Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
February-2022 Volume 23 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
February-2022 Volume 23 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Pitavastatin maintains MAPK7 expression and alleviates angiotensin II‑induced vascular endothelial cell inflammation and injury

  • Authors:
    • Min Li
    • Xiaohua Liu
  • View Affiliations / Copyright

    Affiliations: Department of Outpatient Nursing, The Second Affiliated Hospital of Zhejiang University School of Medicine, Hangzhou, Zhejiang 310000, P.R. China, Department of Nursing, Chengdu Shuangliu District Maternal and Child Health Hospital, Chengdu, Sichuan 610200, P.R. China
    Copyright: © Li et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 132
    |
    Published online on: December 13, 2021
       https://doi.org/10.3892/etm.2021.11055
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Statins have been reported to suppress vascular remodeling in rats with spontaneous hypertension. However, the possible effects of the statin pitavastatin on hypertension‑induced endothelial inflammation and injury remain to be fully elucidated. The present study aimed to evaluate the effects of pitavastatin on HUVEC injury and inflammation. HUVECs were exposed to angiotensin (Ang) II with or without pitavastatin co‑treatment, after which MAPK7 expression was detected via reverse transcription‑quantitative PCR and western blotting. MAPK7 expression was additionally silenced in HUVECs via transfection with short hairpin RNA, followed by Ang II treatment with or without pitavastatin. Cell viability, inflammation, reactive oxygen species (ROS) production, nitric oxide (NO) production and cell apoptosis were then measured by using Cell Conting Kit‑8, ELISA, commercial corresponding kits and TUNEL staining, respectively. Western blotting was also used to determine the protein expression of endothelial NO synthase and endothelin 1, and the proteins involved in apoptosis. Results of the present study demonstrated that the expression levels of MAPK7 in Ang II‑induced endothelial cells were decreased, which was reversed following treatment with pitavastatin. Pitavastatin reversed the Ang II‑induced reduction in cell viability and reversed the Ang II‑induced increase in inflammatory factor and ROS levels and apoptosis in HUVECs by activating MAPK7. Treatment with pitavastatin also increased the production of NO in addition to increasing the expression of endothelial NO synthase and endothelin‑1 in Ang II‑induced HUVECs through MAPK7 activation. Collectively, results from the present study demonstrated that treatment with pitavastatin preserves MAPK7 expression to alleviate Ang II‑induced vascular endothelial cell inflammation and injury. Therefore, findings of the present study may help to elucidate the mechanisms underlying the effects of pitavastatin on vascular endothelial cell inflammation and injury.

Introduction

Hypertension is associated with high rates of incidence worldwide, which is considered to be major risk factor for stroke, coronary heart disease and chronic kidney disease (1). A previous study determined that ~1 billion people had primary hypertension, worldwide (2). Selection of treatment for hypertension remains to be a complex medical issue, since patients may suffer with side effects associated with the medication used to treat hypertension (3). Although an increasing number of pathological factors have been associated with hypertension, the specific mechanism of its pathogenesis remains unclear. Results of previous studies have demonstrated that endothelial dysfunction is closely associated with the occurrence and development of hypertension (4,5). Endothelial dysfunction is considered to be one of the main causes of microvascular and macrovascular complications associated with hypertension (4,5). In addition, endothelial dysfunction has been reported to be a major factor underlying hypertension in the heart and kidneys, causing organ dysfunction (6). Endothelial dysfunction is characterized by changes in permeability and impaired vasodilation, which have been closely associated with both physiological and pathological processes, including aging, apoptosis, nitric oxide (NO) production and autophagy (7). Results of previous studies have demonstrated that high blood pressure can affect the function of endothelial cells through a number of methods (8,9). High blood pressure has been reported to suppress endothelial-dependent vasodilation by NO, increase the permeability of endothelial cells, induce endothelial cell oxidative stress, promote endothelin 1 (ET-1) and angiotensin II (Ang II) production and promote inflammation (10). In turn, these may lead to endothelial cell dysfunction to aggravate hypertension and damage the organ involved (11,12). Endothelial function is a key prognostic indicator of hypertension, where endothelial dysfunction limits the auto-repair and regeneration function of endothelial cells (13). Therefore, it remains of key importance to explore novel targets of endothelial cells to protect against endothelial cell injury and to more effectively diagnose and treat hypertension.

ERK5 is also known as MAPK7 and is a key signaling molecule in the maintenance of endothelial cell integrity and homeostasis (14). Atorvastatin, a type of statin, can be used for the treatment of hypertension (15). In rat models of spontaneous hypertension, atorvastatin has been documented to reduce vascular remodeling by activating protein kinase D/ERK5 (16,17). Pitavastatin is an alternative statin that is excreted in the feces through the hepatoenteric circulation (13,14). Only a small portion of pitvastatin is selectively absorbed by hepatocytes and metabolized by the cytochrome system, meaning that it can avoid interactions with other drugs metabolized by this enzyme system (18,19). However, the effects of pitavastatin in endothelial cell inflammation and injury induced by hypertension remain to be elucidated.

