This article is mentioned in:

Introduction

Obesity is associated with excessive accumulation of adipose tissue, increased risk of diabetes, hypertension, cardiovascular diseases, and depression, and causes enormous economic and social burden (1). Although the molecular mechanisms that link obesity with a spectrum of metabolic and cardiovascular defects are not well understood, previous studies have indicated that endoplasmic reticulum (ER) stress and inflammation are stimulated in obesity (2,3). There are two major responses to ER stress: the unfolded protein response (UPR) and the ER-associated protein degradation (ERAD) pathway (4). PKR-like endoplasmic reticulum kinase (PERK)-eukaryotic initiation factor (eIF2), activating transcription factor 6 (ATF6), and inositol requiring enzyme 1 (IRE1)-X-box binding protein (XBP1) are the three main signaling factors involved in the activation of the UPR pathway, and mutation or knockout of these genes results in insulin resistance in mouse models (5,6). In the ERAD pathway, synoviolin (SYVN1), a mammalian homolog of yeast Hrd1p/Der3p, plays an important role as an E3 ubiquitin ligase to promote the degradation of misfolded proteins (7-9).

SYVN1 was identified from the cDNA of rheumatoid synovial cells and is overexpressed in synovial tissue and PBMCs from rheumatoid arthritis patients (7,10). We demonstrated that the expression of SYVN1 is transcriptionally regulated by pro-inflammatory cytokines such as tumor necrosis factor α (TNFα), interleukin (IL)-1, and IL-6 (11,12) via Ets transcription factors, GA-binding protein (GABP) α, GABP β (13) and interleukin enhancer binding protein 3 (ILF-3) (14), and ER stress via ATF6 and XBP1(15). Recently, we found that SYVN1 deficiency resulted in weight loss and a reduced accumulation of white adipose tissue in WT mice and genetically obese mice (ob/ob and db/db) (16). SYVN1 negatively regulated peroxisome proliferator-activated receptor coactivator (PGC)-1β, a thermogenic coactivator via its ubiquitination. In adipose tissue, there were significantly more mitochondria, a higher mitochondrial respiration level, and an increased basal energy expenditure. Furthermore, the selective SYVN1 inhibitor LS-102 prevented obesity and accumulation of fat in mice (16). Thus, SYVN1 is a potential therapeutic target in obesity treatment. Although high expression of Syvn1 has been found in the white adipose tissue of genetically obese mice (ob/ob and db/db), the expression of SYVN1 in humans has not been elucidated.

We hypothesize that individuals with obesity/overweight will demonstrate increased expression of SYVN1 compared to healthy controls. In this study, we examine the differences in the expression levels of ER stress- and inflammation-associated genes in the circulating leukocytes of Japanese volunteers with a BMI <25.0 compared to those with a BMI ≥25.0.

Materials and methods

Volunteers

The present study was approved by ethics committee of Tokyo Medical University (no. 2728, 2729) and written informed consent was obtained from all subjects. The patient was recruited from March to June in 2015 at a hospital in Kochi prefecture in Japan. A total of 35 volunteers of Japanese origin participated in this study. Twenty four subject (68.5%) were women and 11 (31.4%) were men (mean age 39.0 years). We excluded patients who had a history of rheumatoid arthritis (RA) (n=3).

Cell separation

Blood samples of 10 ml were obtained and PBMCs were isolated by Ficoll gradient (GE Healthcare Bio-Sciences AB, Uppsala, Sweden) (17). Briefly, blood samples were centrifuged for 10 min at 2800 rpm, and blood cell pellets were resuspended with PBS-. 10 ml of Percoll-paque (d=1.077 g/ml) was slowly added, and then tube was centrifuged for 30 min at 1600 rpm. PBMCs were collected and washed with RPMI 1640 medium containing 1% FBS.

RNA isolation and reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis

Total RNA from PBMCs was purified using ISOGEN (Nippon Gene, Tokyo, Japan) according to the manufacturer's instructions, and reverse transcribed using ReverTra Ace with random primers (Toyobo, Osaka, Japan). RT-qPCR was performed using a LightCycler 480 Probes Master (Roche Diagnostics, Mannheim, Germany). Expression levels were determined relative to that of ribosomal protein large P0 (RPLP0) and the mean of the control group (BMI <25.0) set to 1. Primers and probes used in this study are shown in Table I.

Table I Primer sequences and probes.

Table I

Primer sequences and probes.

