Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
January-2022 Volume 23 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January-2022 Volume 23 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML

  • Supplementary Files
    • Supplementary_Data.pdf
Article

Feibi decoction‑medicated serum inhibits lipopolysaccharide‑induced inflammation in RAW264.7 cells and BMDMs

  • Authors:
    • Wan Wei
    • Guodong Li
    • Zhaoheng Liu
    • Haojie Yang
    • Shuo Liu
    • Xinxin Zou
    • Yang Jiao
  • View Affiliations / Copyright

    Affiliations: Graduate School, Beijing University of Chinese Medicine, Beijing 100029, P.R. China, Dongfang Hospital Affiliated to Beijing University of Chinese Medicine, Beijing 100078, P.R. China
  • Article Number: 110
    |
    Published online on: December 2, 2021
       https://doi.org/10.3892/etm.2021.11033
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Feibi decoction (FBD) is a traditional Chinese herbal medicine and has been clinically used in the treatment of pulmonary fibrosis (PF), which is characterized by diffuse interstitial inflammation and exaggerated collagen accumulation. However, the potential mechanisms remain to be elucidated. The present study aimed to investigate the effect of FBD‑medicated serum (FBDS) on lipopolysaccharide (LPS)‑induced inflammation in macrophages. In RAW264.7 macrophages and bone marrow‑derived macrophages (BMDMs), FBDS treatment significantly inhibited the production of pro‑inflammatory cytokines induced by LPS. In addition, it was indicated that FBDS treatment suppressed the activation of NF‑κB and Smad2/Smad3 following LPS treatment. Furthermore, FBDS treatment decreased the expression of transforming growth factor‑β1 and chitinase‑3‑like protein 1. In conclusion, the results demonstrated that treatment with FBDS inhibited LPS‑induced inflammation in RAW264.7 and BMDM cells. These data may improve understanding of the effect of FBD on anti‑inflammation and help determine the mechanisms underlying the alleviation of PF via FBD.

Introduction

Pulmonary fibrosis (PF) is characterized by increased fibroblasts proliferation, interstitial inflammation and the promotion of extracellular matrix synthesis and deposition (1). A number of possible treatments for pulmonary fibrosis have been investigated, but their effect in clinical trials is suboptimal (2). PF is a major therapeutic challenge for which novel therapeutic strategies are warranted, and inhibiting inflammation is increasingly regarded as one of the approaches.

Inflammation is the initial response following lung injury. Once activated, inflammatory cells, such as neutrophils and macrophages, accumulate in the lower airways and consequently release harmful amounts of reactive oxygen species and some proinflammatory cytokines and growth factors that regulate the proliferation and secretary activity of alveolar fibroblasts in the alveolar wall. The activated fibroblasts produce increasing amounts of matrix proteins, which distort the normal lung architecture and affect gas exchange. Therefore, inhibition of inflammation and oxidative stress represents a possible therapeutic strategy (3-7).

Traditional Chinese medicine has been widely used in numerous diseases and has shown notable curative effects (8-10). Feibi decoction (FBD) is a Chinese materia medica product extracted from 8 Chinese traditional medical herbs and widely used for treatment of patients with lung diseases, such as pulmonary fibrosis; however, the precise mechanisms remain to be elucidated. The present study investigated the effect of FBD-medicated serum (FBDS) on lipopolysaccharide (LPS)-induced inflammation in macrophages, and identified that FBDS significantly inhibited the pro-inflammatory cytokines expression in both RAW264.7 macrophages and bone marrow-derived macrophages (BMDMs). It was also observed that FBDS suppressed LPS-induced activation of NF-κB and Smad2/Smad3. Notably, it was identified that FBDS treatment decreased the expression of transforming growth factor (TGF)-β1 and chitinase-3-like protein 1 (CHI3L1). These findings may improve the function of FBD in the treatment of pulmonary fibrosis and expand current understanding of the mechanisms underlying Chinese traditional medicine.