Therefore, the aim of the present study was to investigate the mechanism underlying the effects of pitavastatin on endothelial cell physiology and its potential association with ERK5.

Materials and methods

Materials

Ang II was purchased from APExBIO Technology LLC, whilst pitavastatin was purchased from HL Genomics, Co., Ltd. Antibodies were purchased as follows: Anti-phosphorylated (p)-endothelial NO synthase (eNOS; cat. no. ab215717; 1:1,000; Abcam), anti-eNOS (cat. no. ab76198; 1:1,000; Abcam), anti-endothelin (ET)1 (cat. no. ab2786; 1:1,000; Abcam), anti-Bcl-2 (cat. no. ab32124; 1:1,000; Abcam), anti-Bax (cat. no. ab32503; 1:1,000; Abcam), anti-cleaved caspase-3 (cat. no. ab2302; 1:1,000; Abcam), anti-cleaved poly (ADP-ribose) polymerase 1 (PARP1; cat. no. ab32064; 1:1,000; Abcam), anti-ERK5 (cat. no. ab40809; 1:1,000; Abcam), anti-GAPDH (cat. no. ab181602; 1:2,000; Abcam), HRP-conjugated goat anti-mouse IgG H&L (cat. no. ab205719; 1:10,000; Abcam), HRP-conjugated goat anti-rabbit IgG H&L (cat. no. ab205718; 1:10,000; Abcam) and Alexa Fluor® 488 goat anti-rabbit IgG H&L (cat. no. ab150077; 1:10,000; Abcam).

The following kits were purchased as follows: NO Colorimetric assay kit (cat. no. E-BC-K035-S; Elabscience Biotechnology, Inc.), reactive oxygen species (ROS) colorimetric assay kit (cat. no. E-BC-K138-F; Elabscience Biotechnology, Inc.), TNF-α ELISA kit (cat. no. ADI-901-099; Enzo Life Sciences, Inc.), IL-1β ELISA kit (cat. no. EHC002b.48; NeoBioscience Technology Co., Ltd.) and the IL-6 ELISA kit (cat. no. ADI-901-033; Enzo Life Sciences, Inc.).

Bioinformatics analysis

To search for the potential targets of pitavastatin, the online database STITCH (https://stitch.embl.de/) was used by entering ‘pitavastatin’ in the ‘Item Name’ box. The minimum required interaction score was set to >0.4.

Cell lines and transfection

HUVECs (cat. no. BNCC347734; an extensively used endothelial cell model in vitro) (20) and vascular cell basal medium (cat. no. BNCC341789) containing 5% FBS, were purchased from BeNa Culture Collection; Beijing Beina Chunglian Biotechnology Research Institute. HUVECs were cultured in 5% CO2 with 95% humidity at 37˚C in a CO2 incubator.

To construct the lentivirus vector expressing MAPK7 short hairpin (sh)-RNA (shRNA-MAPK7-1 or shRNA-MAPK7-2), shRNA sequences were annealed and inserted between the EcoRI and BglII sites of the pHBLV-U6-Puro vector (Hanbio Biotechnology Co., Ltd.). The vectors were then co-transfected along with the packaging plasmids including Gal-pol, Rev and VSV-G (all from Yunzhou Bio, China) in a ratio of 2:1:1:1, into 293T cells (ATCC) using Lipofectamine® 2000 (Thermo Fisher Scientific, Inc.). After incubation at 37˚C for 72 h, the culture medium was collected and centrifuged at 500 x g for 5 min at room temperature to obtain the viral supernatant. Finally, HUVECs were transfected with the lentiviral shRNAs (2rd generation) at a MOI of ~3 and incubated at 37˚C. Puromycin (Thermo Fisher Scientific, Inc.) selection (2 µg/ml) was added 2 days post-transfection and after another 2 days incubation at 37˚C, transfection efficiency was detected using western blot analysis. The shRNA sequences were listed as follows: shRNA-MAPK7-1 forward 5'-CCGGACAAGTTACTAAGCCATATTTCTCGAGAAATATGGCTTAGTAACTTG TTTTTTG-3' and reverse, 5'-AATTCAAAAAACAAGTTACTAAGCCATATTTCTCGAGAAATATGGCTTAGTAA CTTGT-3'; shRNA-MAPK7-2 forward, 5'-CCGGTTGTTAGGAGACAAGTTAAATCTCGAGATTTAACTTGTCTCCTAACAATTTTTG-3' and reverse, 5'-AATTCAAAAATTGTTAGGAGACAAGTTAAATCTCGAGATTTAACTTGTCTCCTAACAA-3'.