Gene	Directiona	Primer sequence	Probeb
SYVN1	F	ccagtacctcaccgtgctg	#16
	R	tctgagctagggatgctggt
RPLPO	F	gcagaaggggagacacattt	#62
	R	tgtggtcttgttatgggtggt
IL1	F	ggttgagtttaagccaatcca	#6
	R	tgctgacctaggcttgatga
TNF	F	cagcctcttctccttcctgat	#29
	R	gccagagggctgattagaga
IL6	F	caggagcccagctatgaact	#7
	R	gaaggcagcaggcaacac
ATF6	F	gcagaaggggagacacattt	#62
	R	tgtggtcttgttatgggtggt
XBP1	F	ggagttaagacagcgcttgg	#37
	R	cactggcctcacttcattcc
eIF2	F	gaagctaagaaagctgcaaagc	#43
	R	cagtgtttcgtggtgtgctc
IRE-1	F	gaagcatgtgctcaaacacc	#50
	R	tctgtcgctcacgtcctg

[i] ^aDirection of primer sequences.

[ii] ^bProbe numbers of Universal ProbeLibrary probes (Roche Diagnostics). F, forward; R, reverse; SYVN1, Synoviolin; RPLPO, ribosomal protein lateral stalk subunit P0; IL, interleukin; TNF, tumor necrosis factor; ATF6, activating transcription factor 6; IRE1, inositol requiring enzyme 1; XBP1, X-box binding protein; eIF2, eukaryotic initiation factor.

PCR arrays

Five hundred nanograms of total RNA was reverse transcribed using ReverTra Ace with random primers (Toyobo, Osaka, Japan) and subsequently loaded onto either an Inflammatory Cytokines and Receptors (for measurement of inflammatory cytokine genes) or an Unfolded Protein Response (for measurement of RT stress genes) RT2 Profiler PCR Array, according to the manufacturer's instructions (Qiagen). Fold change was calculated by determining the ratio of mRNA levels to control values using the Δ threshold cycle (Ct) method (2−ΔΔCt). All data were normalized to RPL13a or RPLP0 mRNA. PCR conditions were: 10 min at 95˚C, followed by 45 cycles of 15 sec at 95˚C and 1 min at 60˚C.

Statistical analysis

All the values reported are expressed as mean ± SE and were analyzed using Excel Statistics 2012 (SSRI Japan Co., Ltd., Tokyo). Differences between volunteers with a BMI ≥25.0 and volunteers with a BMI <25.0 were calculated using an unpaired Student's t-test. The Mann-Whitney U test was used in the differences of ratio of women in donors. For all statistical tests, P<0.05 was considered to indicate a statistically significant difference.

Results

Characteristics of donors

The main characteristics of the 35 volunteers are shown in detail in Table II. Of a total of 35 volunteers, 24 (68.5%) were women and 11 (31.4%) were men. The mean age of volunteers was 39.0 years. Our study found 25.7% (9 donors) had a BMI ≥25.0 and 74.3% (26 donors) had a normal BMI of <25.0. Of the 9 donors with a BMI ≥25.0, two thirds (n=6) were classed as over weight (25.0 ≤≤BMI <30.0) and the other third (n=3) were classed as obese (BMI ≥≥30.0).

Table II Characteristics of donors.

Table II

Characteristics of donors.

Variable	All donors	Donor (BMI <25 kg/m2) (n=26)	Donor (BMI ≥25 kg/m2) (n=9)	P-values
Age	39.0±2.0	38.0±2.4	42.1±3.4	0.37
Women (%)	24 (68.5)	17(65)	7(78)	0.50
Weight (kg)	59.4±2.1	53.9±1.4	75.0±4.0	2.7x10-07
Height (m)	1.6±0.01	1.6±0.02	1.6±0.02	0.29
BMI	23.3±0.9	20.9±0.4	30.2±1.8	1.6x10-08

[i] BMI, body mass index.

Expression of SYVN1

To investigate the level of SYVN1 mRNA in PBMCs from volunteers with a BMI ≥25.0 compared with the expression in PBMCs from volunteers with a BMI <25.0, we performed a RT-qPCR assay (Fig. 1). SYVN1 mRNA expression was 1.2-fold higher in PBMCs from volunteers with a BMI ≥25.0 than in PBMCs from volunteers with a BMI <25.0 (P=0.023, n=35).

Figure 1 Expression of SYVN1 mRNA in whole peripheral blood from donors with BMI ≥25.0. Individual measurements were standardized using ribosomal protein lateral stalk subunit P0, and the mean of the control group (BMI <25.0) set to 1. Data are presented as box and whisker plots. The box denotes the first quartile and the third quartile. The line within the box is the median. The whiskers are the two lines outside the box that extend to the highest and lowest data scores. Statistical analysis by Student's t-test. Data are mean ± standard error of the mean. SYVN1, Synoviolin 1.