Materials and methods

Animals

A total of 28 clean healthy Sprague-Dawley rats (all female; 8 weeks old), weighing 200-220 g, were provided by the Beijing University of Chinese Medicine and housed in a cage at 23±1˚C, 45-55% humidity with a 12-h light/dark cycle. Food and water were freely available. A total of 20 healthy C57BL/6J mice (female; 6-8 weeks old; 23.7±1.2 g) were obtained from Beijing University of Chinese Medicine to generate BMDMs. The mice were kept at room temperature (controlled at 25˚C) and at 50% humidity. with a 12-h light/dark cycle. The experiments were carried out according to the National Institutes of Health Guide for the Care and Use of Laboratory Animals (11) and approved by the Animal Ethics Committee of the Scientific Investigation Board of Beijing university of Chinese Medicine.

Preparation of FBDS

The 28 Sprague-Dawley rats were randomly divided into FBD-low (n=7), FBD-moderate (n=7), FBD-high (n=7) and control (n=7) groups. Rats in the FBD groups received intragastric administration of FBD (low, 5 ml/kg; moderate, 10 ml/kg; high, 20 ml/kg) twice a day for 6 days. The control group received intragastric perfusion of physiological saline twice a day for 6 days. Then, 1 h following the last administration, rats were intraperitoneally anesthetized using 3% amobarbital (60 mg/kg) and blood was sampled from the abdominal aorta and centrifuged (4˚C; 3,500 x g; 10 min). Following anesthesia, the rats exhibited slow breathing and muscle relaxation, but no respiratory stagnation or mortality. The serum was aliquoted into 10 ml ampoules and preserved at -80˚C for future use.

Cell culture

Mouse macrophage cell line RAW264.7 (induced by leukemia virus) was obtained from the American Type Culture Collection. The cells were cultured at 37˚C under 5% CO2 in DMEM supplemented with 10% FBS (Invitrogen; Thermo Fisher Scientific, Inc.), 100 U/ml penicillin, and 100 µg/ml streptomycin. BMDM generation was performed according to a previous study (12). Briefly, cells were prepared by flushing the bone marrow from femurs and tibias and then maintaining in DMEM medium containing 10% FBS and supplemented with 10 ng/ml macrophage colony stimulating factor (M-CSF; Peprotech, Inc.; cat. no. 315-02). Then, 4-5 days later, adherent cells were dissociated and cultured in DMEM supplemented with 10% FBS. BMDMs were identified by flow cytometry. The cells were stained for 20 min at 4˚C with 25 µg/ml of anti-F4/80 and anti-CD11b. FITC-anti-F4/80, APC-anti-CD11b were purchased from eBioscience (Thermo Fisher Scientific, Inc.). Data were collected using a FACSCanto (BD Biosciences) and analyzed using FlowJo version 10 software (FlowJo LLC). F4/80+CD11b+ cells were considered BMDMs.

Cell viability

Cell viability was assessed using Cell Counting Kit-8 (CCK-8) assay (Dojindo Molecular Technologies, Inc.). Briefly, 5,000 RAW264.7 cells or BMDMs per well were seeded in 96-well plates and treated with control rats serum or FBDS (10%) at 37˚C for 24 h, followed by LPS stimulation (100 ng/ml) for 8 h. Then the suspension was replaced with an equal volume of fresh culture medium (Invitrogen; Thermo Fisher Scientific, Inc.) containing 10% CCK-8, followed by 3 h incubation at 37˚C. The absorbance was determined at 450 nm on a micro-plate reader (Multiskan MK3; Thermo Fisher Scientific, Inc.).

Reverse transcription-quantitative (RT-q) PCR

Following treatment, total RNA from RAW264.7 cells or BMDMs was extracted with TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. RNA concentration was detected by NanoDrop™ ND-1000 spectrophotometer (NanoDrop Technologies; Thermo Fisher Scientific, Inc.). mRNA (1 µg) was reverse transcribed using PrimeScript RT Master Mix (Perfect Real Time) kit (Takara Biotechnology Co., Ltd.) according to the manufacturer's instructions. The cDNA was denatured for 10 min at 95˚C. A LightCycler (ABI PRISM 7000; Applied Biosciences; Thermo Fisher Scientific, Inc.) and a SYBR RT-PCR kit (Takara Biotechnology Co., Ltd.) were used for RT-qPCR analysis. GAPDH was used as the internal control. Thermocycling conditions were 1 cycle (95˚C for 5 min) and 40 cycles (95˚C for 15 sec; 57˚C for 30 sec; 72˚C for 30 sec) and the 2-ΔΔCq method was used to evaluate the relative quantities of each amplified product in the samples (13). For each qPCR analysis, three technical replicates were performed. Primer sequences used in qPCR are shown in Table I.