Cell viability assay

Cell Counting Kit-8 (CCK-8; cat. no. C0039; Beyotime Institute of Biotechnology) assays were performed to measure cell viability. HUVECs were inoculated into 96-well plates (2x103 cells/well). After being treated with 1 µM Ang II with or without 1 µM pitavastatin co-treatment for 24 h at 37˚C, cells were incubated with 20 µl CCK-8 solution per well at 37˚C for 2 h. The absorbance was measured at 450 nm using a spectrophotometer.

TUNEL assay

TUNEL staining was performed using the ApopTag Fluorescein in situ Apoptosis Detection kit (cat. no. S7110; Sigma-Aldrich; Merck KGaA) following the manufacturer's protocol. Briefly, after being treated with 1 µM Ang II with or without 1 µM pitavastatin co-treatment at 37˚C for 24 h, control (untransfected) or transfected HUVECs (2x104) were washed with PBS and subsequently fixed using 4% paraformaldehyde for 30 min at room temperature. Cells were incubated for 90 min at 37˚C with the terminal deoxynucleotidyltransferase (TdT) incubation buffer. The negative control slide was incubated without the TdT enzyme. The reaction was terminated by washing with PBS and the slide was examined under a fluorescence microscope (Nikon Eclipse 80i; Nikon Corporation). DAPI (5 µg/ml) was used to stain the nuclei blue at room temperature for 5 min. Three fields of view per well were observed (magnification, x200) and the percentage of TUNEL positive cells was calculated using ImageJ software (version 1.8.0; National Institutes of Health) as follows: TUNEL-positive cells (%) = the density of green/blue x100%.

Detection of NO and ROS

HUVECs were inoculated into 96-well plates (2x103 cells/well). After treatment with 1 µM Ang II with or without 1 µM pitavastatin co-treatment for 24 h at 37˚C, detection of NO and ROS levels in the HUVEC culture medium was performed using the aforementioned commercial kits. Levels of NO and ROS were measured at 520 nm using a Multiskan Mk3 microplate reader (Thermo Fisher Scientific, Inc.).

ELISA

Concentrations of TNF-α, IL-1β and IL-6 in the HUVEC culture medium were detected using the aforementioned ELISA kits according to the manufacturer's protocol. Expression levels were quantified using a Multiskan Mk3 microplate reader (Thermo Fisher Scientific, Inc.).

Reverse transcription-quantitative PCR (RT-qPCR)

Total RNA from HUVECs was collected using the TRIzol agent (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol, then reversely transcribed into cDNA using PrimeScript™ RT Master Mix (cat. no. RR036A; Takara Bio, Inc.) according to the manufacturer's protocol. Subsequently, qPCR was performed using TB Green™ Fast qPCR Mix (Takara Bio, Inc.) on an Applied Biosystems 7500 Real-Time PCR System (Thermo Fisher Scientific, Inc.). The results were analyzed using the 2-ΔΔCq method (21). The thermocycling conditions used for qPCR were: 95˚C for 2 min, followed by 40 cycles of 95˚C for 20 sec and 65˚C for 40 sec. The sequences of the primers were as follows: MAPK7 forward, 5'-ACACGACAACATCATCGCCA-3' and reverse, 5'-TCCAGGACCACGTAGACAGA-3' and β-actin forward, 5'-ACAGAGCCTCGCCTTTGCC-3' and reverse, 5'-GATATCATCATCCATGGTGAGCTGG-3'. β-actin was used as the internal reference.

Western blot analysis

Total protein was extracted from the cell lysate using the RIPA buffer (Beyotime Institute of Biotechnology). The protein samples were quantified using a BCA assay (Pierce; Thermo Fisher Scientific, Inc.). Subsequently, extracted proteins (50 µg per lane) were separated by 10% SDS-PAGE and transferred onto PVDF membranes (EMD Millipore). Membranes were blocked with 5% skimmed milk at room temperature for 2 h and subsequently incubated with the aforementioned primary antibodies overnight at 4˚C. Following primary antibody incubation, membranes were incubated with the aforementioned corresponding secondary antibodies at room temperature for 2 h. Protein bands were visualized using Pierce™ ECL (Thermo Fisher Scientific, Inc.). Protein expression was quantified using ImageJ software (version 1.8.0; National Institutes of Health).

Statistical analysis

All experiments were performed in triplicate. All data are presented as the mean ± standard deviation and samples were evaluated using one-way ANOVA followed by Tukey's test using SPSS 16.0 (SPSS, Inc.). An unpaired Student's t tests were used for comparisons between two groups. P<0.05 was considered to indicate a statistically significant difference.