Expression of inflammatory cytokine genes

Ours and other previous studies indicate that the expression of SYVN1 is mainly regulated by inflammatory cytokine signals and ER stress signals (11,12,15). Therefore, we investigated the upstream signals of SYVN1 expression. To examine the expression of inflammatory cytokines and their receptors, we performed a PCR array using an Inflammatory Cytokines and Receptors RT2 Profiler PCR Array System. We compared the expression of 84 inflammatory chemokines, cytokines, and their receptor genes. As shown in Fig. 2, the expression of TNFα and IL-1 was lower in PBMCs from volunteers with a BMI ≥25.0 than in those with a BMI <25.0. To confirm the results of the PCR array, we performed an RT-qPCR assay. In addition, we examined the expression of IL-6, because IL-6 regulates the expression of SYVN1(12). As shown in Fig. 3, the expression of TNFα, IL-1, and IL-6 did not significantly differ between the two groups.

Figure 2 Inflammatory gene expression profile of whole peripheral blood from donors with BMI ≥25.0 and BMI <25.0. Total mRNA transcript levels of 84 inflammatory genes were measured. Polymerase chain reaction array of whole peripheral blood from donors with BMI ≥25.0 and with BMI <25.0. Dashed lines represent 2-fold change. BMI, body mass index.

Figure 3 Expression of IL-1, TNF-α and IL-6 in whole peripheral blood from donors with BMI ≥25.0. Individual measurements were standardized using ribosomal protein lateral stalk subunit P0, and the mean of the control group (BMI <25.0) set to 1. Data are presented as box and whisker plots. The box denotes the first quartile and the third quartile. The line within the box is the median. The whiskers are the two lines outside the box that extend to the highest and lowest data scores. Statistical analysis by Student's t-test. Data are mean ± standard error of the mean. Cross (X) marks indicate outliers. BMI, body mass index; IL, interleukin; TNF, tumor necrosis factor.

Expression of ER stress genes

We next examined the expression of ER stress signals using an Unfolded Protein Response RT2 Profiler PCR Array system. The expression of ER stress-responsive genes, such as ATF6, XBP1, and eIF2a, were higher in PBMCs from volunteers with a BMI ≥25.0 compared with the expression in PBMCs from volunteers with a BMI <25.0 (Fig. 4). To confirm the results of the PCR array, we performed a RT-qPCR assay to investigate the expression of ATF6, XBP1, IRE1, and eIF2a. We investigated the expression of IRE1, because IRE1 is important factor to regulate activity of XBP1(18). We found that ATF6 mRNA expression was significantly higher in PBMCs from volunteers with a BMI ≥25.0 than BMI <25.0 (P=0.046) (Fig. 5). There were no statistically significant differences in the expression of XBP1, IRE1, and eIF2a between volunteers with a BMI ≥25.0 and those with a BMI <25.0.

Figure 4 Expression profile of endoplasmic reticulum stress-associated genes in whole peripheral blood from donors with BMI ≥25.0 and BMI <25.0. Total mRNA transcript levels of 84 unfolded protein response genes were measured. Polymerase chain reaction array of whole peripheral blood from donors with BMI ≥25.0 and with BMI <25.0. Dashed lines represent 2-fold change. BMI, body mass index.

Figure 5 Expression of ATF6, XBP1, eIF2 and IRE1 in whole peripheral blood from donors with BMI ≥25.0. Individual measurements were standardized using ribosomal protein lateral stalk subunit P0, and the mean of the control group (BMI <25.0) set to 1. Data are presented as box and whisker plots. The box denotes the first quartile and the third quartile. The line within the box is median. The whiskers are the two lines outside the box that extend to the highest and lowest data scores. Statistical analysis by Student's t-test. Data are mean ± standard error of the mean. Cross (X) marks indicate outliers. BMI, body mass index; ATF6, activating transcription factor 6; XBP1, X-Box Binding Protein 1; eIF2, Eukaryotic Translation Initiation Factor 2; IRE1, inositol requiring enzyme 1.

Discussion

In the present study, we investigated the expression of SYVN1 in PBMCs from obese/overweight Japanese volunteers. We found that the level of SYVN1 expression was higher in PBMCs from volunteers with a BMI ≥25.0 than those with a BMI <25.0. Previous studies, including our own, have revealed that SYVN1 is transcriptionally regulated by inflammatory cytokines including TNFα, IL-1, and IL-6, and by ER stress. In the current study, the expression of TNFα, IL-1, and IL-6 was not significantly different between PBMCs from donors with a BMI ≥25.0 and those with a BMI <25.0 (Fig. 3). In addition, there were no statistically significant differences in the expression of the ER stress-responsive genes XBP1, IRE1, and eIF2a (Fig. 5). However, ATF6 mRNA expression was significantly higher in PBMCs from volunteers with a BMI ≥25.0 than those with a BMI <25.0 (Fig. 5). Taken together, these results suggest that the ATF6-SYVN1 axis may be activated in obese/overweight donors.