Table I

Primers used in the present study.

Table I

Primers used in the present study.

Primer nameSequence (5'-3')
TNFα forward GCCACCACGCTCTTCTGTCT
TNFα reverse TGAGGGTCTGGGCCATAGAAC
IL-6 forward ACAACCACGGCCTTCCCTAC
IL-6 reverse CATTTCCACGATTTCCCAGA
IL-1β forward ACCTTCCAGGATGAGGACATGA
IL-1β reverse AACGTCACACACCAGCAGGTTA
IL-8 forward GGGTCGTACTGCGTATCCTG
IL-8 reverse AGACAAGGACGACAGCGAAG
TGF-β1 forward CACTCCCGTGGCTTCTAGTG
TGF-β1 reverse GGACTGGCGAGCCTTAGTTT
CHI3L1 forward CCCCGTTCCTGCGTTCTTAT
CHI3L1 reverse CAGGTGTTGGGCTATCTGGG
GAPDH forward AATGACCCCTTCATTGAC
GAPDH reverse TCCACGACGTACTCAGCGC
ELISA

Mouse tumor necrosis factor (TNF)α (cat. no. MTA00B) and interleukin (IL)-6 (cat. no. M6000B) ELISA kits (R&D Systems, Inc.) were used according to the manufacturer's instructions.

Western blot analysis

Western blot analysis was performed as described previously (14). The cells were homogenized, washed with PBS, and lysed in a RIPA buffer (Beyotime Institute of Biotechnology). The protein concentration of lysates was measured using Bio-Rad quantification assay (Bio-Rad Laboratories, Inc.). Proteins (20 µg/lane) were separated using 10% SDS-PAGE and transferred to a PVDF membrane (EMD Millipore). The membrane was then blocked with 2.5% non-fat dry milk for 1 h at room temperature. The antibodies for p65 (1:500; cat. no. 8242), phosphorylated (p-)p65 (1:500; cat. no. 3033), IκB kinase (IKK)β (1:500; cat. no. 2678), p-IKKβ (1:500; cat. no. 2694) and β-actin (1:1,000; cat. no. 3700; endogenous control) were from Cell Signaling Technology, Inc. Smad2 (1:500; cat. no. ab40855), p-Smad2 (1:500; cat. no. ab53100), Smad3 (1:500; cat. no. ab40854), p-Smad3 (1:500; cat. no. ab52903), TGF-β1 (1:500; cat. no. ab92486) and CHI3L1 (1:500; cat. no. ab180569) were from Abcam. The primary antibodies were added and incubated overnight at 4˚C. Following incubation with the corresponding horseradish peroxidase-conjugated secondary antibody (goat anti-rabbit IgG-HRP; 1:4,000; cat. no. sc2004; or goat anti-mouse IgG-HRP; 1:4,000; cat. no. sc2005; Santa Cruz Biotechnology, Inc.) at 25˚C for 2 h, the target protein was visualized by enhanced chemiluminescence (cat. no. 32106, Thermo Fisher Scientific, Inc.). Relative protein expression levels were determined by scanning densitometry (ChemiDoc XRS + Systems; Bio-Rad Laboratories, Inc.) and analyzed using Image Lab 5.0 software (Bio-Rad Laboratories, Inc.).

Statistical analysis

All data are presented as the mean ± standard deviation of three independent experiments. One-way analysis of variance (ANOVA) was performed to compare three or more groups. If the ANOVA analysis was significant, the Tukey's post hoc test was applied for comparison between each two groups. P<0.05 was considered to indicate a statistically significant difference.

Results

FBDS reduces proinflammatory cytokine expression in LPS-stimulated RAW264.7 macrophages

To investigate the effect of FBD on lung inflammation, mouse macrophages RAW264.7 cells were incubated with saline or with FBDS (low, moderate or high dosage) followed by stimulation with LPS. Subsequently, the production of proinflammatory cytokines was examined. At first, the cell viability of RAW264.7 cells following FBDS treatment was examined and it was identified that RAW264.7 viability was not affected by FBDS treatment (Fig. S1A). As shown in Fig. 1A, treatment with FBDS significantly decreased the mRNA levels of pro-inflammatory cytokines induced by LPS stimulation (TNFα, IL-6, IL-1β and IL-8) compared with the group treated with LPS and control serum in a dose-dependent manner. In addition, consistent with the mRNA data, the ELISA data indicated that protein expression levels of TNFα and IL-6 were also decreased by FBDS incubation compared with the group treated with LPS and control serum (Fig. 1B).