Results

Pitavastatin increases MAPK7 expression in Ang II-induced endothelial cells

As shown in Fig. 1A and B, the expression levels of MAPK7 were detected using RT-qPCR and western blot analyzes. The results demonstrated that the expression levels of MAPK7 were significantly decreased following treatment with 1 µM Ang II in a time-dependent manner. In particular, MAPK7 expression was the lowest following treatment with 1 µM Ang II for 24 h (Fig. 1A and B). Therefore, this treatment time was selected for subsequent studies. The STITCH (http://stitch.embl.de/) database was subsequently used to predict potential pitavastatin targets, which revealed MAPK7 as one of the hits (Fig. 1C). Following pitavastatin treatment, the expression levels of MAPK7 were detected using western blot analysis. Results of the present study demonstrated that the expression levels of MAPK7 in Ang II-induced HUVECs were increased following treatment with pitavastatin, especially at higher doses of 0.5 and 1 µM (Fig. 1D). In conclusion, pitavastatin restored MAPK7 expression in Ang II-induced endothelial cells.

Figure 1

Pitavastatin increases MAPK7 expression in Ang II-induced endothelial cells. Expression levels of MAPK7 in Ang II-induced endothelial cells were measured using (A) western blot analysis and (B) reverse transcription-quantitative PCR. (C) STITCH predicted that pitavastatin targeted MAPK7 expression. (D) Expression of MAPK7 was detected using western blot analysis. *P<0.05, **P<0.01 and ***P<0.001 vs. Control; ###P<0.001 vs. Ang II; ΔΔΔP<0.001 vs. 1 µM pitavastatin. Ang II, angiotensin II.

Pitavastatin alleviates damage in Ang II-induced HUVECs by activating MAPK7

To determine the effects of pitavastatin on Ang II-induced endothelial cell viability and inflammation, loss of function experiments were performed. HUVECs were transfected with shRNA-NC, shRNA-MAPK7-1 or shRNA-MAPK7-2 for MAPK7 silencing. As demonstrated in Fig. 2A and B, there was no significant difference in MAPK7 expression between the sh-negative control (NC) group compared with that in the control group. However, MAPK7 expression levels were significantly reduced in HUVECs transfected with sh-MAPK7-1 or sh-MAPK7-2 compared with those in the sh-NC group (Fig. 2A and B). Since the transfection efficiency was the highest following transfection with sh-MAPK7-1, this shRNA was used for subsequent experiments.

Figure 2

Pitavastatin alleviates damage in Ang II-induced HUVECs by activating MAPK7. MAPK7 expression in HUVECs was measured using (A) western blot analysis and (B) reverse transcription-quantitative PCR. ***P<0.001 vs. shRNA-NC. (C) Cell Counting Kit-8 assay was used to measure the cell viability of Ang II-induced HUVECs following treatment with different concentrations of pitavastatin. (D) ELISA were used to measure the production of TNF-α, IL-1β and IL-6. (E) Commercial kits were used to detect the levels of reactive oxygen species. **P<0.01 and ***P<0.001 vs. Control; #P<0.05, ##P<0.01 and ###P<0.001 vs. Ang II; ΔP<0.05, ΔΔP<0.01 and ΔΔΔP<0.001 vs. 1 µM pitavastatin. Ang II, angiotensin II; shRNA, short hairpin RNA; NC, negative control.

In addition, cell viability were significantly decreased following treatment with Ang II, which was significantly reversed by pitavastatin treatment (Fig. 2C). By contrast, this pitavastatin-induced restoration of cell viability was significantly prevented by MAPK7 knockdown (Fig. 2C). As demonstrated in Fig. 2D, the secretion of IL-1β, IL-6 and IL-8 were significantly increased following treatment with Ang II but were significantly reversed by pitavastatin. The anti-inflammatory effects of pitavastatin on IL-1β, IL-6 and IL-8 were in turn significantly reversed by MAPK7 knockdown (Fig. 2D). In addition, results of the ROS kit demonstrated that the levels of ROS were significantly increased following Ang II treatment but were reversed by concomitant pitavastatin treatment, which was in turn reversed by transfection with shRNA-MAPK7 (Fig. 2E).

Pitavastatin increases the production of NO, eNOS phosphorylation and ET-1 expression in Ang II-induced HUVECs by activating MAPK7

NO is a key signaling molecule secreted by the vascular endothelium that serves a key role in vascular smooth muscle relaxation by activating certain signal transduction pathways, such as that of hypoxia-inducible factor-1α and VEGF (22). eNOS is a key enzyme in the NO production pathway that is an indirect indicator of heart failure (23). By contrast, ET-1 is mainly secreted by vascular endothelial cells, cardiomyocytes and endocardial cells and is considered to be a potent vasoconstrictor (24). ET-1 co-operates with NO to regulate the vasoconstrictive and diastolic balance of the vascular endothelium (10). As demonstrated in Fig. 3A, treatment with pitavastatin significantly suppressed the expression levels of eNOS and ET-1 in Ang II-induced HUVECs, which were significantly reversed following transfection with the sh-MAPK7 plasmid. Notably, treatment with pitavastatin in Ang II-induced HUVECs increased the production levels of NO and p-eNOS, which were significantly reversed following transfection with sh-MAPK7 (Fig. 3B).

