and the sample size was small. In addition, the
differences among different pathological types were not included in
the present study.
In conclusion, TNF-α and IL-10 gene polymorphisms
are predominantly correlated with the susceptibility and the
condition of primary nephrotic syndrome. TT genotype at rs1799724
of TNF-α gene and AA genotype at rs141219090 of IL-10 gene are risk
factors of primary nephrotic syndrome.
Acknowledgements
Not applicable.
Funding
No funding was received.
Availability of data and materials
All data generated or analyzed during this study are
included in this published article.
Authors' contributions
MX, SB and ZH designed the study and performed the
experi-ments. JC, LX, YaL, LQ and YoL were also involved in the
conception of the study. SZ, YWu, GT, WW and YWa analyzed the data.
All authors read and approved the final manuscript.
Ethics approval and consent to
participate
The study was approved by the Ethics Committee of
the Qilu Hospital of Shandong University (Jinan, China) (no.
QL0220161204). Signed informed consents were obtained from the
patients and/or guardians.
Patients consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing
interests.
References
|
1
|
Downie ML, Gallibois C, Parekh RS and
Noone DG: Nephrotic syndrome in infants and children:
Pathophysiology and management. Paediatr Int Child Health.
37:248–258. 2017.PubMed/NCBI View Article : Google Scholar
|
|
2
|
Sun XM, Sun XH, Li ZY, Yuan CJ and Wu J:
Expression of NF-κB in juvenile rats with nephrotic syndrome and
its effects on inflammatory changes and renal injury. Eur Rev Med
Pharmacol Sci. 23:4010–4016. 2019.PubMed/NCBI View Article : Google Scholar
|
|
3
|
Colucci M, Corpetti G, Emma F and
Vivarelli M: Immunology of idiopathic nephrotic syndrome. Pediatr
Nephrol. 33:573–584. 2018.PubMed/NCBI View Article : Google Scholar
|
|
4
|
Macé C and Chugh SS: Nephrotic syndrome:
Components, connections, and angiopoietin-like 4-related
therapeutics. J Am Soc Nephrol. 25:2393–2398. 2014.PubMed/NCBI View Article : Google Scholar
|
|
5
|
Wang CS and Greenbaum LA: Nephrotic
syndrome. Pediatr Clin North Am. 66:73–85. 2019.PubMed/NCBI View Article : Google Scholar
|
|
6
|
Piekoszewska-Ziętek P, Turska-Szybka A and
Olczak-Kowalczyk D: Single nucleotide polymorphism in the aetiology
of caries: Systematic literature review. Caries Res. 51:425–435.
2017.PubMed/NCBI View Article : Google Scholar
|
|
7
|
Bianco AC and Kim BS: Pathophysiological
relevance of deiodinase polymorphism. Curr Opin Endocrinol Diabetes
Obes. 25:341–346. 2018.PubMed/NCBI View Article : Google Scholar
|
|
8
|
Luo XH, Li GR and Li HY: Association of
the CYP4F2 rs2108622 genetic polymorphism with hypertension: A
meta-analysis. Genet Mol Res. 14:15133–15139. 2015.PubMed/NCBI View Article : Google Scholar
|
|
9
|
Gunadi Makhmudi A and Agustriani N
Rochadi: Effects of SEMA3 polymorphisms in Hirschsprung disease
patients. Pediatr Surg Int. 32:1025–1028. 2016.PubMed/NCBI View Article : Google Scholar
|
|
10
|
Fu Y, Sun S, Liang J, Liu S, Jiang Y, Xu L
and Mei J: PEAR1 gene polymorphism in a Chinese pedigree with
pulmonary thromboembolism. Medicine (Baltimore).
95(e5687)2016.PubMed/NCBI View Article : Google Scholar
|
|
11
|
Tieranu I, Dutescu MI, Bara C, Tieranu CG,
Balgradean M and Popa OM: Preliminary study regarding the
association between tumor necrosis factor alpha gene polymorphisms
and childhood idiopathic nephrotic syndrome in Romanian pediatric
patients. Maedica (Buchar). 12:164–168. 2017.PubMed/NCBI
|
|
12
|
Gao J, Wei L, Fu R, Wei J, Niu D, Wang L,
Ge H, Yu Q, Wang M, Liu X, et al: Association of interleukin-10
polymorphisms (rs1800872, rs1800871 and rs1800896) with
predisposition to IgA nephropathy in a Chinese Han population: A
case-control study. Kidney Blood Press Res. 42:89–98.
2017.PubMed/NCBI View Article : Google Scholar
|
|
13
|
Inaba A, Hamasaki Y, Ishikura K, Hamada R,
Sakai T, Hataya H, Komaki F, Kaneko T, Mori M and Honda M:
Long-term outcome of idiopathic steroid-resistant nephrotic
syndrome in children. Pediatr Nephrol. 31:425–434. 2016.PubMed/NCBI View Article : Google Scholar
|
|
14
|
Ramanathan AS, Vijayan M, Rajagopal S,
Rajendiran P and Senguttuvan P: WT1 and NPHS2 gene mutation
analysis and clinical management of steroid-resistant nephrotic
syndrome. Mol Cell Biochem. 426:177–181. 2017.PubMed/NCBI View Article : Google Scholar
|
|
15
|
Cortvrindt C, Speeckaert R, Moerman A,
Delanghe JR and Speeckaert MM: The role of interleukin-17A in the
pathogenesis of kidney diseases. Pathology. 49:247–258.
2017.PubMed/NCBI View Article : Google Scholar
|
|
16
|
Silva PC, Gomes AV, de Britto LR, de Lima
EL, da Silva JL, Montenegro SM, Muniz MT and Domingues AL:
Influence of a TNF-α polymorphism on the severity of
schistosomiasis periportal fibrosis in the northeast of Brazil.
Genet Test Mol Biomarkers. 21:658–662. 2017.PubMed/NCBI View Article : Google Scholar
|
|
17
|
Umapathy D, Krishnamoorthy E,
Mariappanadar V, Viswanathan V and Ramkumar KM: Increased levels of
circulating (TNF-α) is associated with (-308G/A) promoter
polymorphism of TNF-α gene in diabetic nephropathy. Int J Biol
Macromol. 107:2113–2121. 2018.PubMed/NCBI View Article : Google Scholar
|
|
18
|
Zhao N, Chen HL, Chen ZZ, Li J and Chen
ZB: IL-10-592 polymorphism is associated with IL-10 expression and
severity of enterovirus 71 infection in Chinese children. J Clin
Virol. 95:42–46. 2017.PubMed/NCBI View Article : Google Scholar
|
|
19
|
Liu X, Li Q, Zhu R and He Z: Association
of IL-10-1082A/G Polymorphism with ischemic stroke: Evidence from a
case-control study to an updated meta-analysis. Genet Test Mol
Biomarkers. 21:341–350. 2017.PubMed/NCBI View Article : Google Scholar
|