Figure 1

FBDS reduces proinflammatory cytokine expression in LPS-stimulated RAW264.7 macrophages. RAW264.7 cells were incubated with blank serum or FBDS (10%) for 24 h, followed by LPS stimulation (100 ng/ml) for 8 h. (A) The relative mRNA levels of TNFα, IL-6, IL-1β and IL-8. (B) The protein levels of TNFα and IL-6. Data are representative of three independent experiments (mean ± standard deviation). #P<0.05 vs. control group; *P<0.05, **P<0.01, ***P<0.001 vs. LPS group. FBDS, Feibi decoction-medicated serum; LPS, lipopolysaccharide; TNF, tumor necrosis factor; IL, interleukin.

FBDS reduces proinflammatory cytokine expression in LPS-stimulated BMDMs

To confirm the results in Fig. 1, BMDMs were used and the experiments repeated. The cell viability of BMDMs following FBDS treatment and identification of BMDMs was confirmed (Fig. S1A and B). As shown in Fig. 2 and consistent with the expression data in Fig. 1, it was identified that FBDS treatment also decreased the production of proinflammatory cytokines in both mRNA and protein levels in BMDMs compared with the group treated with LPS and control serum.

Figure 2

FBDS reduces pro-inflammatory cytokines expression in LPS-stimulated (BMDMs). BMDMs were incubated with blank serum or FBDS (10%) for 24 h, followed by LPS stimulation (100 ng/ml) for 8 h. (A) The relative mRNA levels of TNFα, IL-6, IL-1β and IL-8. (B) The protein levels of TNFα and IL-6. Data are representative of three independent experiments (mean ± standard deviation). #P<0.05 vs. control group; *P<0.05, **P<0.01, ***P<0.001 vs. LPS group. FBDS, Feibi decoction-medicated serum; BMDMs, bone marrow derived macrophages; LPS, lipopolysaccharide.

FBDS inhibits the activation of NF-κB signaling pathway

NF-κB represents a paradigm for signal transduction and proinflammatory cytokine production (15,16). Therefore, the present study examined whether FBDS treatment regulated LPS-induced proinflammatory cytokine production via the NF-κB signaling pathway. Western blotting demonstrated that LPS-induced phosphorylation of p65 and IKKβ were all suppressed by FBDS treatment in BMDMs (Fig. 3A) or RAW264.7 cells (Fig. S2A). Western blotting and quantification of protein levels of p-P65 and p-IKKβ are presented in Fig. 3.

Figure 3

FBDS inhibits the activation of NF-κB signaling pathway. BMDMs were incubated with blank serum or FBDS (10%) for 24 h, followed by LPS stimulation (100 ng/ml) for 8 h. (A) Phosphorylation of p65 and IKKβ was examined by western blot assay. Quantification of protein levels of (B) p-p65 and (C) p-IKKβ in (A). Data are representative of three independent experiments (mean ± standard deviation). #P<0.05 vs. control group; *P<0.05, **P<0.01, ***P<0.001 vs. LPS group. FBDS, Feibi decoction-medicated serum; BMDMs, bone marrow derived macrophages; LPS, lipopolysaccharide; IKKβ, IκB kinase; p-, phosphorylated.

FBDS suppresses the activation of Smad2/Smad3

A previous study indicated that the Smad signaling pathways are closely associated with the genesis and development of pulmonary fibrosis in response to inflammatory stimulation (17). Therefore the effect of FBDS on Smad2/3 activation was examined. As shown in Fig. 4A, phosphorylation of Smad2/3 induced by LPS was significantly inhibited in FBDS pre-treated BMDMs in a dose-dependent manner compared with the group treated with LPS and control serum, and similar results were also observed in RAW264.7 cells (Fig. S2B). Quantification of protein levels of p-Smad2 and p-Smad3 are presented as Fig. 4B and C.