Figure 3

Pitavastatin increases the production of NO, activation eNOS and ET-1 expression in Ang II-induced HUVECs by activating MAPK7. (A) Protein expression of eNOS phosphorylation, eNOS expression and ET-1 expression in Ang II-induced endothelial cells were measured using western blot analysis. (B) NO production was measured using a commercial kit. **P<0.01 and ***P<0.001 vs. Control; #P<0.05, ##P<0.01 and ###P<0.001 vs. Ang II; ΔP<0.05 and ΔΔP<0.01 vs. Ang II + 1 µM pitavastatin. Ang II, angiotensin II; shRNA, short hairpin RNA; NC, negative control; ET-1, endothelin-1; NO, nitric oxide; p-, phosphorylated; eNOS, endothelial NO synthase.

Pitavastatin inhibits the apoptosis of Ang II-induced HUVECs by activating MAPK7

To assess the effects of pitavastatin on the apoptosis of Ang II-induced HUVECs, TUNEL staining was performed. The number of TUNEL-positive cells was significantly reduced in the Ang II + pitavastatin group compared with that in the Ang II-alone group (green represents apoptotic cells). However, transfection with shRNA-MAPK7 significantly reversed the inhibitory effects of pitavastatin on cell apoptosis (Fig. 4A). These results were investigated further by measuring the expression levels of apoptosis-associated proteins. As demonstrated in Fig. 4B, the expression levels of Bax, ratios of cleaved-PARP/PARP and cleaved caspase-3/caspase-3 in the Ang II-induced HUVECs were significantly reduced following treatment with pitavastatin. However, expression levels of the anti-apoptotic protein Bcl-2 were significantly increased by pitavastatin (Fig. 4B). All of the effects mediated by pitavastatin on the expression of proteins associated with apoptosis were significantly reversed by shRNA-MAPK7 transfection (Fig. 4B). These findings suggest that treatment with pitavastatin inhibited the apoptosis of Ang II-induced HUVECs by activating MAPK7.

Figure 4

Pitavastatin inhibits the apoptosis of Ang II-induced HUVECs by activating MAPK7. (A) TUNEL staining was performed to investigate the apoptosis of Ang II-induced HUVECs at 24 h following treatment with pitavastatin. (B) Western blot analyses of Bax, Bcl-2, cleaved-PARP/PARP and cleaved caspase-3/caspase-3 protein levels in Ang II-induced HUVECs. **P<0.01 and ***P<0.001 vs. Control; #P<0.05 and ###P<0.001 vs. Ang II; ΔΔP<0.01 and ΔΔΔP<0.001 vs. Ang II + 1 µM pitavastatin. Ang II, angiotensin II; NC, negative control; shRNA, short hairpin RNA; PARP, poly (ADP-ribose) polymerase 1.

Discussion

Vascular endothelial cell injury is considered to be one of the first events of atherosclerosis and is closely associated with the development of cardiovascular diseases, including coronary heart disease and hypertension (25). Results of a previous study demonstrated that ischemia injury, oxidative stress and oxidized low density lipoprotein can all induce endothelial cell injury and apoptosis (26). In addition, the expression levels of eNOS and ET-1 were significantly increased following the induction of vascular endothelial injury, cell destruction or increased membrane permeability, which were accompanied with reductions in the levels of NO and may reflect the degree of cell injury (27,28). In the present study, HUVECs were treated with 1 µM Ang II, which significantly increased proinflammatory cytokine and ROS production and ET-1 secretion, significantly decreased NO production whilst significantly increasing the rate of apoptosis. These results suggest that Ang II is directly involved in the process of vascular endothelial cell injury and apoptosis.

Statins are lipid-lowering drugs that are frequently applied in clinical practice (29). They have been previously reported to exert anti-inflammatory, anti-oxidation, vascular endothelial protective, plaque stabilizing and anti-platelet properties (30). Results of the present study demonstrated that treatment with pitavastatin significantly increased the production levels of NO and eNOS phosphorylation whilst significantly decreasing ET-1 expression in Ang II-induced HUVECs. Furthermore, treatment with pitavastatin alleviated cell damage and apoptosis of Ang II-induced HUVECs by activating MAPK7, as demonstrated by MAPK7 knockdown experiments.