Previous studies have suggested that increased ER stress is associated with metabolic syndrome and type 2 diabetes. Increased levels of ER stress markers have been found in liver and adipose tissue from genetically obese mice (ob/ob, db/db) and high fat diet-induced obese mice models (19,20). The expression of ER stress markers is also increased in adipose tissue and endothelial cells from obese humans (21,22) and in PBMCs from patients with metabolic syndrome and type 2 diabetes (23,24). In our study, the expression of SYVN1 and ATF6 was significantly increased in PBMCs from volunteers with a BMI ≥25.0 than those with a BMI <25.0, whereas the expression of the ER stress markers XBP1, IRE1, and eIF2a were not (Fig. 5). Most studies on humans have examined patients with chronic conditions, whereas we investigated donors with a BMI ≥25.0, classed as obese/overweight. Therefore, the different expression patterns of ER stress markers might be dependent on whether patients have a chronic condition.

SYVN1 is associated with both RA and overweight/obesity. In recent years, it has become clear that obesity is a risk factor for the onset of RA and to biologics (25,26). We previously demonstrated that SYVN1 was present in the cDNA of rheumatoid synovial cells and that overexpression of Syvn1 in transgenic mice leads to advanced arthropathy via reduction of apoptosis in synoviocytes (7). Toh et al (10) demonstrated that the expression of SYVN1 is also increased in human PBMCs from RA patients compared with those from controls. In addition, the expression of SYVN1 was reduced in responders, but not nonresponders, of infliximab treatment, suggesting that the expression of SYVN1 in PBMCs could be marker for nonresponders of infliximab treatment. In the present study, we found that elevated levels of SYVN1 were present in circulating PBMCs from volunteers with a BMI ≥25.0. We previously demonstrated that high expression of Syvn1 was observed in obese mice (db/db and ob/ob mice), whereas conditional knockout mice of Syvn1 revealed that loss of Syvn1 expression induced reduced body weight. In addition, treatment with the SYVN1 inhibitor LS-102 attenuated weight gain in C57BL/6J and db/db mice. These studies suggested that the expression level of SYVN1 in PBMCs could be marker of overweight/obesity and that SYVN1 has a pivotal role in overweight/obesity and RA, and it is possible that SYVN1 is involved in onset of RA and chronic inflammation due to obesity, and also sensitivity to treatment.

Taken together, in the present study we provide evidence that the expression of SYVN1 was higher in circulating PBMCs from volunteers with a BMI ≥25.0 compared to those with a BMI of <25.0. The small sample number and the low proportion of obese patients are limitations of our study. Further analysis on a large scale, with more participants, will be needed to determine whether the expression of SYVN1 has the potential to become a biomarker and will also help contribute to the understanding of the physiological significance of SYVN1 regulation.

Acknowledgements

The authors thank Mr. S. Shibata (Tokyo Medical University) for technical assistance. The authors also thank all members of Dr. Nakajima's laboratory and Dr. Khin Thuzar Wynn (Yangon Speciality Hospital).

Funding

The present study was supported in part by the Japan Society for the Promotion of Science KAKENHI (grant nos. 23659176, 26670479, 26461478 and 16H05157). This study was also supported in part by funds provided through a MEXT-Supported program of the Strategic Research Foundation at Private Universities (S1411011, 2014-2018) from the Ministry of Education, Culture, Sports, Science and Technology of Japan. This work was funded in part by grants from the Naito Foundation, Natural Science Scholarship Daiichi-Sankyo Foundation of Life Science, Mitsubishi, Tanabe Pharma Corporation, Bureau of Social Welfare and Public Health, Academic contribution of Pfizer, Eisai, Santen Pharmaceutical, Abbvie, Takeda Science Foundation, AstraZeneca (R&D Grant 2013), and ONO Medical Research Foundation and Industry-University Cooperation (BioMimetics Sympathies Inc.).

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Authors' contributions

HF, SA, NY and TN conceived the project and designed the experiments. HF, SA, IM and TN performed experiments and analyzed data. HF and TN wrote the manuscript. All authors discussed the results and commented on the manuscript.

Ethics approval and consent to participate

All human experimental protocols in this study (no. 2728, 2729) were approved by the Ethics Review Committee of Tokyo Medical University. Written informed consent was obtained from all participants prior to collection of joint tissue samples.

Patient consent for publication

Consent for publication was obtained from all participants.

Competing interests

The authors and employees of BioMimetics Sympathies Inc. have declared that they have no competing interests.

References