Figure 4

FBDS suppresses the activation of Smad2/Smad3. BMDMs were incubated with blank serum or FBDS (10%) for 24 h, followed by LPS stimulation (100 ng/ml) for 8 h. (A) Phosphorylation of Smad2 and Smad3 was examined by western blot assay. Quantification of protein levels of (B) p-Smad2 and (C) p-Smad3 in part (A). Data are representative of three independent experiments (mean ± standard deviation). #P<0.05 vs. control group; **P<0.01, ***P<0.001 vs. LPS group. FBDS, Feibi decoction-medicated serum; BMDMs, bone marrow derived macrophages; LPS, lipopolysaccharide; p-, phosphorylated.

FBDS decreases the expression of TGF-β1 and CHI3L1

TGF-β is well known as the critical upstream ligand of Smad signaling pathways. It was observed that FBDS treatment significantly decreased the mRNA level of TGF-β1 (Fig. 5A), as well as the protein level of TGF-β1 (Fig. 5B and C). Previous studies suggested CHI3L1 as a novel biomarker of inflammation, and whether FBDS could also regulate the expression of CHI3L1 was investigated (1,2). Notably, it was identified that the mRNA level of CHI3L1 was also decreased by FBDS treatment compared with the group treated with LPS and control serum (Fig. 5A). The protein level of CHI3L1 was also suppressed in FBDS-treated BMDMs (Fig. 5B and D) compared with the group treated with LPS and control serum. Similar results were also observed in RAW264.7 cells (Fig. S2C).

Figure 5

FBDS decreases the expression of TGF-β1 and CHI3L1. BMDMs were incubated with blank serum or FBDS (10%) for 24 h, followed by LPS stimulation (100 ng/ml) for 8 h. (A) The relative mRNA levels and (B) the protein levels of TGF-β1 and CHI3L1. Quantification of protein levels of (C) TGF-β1 and (D) CHI3L1 in B. Data are representative of three independent experiments (mean ± standard deviation). #P<0.05 vs. control group; *P<0.05, **P<0.01, ***P<0.001 vs. LPS group. FBDS, Feibi decoction-medicated serum; TGF, transforming growth factor; CHI3L1, chitinase-3-like protein 1; BMDMs, bone marrow derived macrophages; LPS, lipopolysaccharide.

Discussion

PF is a chronic, debilitating and often lethal lung disorder. Although the molecular mechanisms of PF are gradually becoming clear with numerous researchers' efforts, few effective drugs have been developed to reverse human PF or even halt the chronic progression to respiratory failure (8,18,19). Therefore, novel strategies are urgently required. Traditional Chinese medicine, which is the main component of the medical practice used for >5,000 years in China, has been demonstrated to be effective in the treatment of a diverse range human diseases (20-22). FBD has been widely used for treatment of patients with lung diseases such as cough and PF. For the first time, to the best of the authors' knowledge, it was identified in the present study that FBDS significantly inhibit proinflammatory cytokine production in macrophages, which suggested that FBD may also serve an anti-inflammatory role.

NF-κB, is reported as a central dimeric transcription factor, regulating the expression of genes responsible for innate and adaptive immunity, cell proliferation and apoptosis (15,16). Previous studies have also reported that NF-κB signaling participates in the regulation of PF (23,24). In present study, it was observed that FBDS treatment significantly alleviated the inflammatory cytokines production induced by LPS in a dose-dependent manner in RAW264.7 cells and BMDMs. In addition, it was identified that FBDS treatment individually did not affect the cell viability in RAW264.7 cells and BMDMs. Consistently, the inflammatory cytokines expression levels were not changed following LPS stimulation (data not shown), which indicated that FBDS may inhibit inflammation by affecting downstream signaling pathways stimulated by LPS, and NF-kB signaling pathway is the most important downstream pathway in response to the LPS stimulation. It was identified that FBDS suppressed the phosphorylation of P65 and IKKβ, indicating that FBD may inhibit the activation of NF-κB. Phosphorylation of Smad2 and Smad3 induces fibrosis and was hypothesized to be the main cause of PF (25). The effect of FBDS on LPS-induced phosphorylation of Smad2 and Smad3 was also detected, and it was identified that the levels of phosphorylation were significantly decreased by FBDS treatment; these data suggested that FBDS alleviated LPS-induced inflammation primarily through the NF-κB and Smad2/3 signaling pathways.