MAPK is typically activated by epidermal growth factors, inflammatory factors and growth factors, which has been found to regulate the stress response, inflammatory response, cell proliferation and development (31,32). Results of a previous study demonstrated that MAPK7 deficiency alleviated DNA damage in mouse thymus cells and inhibited the growth of mouse thymus lymphoma (33). Gavine et al (34) revealed that MAPK7 expression was higher in squamous cell carcinoma and esophageal carcinoma tissues compared with normal tissues, whilst MAPK7 silencing inhibited the proliferation, migration and invasion of osteosarcoma cells to enhance their sensitivity to chemotherapy. In the present study, treatment with pitavastatin increased MAPK7 expression in Ang II-induced endothelial cells. In addition, it is known that MAPK7 signaling is activated upon phosphorylation (35), therefore, the effects of pitavastatin on the phosphorylation of MAPK7 and the effects of an MAPK7 inhibitor on the effects of pitavastatin should be investigated in future studies.

To conclude, the present study provided supporting evidence that pitavastatin can preserve MAPK7 expression to alleviate Ang II-induced vascular endothelial cell inflammation and injury. Results of the present study revealed a potentially novel therapeutic strategy for the treatment of vascular endothelial cell inflammation and injury. However, the present study solely focused on the pitavastatin-induced regulation of endothelial cell proliferation, inflammation and apoptosis. Further investigations are required to focus on the role of associated signaling pathways.

Acknowledgements

Not applicable.

Funding

Funding: No funding was received.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Author's contributions

ML and XHL contributed to the conception and design of the study. ML and XHL performed the experiments and collected the data. ML and XHL performed the statistical analysis. ML and XHL completed data interpretation. Both authors contributed to reading and revising the manuscript and approved the submitted version. Both authors read and approved the final manuscript. ML and XHL confirm the authenticity of all the raw data.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Di Palo KE and Barone NJ: Hypertension and heart failure: Prevention, targets, and treatment. Heart Fail Clin. 16:99–106. 2020.PubMed/NCBI View Article : Google Scholar

2 

Zhang W, Wang Q, Feng Y, Chen X, Yang L, Xu M, Wang X, Li W, Niu X and Gao D: MicroRNA-26a protects the heart against hypertension-induced myocardial fibrosis. J Am Heart Assoc. 9(e017970)2020.PubMed/NCBI View Article : Google Scholar

3 

Chen Y, Lu W, Yang K, Duan X, Li M, Chen X, Zhang J, Kuang M, Liu S, Wu X, et al: Tetramethylpyrazine: A promising drug for the treatment of pulmonary hypertension. Br J Pharmacol. 177:2743–2764. 2020.PubMed/NCBI View Article : Google Scholar

4 

Zhao H, Wang Y, Zhang X, Guo Y and Wang X: miR-181b-5p inhibits endothelial-mesenchymal transition in monocrotaline-induced pulmonary arterial hypertension by targeting endocan and TGFBR1. Toxicol Appl Pharmacol. 386(114827)2020.PubMed/NCBI View Article : Google Scholar

5 

Dong ZC, Wu MM, Zhang YL, Wang QS, Liang C, Yan X, Zou LX, Chen C, Han X, Zhang B and Zhang ZR: The vascular endothelial growth factor trap aflibercept induces vascular dysfunction and hypertension via attenuation of eNOS/NO signaling in mice. Acta Pharmacol Sin. 42:1437–1448. 2020.PubMed/NCBI View Article : Google Scholar

6 

Mokotedi L, Millen AME, Mogane C, Gomes M, Woodiwiss AJ, Norton GR and Michel FS: Associations of inflammatory markers and vascular cell adhesion molecule-1 with endothelial dysfunction in collagen-induced arthritis. Eur J Pharmacol. 865(172786)2019.PubMed/NCBI View Article : Google Scholar

7 

Canpolat U, Kocyigit D and Yildirim A: Role of endothelial dysfunction and endocan in atherosclerosis: Point of origin or end point? Angiology. 71(477)2020.PubMed/NCBI View Article : Google Scholar

8 

Bhagwani AR, Hultman S, Farkas D, Moncayo R, Dandamudi K, Zadu AK, Cool CD and Farkas L: Endothelial cells are a source of nestin expression in pulmonary arterial hypertension. PLoS One. 14(e0213890)2019.PubMed/NCBI View Article : Google Scholar

9 

Luo S, Xia W, Chen C, Robinson EA and Tao J: Endothelial progenitor cells and hypertension: Current concepts and future implications. Clin Sci (Lond). 130:2029–2042. 2016.PubMed/NCBI View Article : Google Scholar

10 

Masi S, Uliana M and Virdis A: Angiotensin II and vascular damage in hypertension: Role of oxidative stress and sympathetic activation. Vascul Pharmacol. 115:13–17. 2019.PubMed/NCBI View Article : Google Scholar

