Introduction
Ischemic stroke is a multifactorial and polygenic
disease, and is strongly influenced by a genetic component
(1–3). Although genome-wide association
studies have implicated various candidate genes underlying
predisposition to ischemic stroke (4–6), the
genes that confer susceptibility to this condition remain to be
identified definitively.
It is increasingly recognized that chronic kidney
disease (CKD) is an independent risk factor for atherosclerotic
diseases including ischemic stroke. Individuals with CKD are at
increased risk not only for end stage renal disease but also for a
poor cardiovascular outcome and premature death (7–9).
Furthermore, many uncertainties exist regarding genetic
contribution to ischemic stroke in individuals with CKD.
We performed an association study for 150
polymorphisms of 144 candidate genes and ischemic stroke in 4,444
Japanese individuals with or without CKD. The aim of the present
study was to identify genetic variants that confer susceptibility
to ischemic stroke in individuals with or without CKD in order to
allow prediction of genetic risk for such individuals
separately.
Materials and methods
Study population
The study population comprised 4,444 unrelated
Japanese individuals (2,113 men, 2,331 women) who either visited
outpatient clinics or were admitted to one of the five
participating hospitals (Gifu Prefectural General Medical Center,
Gifu Prefectural Tajimi Hospital in Gifu Prefecture, Japan; and
Hirosaki University Hospital, Reimeikyo Rehabilitation Hospital,
and Hirosaki Stroke Center in Aomori Prefecture, Japan) between
October 2002 and March 2008, due to various symptoms or for an
annual health checkup, or individuals who were recruited to a
population-based prospective cohort study of aging and age-related
diseases in Nakanojo, Gunma Prefecture, Japan. The study subjects
comprised 974 people with CKD (227 subjects with ischemic stroke
and 747 controls) and 3,470 people without CKD (612 subjects with
ischemic stroke and 2,858 controls). Estimated glomerular
filtration rate (eGFR) was calculated with the use of the
simplified prediction equation proposed by the Japanese Society of
Nephrology and based on that described in the Modification of Diet
in Renal Disease study (10): eGFR
(ml min−1 1.73 m−2) = 194 x [age
(years)]−0.287 x [serum creatinine
(mg/dl)]−1.094 (x 0.739 if female). The National Kidney
Foundation-Kidney Disease Outcome Quality Initiative guidelines
recommend a diagnosis of CKD when eGFR is <60 ml
min−1 1.73 m−2 (11), on the basis of which 974 subjects
in the present study were diagnosed with CKD. The diagnosis of
ischemic stroke was based on the occurrence of a new and abrupt
focal neurological deficit, with neurological symptoms and signs
persisting for >24 h; it was confirmed by positive findings in
computed tomography or magnetic resonance imaging (or both) of the
head. The type of stroke was determined according to the
Classification of Cerebrovascular Diseases III (12). Individuals with cardiogenic embolic
infarction, lacunar infarction alone, transient ischemic attack,
moyamoya disease, or cerebral venous sinus thrombosis were excluded
from the study, as were those with atrial fibrillation in the
absence or presence of valvular heart disease. The 3,605 control
subjects were recruited from community-dwelling individuals or the
patients who visited outpatient clinics regularly for treatment of
various common diseases. They had no history of ischemic or
hemorrhagic stroke or other cerebral diseases; of coronary heart
disease, aortic aneurysm, or peripheral arterial occlusive disease;
or of other atherosclerotic, thrombotic, embolic, or hemorrhagic
disorders. The study protocol complied with the Declaration of
Helsinki and was approved by the Committees on the Ethics of Human
Research of Mie University Graduate School of Medicine, Hirosaki
University Graduate School of Medicine, Gifu International
Institute of Biotechnology, Tokyo Metropolitan Institute of
Gerontology and the participating hospitals. Written informed
consent was obtained from each participant.
Selection and genotyping of
polymorphisms
Our aim was to identify genetic variants associated
with ischemic stroke in the Japanese population with or without CKD
in a case-control association study by examining the relations of
candidate gene polymorphisms to this condition. Polymorphisms
examined in the present study (data not shown) were selected from
genome-wide association studies of ischemic stroke and myocardial
infarction (P-value for allele frequency <1.0×10−7)
with the use of the GeneChip Human Mapping 500K Array Set
(Affymetrix, Santa Clara, CA, USA) (13). We have not examined the relation of
these polymorphisms to ischemic stroke in the absence or presence
of CKD in our previous studies (14–17).
Venous blood (7 ml) was collected in tubes
containing 50 mmol/l ethylenediaminetetraacetic acid (disodium
salt), the peripheral blood leukocytes were isolated, and genomic
DNA was extracted from these cells with a DNA extraction kit
(Genomix; Talent, Trieste, Italy). Genotypes of the 150
polymorphisms were determined at G&G Science (Fukushima, Japan)
by a method that combines the polymerase chain reaction and
sequence-specific oligonucleotide probes with suspension array
technology (Luminex, Austin, TX, USA). Primers, probes and other
conditions for genotyping of polymorphisms related to ischemic
stroke are shown in Table I.