Notably, it was also identified that the mRNA and protein expression of TGF-β1, the critical upstream ligand of Smad signaling pathways, were significantly inhibited in FBDS-treated macrophages. In addition, the expression of CHI3L1, a novel biomarker of inflammation, was also inhibited at both mRNA and protein levels. However, the precise mechanisms by which FBD regulates the mRNA and protein expression of TGF-β1 and CHI3L1 requires further study. Although RAW264.7 cells and BMDMs were used to illustrate the effect of FBDS in inflammation, both of these cells are widely used in LPS-related inflammatory studies, so the results of the present study may also need to be repeated in another different type of macrophage cell line to prove the robustness of the hypothesis.

Supplementary Material

Effect of FBDS on RAW264.7 and BMDMs viability. and identification of BMDMs. RAW264.7 cells and BMDMs were incubated with blank serum or FBDS (10%) for 24 h, followed by LPS stimulation (100 ng/ml) for 8 h. (A) Cell viability of RAW264.7 and BMDMs. (B) BMDMs identified by flow cytometry using F4/80 and CD11b antibodies. Data are representative of three independent experiments (mean ± standard deviation). FBDS, Feibi decoction-medicated serum; BMDMs, bone marrow derived macrophages; LPS, lipopolysaccharide.
NF-κB, Smad2/Smad3 activation and TGF-β1, CHI3L1 expression levels are suppressed by FBDS treatment in RAW264.7 cells. RAW264.7 cells were incubated with blank serum or FBDS (10%) for 24 h, followed by LPS stimulation (100 ng/ml) for 8 h. (A) Phosphorylation of p65 and IKKβ and (B) Smad2 and Smad3 were examined by western blot assay. (C) The protein levels of TGF-β1 and CHI3L1. Data are representative of three independent experiments. TGF, transforming growth factor; CHI3L1, chitinase-3-like protein 1; FBDS, Feibi decoction-medicated serum; LPS, lipopolysaccharide; p-, phosphorylated.

Acknowledgements

Not applicable.

Funding

Funding: This work was supported by the National Natural Science Foundation of China (grant no. 81573970).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

WW, GL and YJ contributed to the conception and design of the study, data acquisition, analysis and revised the manuscript. ZL and XZ contributed to data collection and statistical analysis. HY and SL contributed to data collection, statistical analysis and manuscript preparation. XZ and YJ confirmed the authenticity of all the raw data. All authors have read and approved the final manuscript.

Ethics approval and consent to participate

The protocols were performed in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals (26). The experiments were carried out according to the NIH Guide for the Care and Use of Laboratory Animals (26) and approved by the Animal Ethics Committee of the Scientific Investigation Board of Beijing university of Chinese medicine.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Li Y, Liang J, Yang T, Monterrosa Mena J, Huan C, Xie T, Kurkciyan A, Liu N, Jiang D and Noble PW: Hyaluronan synthase 2 regulates fibroblast senescence in pulmonary fibrosis. Matrix Biol. 55:35–48. 2016.PubMed/NCBI View Article : Google Scholar

2 

Lasky JA and Ortiz LA: Antifibrotic therapy for the treatment of pulmonary fibrosis. Am J Med Sci. 322:213–221. 2001.PubMed/NCBI View Article : Google Scholar

3 

Zhao L, Wang X, Chang Q, Xu J, Huang Y, Guo Q, Zhang S, Wang W, Chen X and Wang J: Neferine, a bisbenzylisoquinline alkaloid attenuates bleomycin-induced pulmonary fibrosis. Eur J Pharmacol. 627:304–312. 2010.PubMed/NCBI View Article : Google Scholar

4 

Wang HD, Yamaya M, Okinaga S, Jia YX, Kamanaka M, Takahashi H, Guo LY, Ohrui T and Sasaki H: Bilirubin ameliorates bleomycin-induced pulmonary fibrosis in rats. Am J Respir Crit Care Med. 165:406–411. 2002.PubMed/NCBI View Article : Google Scholar

5 

Chen CY, Peng WH, Wu LC, Wu CC and Shihlan H: Luteolin ameliorates experimental lung fibrosis both in vivo and in vitro: Implications for therapy of lung fibrosis. J Agric Food Chemy. 58:11653–11661. 2010.PubMed/NCBI View Article : Google Scholar