11 

Ballard KD, Timsina R and Timmerman KL: Influence of time of day and intermittent aerobic exercise on vascular endothelial function and plasma endothelin-1 in healthy adults. Chronobiol Int. 1–8. 2021.PubMed/NCBI View Article : Google Scholar

12 

Zhang X, Hu C, Yuan YP, Song P, Kong CY, Wu HM, Xu SC, Ma ZG and Tang QZ: Endothelial ERG alleviates cardiac fibrosis via blocking endothelin-1-dependent paracrine mechanism. Cell Biol Toxicol. 37:873–890. 2021.PubMed/NCBI View Article : Google Scholar

13 

Hu C and Dong ZL: MicroRNA-212 promotes the recovery function and vascular regeneration of endothelial progenitor cells in mice with ischemic stroke through inactivation of the notch signaling pathway via downregulating MMP9 expression. J Cell Physiol. 234:7090–7103. 2019.PubMed/NCBI View Article : Google Scholar

14 

Gentilini A, Lori G, Caligiuri A, Raggi C, Maira GD, Pastore M, Piombanti B, Lottini T, Arcangeli A, Madiai S, et al: Extracellular signal-regulated kinase 5 regulates the malignant phenotype of cholangiocarcinoma cells. Hepatology. 74:2007–2020. 2021.PubMed/NCBI View Article : Google Scholar

15 

Curran MP: Amlodipine/Atorvastatin: A review of its use in the treatment of hypertension and dyslipidaemia and the prevention of cardiovascular disease. Drugs. 70:191–213. 2010.PubMed/NCBI View Article : Google Scholar

16 

Fang T, Guo B, Xue L and Wang L: Atorvastatin prevents myocardial fibrosis in spontaneous hypertension via interleukin-6 (IL-6)/signal transducer and activator of transcription 3 (STAT3)/endothelin-1 (ET-1) pathway. Med Sci Monit. 25:318–323. 2019.PubMed/NCBI View Article : Google Scholar

17 

Yuan H, Wang D, Zhang Y and Geng J: Atorvastatin attenuates vascular remodelling in spontaneously hypertensive rats via the protein kinase D/extracellular signal-regulated kinase 5 pathway. Clin Exp Pharmacol Physiol. 47:1429–1438. 2020.PubMed/NCBI View Article : Google Scholar

18 

Nagayama D, Saiki A, Watanabe Y, Yamaguchi T, Ohira M, Sato N, Kanayama M, Moroi M, Miyashita Y, Shirai K and Tatsuno I: Prevention of cardiovascular events with pitavastatin is associated with increased serum lipoprotein lipase mass level: Subgroup analysis of the TOHO-LIP. J Atheroscler Thromb: Feb 27, 2021. doi: 10.5551/jat.62141.

19 

Bhatti H and Tadi P: Pitavastatin. In: StatPearls, StatPearls Publishing, Treasure Island, FL, 2021.

20 

Cao Y, Gong Y, Liu L, Zhou Y, Fang X, Zhang C, Li Y and Li J: The use of human umbilical vein endothelial cells (HUVECs) as an in vitro model to assess the toxicity of nanoparticles to endothelium: A review. J Appl Toxicol. 37:1359–1369. 2017.PubMed/NCBI View Article : Google Scholar

21 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar

22 

Rajendran S, Shen X, Glawe J, Kolluru GK and Kevil CG: Nitric oxide and hydrogen sulfide regulation of ischemic vascular growth and remodeling. Compr Physiol. 9:1213–1247. 2019.PubMed/NCBI View Article : Google Scholar

23 

Bonnefont-Rousselot D: Resveratrol and cardiovascular diseases. Nutrients. 8(250)2016.PubMed/NCBI View Article : Google Scholar

24 

Jankowich M and Choudhary G: Endothelin-1 levels and cardiovascular events. Trends Cardiovasc Med. 30:1–8. 2020.PubMed/NCBI View Article : Google Scholar

25 

Yamada T, Egashira N, Imuta M, Yano T, Yamauchi Y, Watanabe H and Oishi R: Role of oxidative stress in vinorelbine-induced vascular endothelial cell injury. Free Radic Biol Med. 48:120–127. 2010.PubMed/NCBI View Article : Google Scholar

26 

Zhang M, Wang X, Yao J and Qiu Z: Long non-coding RNA NEAT1 inhibits oxidative stress-induced vascular endothelial cell injury by activating the miR-181d-5p/CDKN3 axis. Artif Cells Nanomed Biotechnol. 47:3129–3137. 2019.PubMed/NCBI View Article : Google Scholar

27 

Nakamura-Utsunomiya A, Tsumura M, Okada S, Kawaguchi H and Kobayashi M: Downregulation of endothelial nitric oxide synthase (eNOS) and endothelin-1 (ET-1) in a co-culture system with human stimulated X-linked CGD neutrophils. PLoS One. 15(e0230665)2020.PubMed/NCBI View Article : Google Scholar