Detailed genotyping methodology has been described previously
(18).
 | Table I.Primers, probes and conditions for
genotyping of polymorphisms related (P-value for allele frequency
of <0.05) to ischemic stroke by the Chi-square test. |
Table I.
Primers, probes and conditions for
genotyping of polymorphisms related (P-value for allele frequency
of <0.05) to ischemic stroke by the Chi-square test.
| Gene | SNP | Sense primer
(5′→3′) | Antisense primer
(5′→3′) | Probe 1 (5′→3′) | Probe 2 (5′→3′) | Annealing (°C) | Cycles |
|---|
| Individuals with
CKD |
| ROR2 | A→G (rs10992119) |
TGCAATGCACCGAGGAGCAAGT |
CTTGCCCTGGGGCATCTGAAG |
CAGCGACTAAATCAGCCACGC |
GTGGCGTGGCCGATTTAGTC | 60 | 50 |
| SORCS2 | C→T (rs17828052) |
AGGCTCTCCTGTATCTACAGATG |
CACCAGGCAAGCAAAGAGAGGTA |
TGACTTACTTTCTTCGAGCATTT |
AAACACTTAAATGCTCAAAGAAAGT | 60 | 50 |
| LLGL2 | A→G (rs1671021) |
GCTCCTGGCCTCACCTTGCG |
GCTGCTCTACAAACTCAGCACTG |
CTGGGCACTGAAGTTCTCGTT |
CCAACGAGAACCTCAGTGCC | 60 | 50 |
| CELSR1 | A→C (rs9615362) |
TGGAAACCTAGTTTGGTTAAGTGTT |
CACCAGGGAGCCACACATGTC |
AGGCAGGTGGTGTTATCCCA |
CATTGTCTGGGATACCACCAC | 60 | 50 |
| CDH4 | A→G (rs11698886) |
AGTGTGTCAATGTCCCATCCTTG |
TCCCCAGAGCCTGAGCTCAGC |
GGAAGCCTCAACATTCTCTCTG |
GGCAGAGAGAACGTTGAGGC | 60 | 50 |
| RAB6C | C→G (rs6719989) |
GCTGGGGAAGCCGAAGCGC |
GACGGAGGGTGGCGGAGCC |
CGCAGATGTATCCGGGATCT |
GCAGATGTATCCCGGATCTCT | 60 | 50 |
|
PPP1R12B | G→T (rs930734) |
ACTCCCCATGGGGTGGCTCG |
CTTGGTCTTAGAGGCGTCCAGT |
CTCCTACAGATGCGCCTTTGA |
AGGGTCAAAGGCTCATCTGTA | 60 | 50 |
| CCDC86 | G→T (rs480081) |
GGGCTGCTTCTTGGAGAATGAC |
CCTTTGCTGGGACGTACTCAGT |
CTTGCAGATTTGAACTCCATGT |
CCGGGGACATGGATTTCAAAT | 60 | 50 |
| AKAP12 | A→G (rs756009) |
CGAGGATGACCCAGGCCTCAA |
CCACACTTTGCCGGCCTCCAG |
AGTGAGGGCAACTTTGCTAA |
GAGGGCAACTTCGCTAAATCC | 60 | 50 |
| ZC3H3 | A→G
(rs7464822) |
CCGTGCTCTCTGTTGTTCCAC |
CTGCGTCTCCAGCTGACAGTG |
TGTTGTCATTAAACATCAGGTAG |
TGTTGTCATTAAACACCAGGTAG | 60 | 50 |
| RUVBL2 | C→T
(rs1062708) |
GGACGTGATCACCATCGACAAG |
GAGCCCATAGCGTCGTAGTCG |
GCAAGATCTCCAAGTTGGGC |
GAGCGGCCCAACTTGGAGA | 60 | 50 |
| Individuals without
CKD |
| CELSR1 | C→T
(rs4044210) |
CCATGGCCCTGAGGTCCACG |
GCTGGCTGCCCCCAGAGCTC |
CCACGAAGGAGATGGTGGTA |
TTAACTGTACCACCATCTCCTT | 60 | 50 |
| CELSR1 | C→T
(rs6007897) |
GGAGACGGAGGACTCCAGCTC |
CTTGCTGTCGACATCTTTGACAAG |
TCTTCATGGATGGCGTCGAAT |
CCGCGATTCGACGCCATCC | 60 | 50 |
| PTPRN2 | C→T
(rs1638021) |
CAGCCCTTCCCACCTACCAG |
CCCAGGTCTCCCAGCCTCAG |
AGCGAACCTTTGAGCTTTGC |
CCAGCGGCAAAGTTCAAAGG | 60 | 50 |
| SEMA3F | A→G
(rs12632110) |
GGTGCTGCACCGTGGATGTGA |
CTCCAGATCACTCCTCTACTACA |
TGTGAGTCCTTGCACAGTGGT |
CATTTCACCACTGCGCAAGGA | 60 | 50 |
| ZNF607 | G→T
(rs17306508) |
GCAGAGGCTCCCGCAGTGAC |
TGGACCCCTGGCTCCGGTTC |
CCTTTTGGTTCCACCTGAAGA |
CCGCCTTCTTCATGTGGAAC | 60 | 50 |
| ITPK1 | C→T
(rs2295394) |
GCCCTGCGGCAGGCACTGG |
GGCGTGCTGCCCTGTCTGGT |
ATGATGTCGATGCCGAAGAGT |
TGATGTCGATGCCAAAGAGTG | 60 | 50 |
| POLR1D | C→T (rs14105) |
GGCGGAACCTCGAGCGCGGA |
AAAAGAGGGCGATAAGGAACCAG |
GAAAGAAGAAAACCCGAAGAAAC |
AAAGAAGAAAACCCAAAGAAACAC | 60 | 50 |
| NDST1 | C→G
(rs2545342) |
CCTTTCATGAGCTCTTTCTTAGCT |
CATCAGAAACCTCTTTCAAGAATGC |
CAGAGGATCAAGCAATAATCAG |
GACAGAGGATCAAGGAATAATCA | 60 | 50 |
| RUVBL2 | C→T (rs753307) |