6 

Tsai KD, Yang SM, Lee JC, Wong HY, Shih CM, Lin TH, Tseng MJ and Chen W: Panax notoginseng attenuates Bleomycin-Induced pulmonary fibrosis in mice. Evid Based Complement Alternat Med. 2011(404761)2011.PubMed/NCBI View Article : Google Scholar

7 

Sener G, Topaloglu N, Sehirli AO, Ercan F and Gedik N: Resveratrol alleviates bleomycin-induced lung injury in rats. Pulm Pharmacol Ther. 20:642–649. 2007.PubMed/NCBI View Article : Google Scholar

8 

Li LC and Kan LD: Traditional Chinese medicine for pulmonary fibrosis therapy: Progress and future prospects. J Ethnopharmacol. 198:45–63. 2017.PubMed/NCBI View Article : Google Scholar

9 

Xiang J, Cheng S, Feng T, Wu Y, Xie W, Zhang M, Xu X and Zhang C: Neotuberostemonine attenuates bleomycin-induced pulmonary fibrosis by suppressing the recruitment and activation of macrophages. Int Immunopharmacol. 36:158–164. 2016.PubMed/NCBI View Article : Google Scholar

10 

Xiong X, Yang X, Liu Y, Zhang Y, Wang P and Wang J: Chinese herbal formulas for treating hypertension in traditional Chinese medicine: Perspective of modern science. Hypertens Res. 36:570–579. 2013.PubMed/NCBI View Article : Google Scholar

11 

National Research Council (US) Committee for the Update of the Guide for the Care and Use of Laboratory Animals: Guide for the Care and Use of Laboratory Animals, 8th edition. National Academies Press, Washington, DC, 2011.

12 

Ferri F, Parcelier A, Petit V, Gallouet AS, Lewandowski D, Dalloz M, van den Heuvel A, Kolovos P, Soler E, Squadrito ML, et al: TRIM33 switches off Ifnb1 gene transcription during the late phase of macrophage activation. Nat Commun. 6(8900)2015.PubMed/NCBI View Article : Google Scholar

13 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar

14 

Lee GT, Kwon SJ, Lee JH, Jeon SS, Jang KT, Choi HY, Lee HM, Kim WJ, Kim SJ and Kim IY: Induction of interleukin-6 expression by bone morphogenetic protein-6 in macrophages requires both SMAD and p38 signaling pathways. J Biol Chem. 285:39401–39408. 2010.PubMed/NCBI View Article : Google Scholar

15 

Karin M and Lin A: NF-kappaB at the crossroads of life and death. Nat Immunol. 3:221–227. 2002.PubMed/NCBI View Article : Google Scholar

16 

Li Q and Verma IM: NF-kappaB regulation in the immune system. Nat Rev Immunol. 2:725–734. 2002.PubMed/NCBI View Article : Google Scholar

17 

Wang P, Nie X, Wang Y, Li Y, Ge C, Zhang L, Wang L, Bai R, Chen Z, Zhao Y and Chen C: Multiwall carbon nanotubes mediate macrophage activation and promote pulmonary fibrosis through TGF-β/Smad signaling pathway. Small. 9:3799–3811. 2013.PubMed/NCBI View Article : Google Scholar

18 

Meyer KC: Pulmonary fibrosis, part I: Epidemiology, pathogenesis, and diagnosis. Expert Rev Respir Med. 11:343–359. 2017.PubMed/NCBI View Article : Google Scholar

19 

Smith ML: Update on pulmonary fibrosis: Not all fibrosis is created equally. Arch Pathol Lab Med. 140:221–229. 2016.PubMed/NCBI View Article : Google Scholar

20 

Xu X, Li D, Gao H, Gao Y, Zhang L, Du Y, Wu J and Gao P: Protective effect of the traditional Chinese medicine xuesaitong on intestinal ischemia-reperfusion injury in rats. Int J Clin Exp Med. 8:1768–1779. 2015.PubMed/NCBI

21 

Ding Z and Lian F: Traditional Chinese medical herbs staged therapy in infertile women with endometriosis: A clinical study. Int J Clin Exp Med. 8:14085–14089. 2015.PubMed/NCBI