28 

Walshe TE, Ferguson G, Connell P, O'Brien C and Cahill PA: Pulsatile flow increases the expression of eNOS, ET-1, and prostacyclin in a novel in vitro coculture model of the retinal vasculature. Invest Ophthalmol Vis Sci. 46:375–382. 2005.PubMed/NCBI View Article : Google Scholar

29 

Castilla-Guerra L, Fernandez-Moreno MD and Colmenero-Camacho MA: Statins in Stroke Prevention: Present and future. Curr Pharm Des. 22:4638–4644. 2016.PubMed/NCBI View Article : Google Scholar

30 

Koushki K, Shahbaz SK, Mashayekhi K, Sadeghi M, Zayeri ZD, Taba MY, Banach M, Al-Rasadi K, Johnston TP and Sahebkar A: Anti-inflammatory action of statins in cardiovascular disease: The role of inflammasome and toll-like receptor pathways. Clin Rev Allergy Immunol. 60:175–199. 2021.PubMed/NCBI View Article : Google Scholar

31 

Mo S, Qian Y, Zhang W, Qian L, Wang Y, Cailin G and Ding H: Mitogen-activated protein kinase action in plant response to high-temperature stress: A mini review. Protoplasma. 258:477–482. 2021.PubMed/NCBI View Article : Google Scholar

32 

Kim M, Jeong S, Lim CW and Lee SC: Mitogen-activated protein kinase CaDIMK1 functions as a positive regulator of drought stress response and abscisic acid signaling in capsicum annuum. Front Plant Sci. 12(646707)2021.PubMed/NCBI View Article : Google Scholar

33 

Lochhead PA, Clark J, Wang LZ, Gilmour L, Squires M, Gilley R, Foxton C, Newell DR, Wedge SR and Cook SJ: Tumor cells with KRAS or BRAF mutations or ERK5/MAPK7 amplification are not addicted to ERK5 activity for cell proliferation. Cell Cycle. 15:506–518. 2016.PubMed/NCBI View Article : Google Scholar

34 

Gavine PR, Wang M, Yu D, Hu E, Huang C, Xia J, Su X, Fan J, Zhang T, Ye Q, et al: Identification and validation of dysregulated MAPK7 (ERK5) as a novel oncogenic target in squamous cell lung and esophageal carcinoma. BMC Cancer. 15(454)2015.PubMed/NCBI View Article : Google Scholar

35 

Nithianandarajah-Jones GN, Wilm B, Goldring CE, Müller J and Cross MJ: ERK5: structure, regulation and function. Cell Signal. 24:2187–2196. 2012.PubMed/NCBI View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Li M and Liu X: Pitavastatin maintains MAPK7 expression and alleviates angiotensin II‑induced vascular endothelial cell inflammation and injury. Exp Ther Med 23: 132, 2022.
APA
Li, M., & Liu, X. (2022). Pitavastatin maintains MAPK7 expression and alleviates angiotensin II‑induced vascular endothelial cell inflammation and injury. Experimental and Therapeutic Medicine, 23, 132. https://doi.org/10.3892/etm.2021.11055
MLA
Li, M., Liu, X."Pitavastatin maintains MAPK7 expression and alleviates angiotensin II‑induced vascular endothelial cell inflammation and injury". Experimental and Therapeutic Medicine 23.2 (2022): 132.
Chicago
Li, M., Liu, X."Pitavastatin maintains MAPK7 expression and alleviates angiotensin II‑induced vascular endothelial cell inflammation and injury". Experimental and Therapeutic Medicine 23, no. 2 (2022): 132. https://doi.org/10.3892/etm.2021.11055
Copy and paste a formatted citation
x
Spandidos Publications style
Li M and Liu X: Pitavastatin maintains MAPK7 expression and alleviates angiotensin II‑induced vascular endothelial cell inflammation and injury. Exp Ther Med 23: 132, 2022.
APA
Li, M., & Liu, X. (2022). Pitavastatin maintains MAPK7 expression and alleviates angiotensin II‑induced vascular endothelial cell inflammation and injury. Experimental and Therapeutic Medicine, 23, 132. https://doi.org/10.3892/etm.2021.11055
MLA
Li, M., Liu, X."Pitavastatin maintains MAPK7 expression and alleviates angiotensin II‑induced vascular endothelial cell inflammation and injury". Experimental and Therapeutic Medicine 23.2 (2022): 132.
Chicago
Li, M., Liu, X."Pitavastatin maintains MAPK7 expression and alleviates angiotensin II‑induced vascular endothelial cell inflammation and injury". Experimental and Therapeutic Medicine 23, no. 2 (2022): 132. https://doi.org/10.3892/etm.2021.11055
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team