22 

Yin D, Liu Z, Peng D, Yang Y, Gao X, Xu F and Han L: Serum containing Tao-Hong-Si-Wu decoction induces human endothelial cell VEGF production via PI3K/Akt-eNOS signaling. Evid Based Complement Alternat Med. 2013(195158)2013.PubMed/NCBI View Article : Google Scholar

23 

Qin Y, Li S, Zhao G, Fu X, Xie X, Huang Y, Cheng X, Wei J, Liu H and Lai Z: Long-term intravenous administration of carboxylated single-walled carbon nanotubes induces persistent accumulation in the lungs and pulmonary fibrosis via the nuclear factor-kappa B pathway. Int J Nanomedicine. 12:263–277. 2017.PubMed/NCBI View Article : Google Scholar

24 

Yang D, Yuan W, Lv C, Li N, Liu T, Wang L, Sun Y, Qiu X and Fu Q: Dihydroartemisinin supresses inflammation and fibrosis in bleomycine-induced pulmonary fibrosis in rats. Int J Clin Exp Pathol. 8:1270–1281. 2015.PubMed/NCBI

25 

Zhou Y, He Z, Gao Y, Zheng R, Zhang X, Zhao L and Tan M: Induced pluripotent stem cells inhibit bleomycin-induced pulmonary fibrosis in mice through suppressing TGF-β1/Smad-mediated epithelial to mesenchymal transition. Front Pharmacol. 7(430)2016.PubMed/NCBI View Article : Google Scholar

26 

National Research Council (US) Institute for Laboratory Animal Research: Guide for the Care and Use of Laboratory Animals. National Academies Press (US), Washington, DC, 1996.

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wei W, Li G, Liu Z, Yang H, Liu S, Zou X and Jiao Y: Feibi decoction‑medicated serum inhibits lipopolysaccharide‑induced inflammation in RAW264.7 cells and BMDMs. Exp Ther Med 23: 110, 2022.
APA
Wei, W., Li, G., Liu, Z., Yang, H., Liu, S., Zou, X., & Jiao, Y. (2022). Feibi decoction‑medicated serum inhibits lipopolysaccharide‑induced inflammation in RAW264.7 cells and BMDMs. Experimental and Therapeutic Medicine, 23, 110. https://doi.org/10.3892/etm.2021.11033
MLA
Wei, W., Li, G., Liu, Z., Yang, H., Liu, S., Zou, X., Jiao, Y."Feibi decoction‑medicated serum inhibits lipopolysaccharide‑induced inflammation in RAW264.7 cells and BMDMs". Experimental and Therapeutic Medicine 23.1 (2022): 110.
Chicago
Wei, W., Li, G., Liu, Z., Yang, H., Liu, S., Zou, X., Jiao, Y."Feibi decoction‑medicated serum inhibits lipopolysaccharide‑induced inflammation in RAW264.7 cells and BMDMs". Experimental and Therapeutic Medicine 23, no. 1 (2022): 110. https://doi.org/10.3892/etm.2021.11033
Copy and paste a formatted citation
x
Spandidos Publications style
Wei W, Li G, Liu Z, Yang H, Liu S, Zou X and Jiao Y: Feibi decoction‑medicated serum inhibits lipopolysaccharide‑induced inflammation in RAW264.7 cells and BMDMs. Exp Ther Med 23: 110, 2022.
APA
Wei, W., Li, G., Liu, Z., Yang, H., Liu, S., Zou, X., & Jiao, Y. (2022). Feibi decoction‑medicated serum inhibits lipopolysaccharide‑induced inflammation in RAW264.7 cells and BMDMs. Experimental and Therapeutic Medicine, 23, 110. https://doi.org/10.3892/etm.2021.11033
MLA
Wei, W., Li, G., Liu, Z., Yang, H., Liu, S., Zou, X., Jiao, Y."Feibi decoction‑medicated serum inhibits lipopolysaccharide‑induced inflammation in RAW264.7 cells and BMDMs". Experimental and Therapeutic Medicine 23.1 (2022): 110.
Chicago
Wei, W., Li, G., Liu, Z., Yang, H., Liu, S., Zou, X., Jiao, Y."Feibi decoction‑medicated serum inhibits lipopolysaccharide‑induced inflammation in RAW264.7 cells and BMDMs". Experimental and Therapeutic Medicine 23, no. 1 (2022): 110. https://doi.org/10.3892/etm.2021.11033
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team