CAGATGGCGGCAGTGAGTGAC |
GGATGAAAATTCCCTGCGTCTGA |
ATTCTAGGATGAAATCGGAACC |
CTAGGATGAAATCAGAACCCTG | 60 | 50 |
| CARD14 | C→T
(rs8068452) |
ATGGTGCCGTGAAACCTCGAAG |
CAGGTTCCAGAACCTTCCGCTA |
AGTAGAGTCTGCCTCCATATCA |
TCGATGATATGGAAGCAGACTC | 60 | 50 |
|
RABGAP1L | C→G
(rs12078839) |
CTTGCTATTTCAGCCATTGCTGAA |
TATAGTGGTGGAGCTGGAAATAGA |
GGAAGGAACCAACTGGAGAGT |
TCTGACTCTCCACTTGGTTCC | 60 | 50 |
Statistical analysis
Quantitative data were compared between subjects
with ischemic stroke and controls by the unpaired Student's t-test.
Categorical data were compared by the Chi-square test. Allele
frequencies were estimated by the gene counting method, and the
Chi-square test was used to identify departure from Hardy-Weinberg
equilibrium. In an initial screen, the genotype distributions (3×2)
and allele frequencies (2×2) of each polymorphism were compared
between subjects with ischemic stroke and controls by the
Chi-square test. Given the multiple comparisons of genotypes, the
false discovery rate (FDR) was calculated by the method of
Benjamini and Hochberg (19) from
the distribution of P-values for allele frequencies of the 150
polymorphisms. Polymorphisms with an FDR of <0.05 were further
examined by multivariable logistic regression analysis with
adjustment for covariates that differed significantly between
subjects with ischemic stroke and controls. Multivariable logistic
regression analysis was thus performed with ischemic stroke as a
dependent variable and independent variables including age, gender
(0, woman; 1, man), serum concentration of creatinine, and the
prevalence of hypertension, diabetes mellitus and
hypercholesterolemia (0, no history of these conditions; 1,
positive history), the genotype of each polymorphism, and the
P-value, odds ratio and 95% CI were calculated. Each genotype was
assessed according to dominant, recessive and additive genetic
models. Additive models included the additive 1 model
(heterozygotes vs. wild-type homozygotes) and the additive 2 model
(variant homozygotes vs. wild-type homozygotes), which were
analyzed simultaneously with a single statistical model. We also
performed a stepwise forward selection procedure to examine the
effects of genotypes as well as other covariates on ischemic
stroke. In the stepwise forward selection procedure, each genotype
was examined according to a dominant or recessive model on the
basis of statistical significance in the multivariable logistic
regression analysis. With the exception of the initial screen by
the Chi-square test (FDR <0.05), a P-value of <0.05 was
considered statistically significant. Statistical significance was
examined by two-sided tests performed with JMP version 5.1 software
and JMP Genomics version 3.2 software (SAS Institute, Cary, NC,
USA).
Results
The characteristics of the study subjects are
documented in Table II. In
individuals with CKD, age, the frequency of males, prevalence of
hypertension, hypercholesterolemia and diabetes mellitus, as well
as systolic and diastolic blood pressure, serum concentrations of
total cholesterol, low-density lipoprotein (LDL)-cholesterol and
creatinine, fasting plasma glucose level and blood glycosylated
hemoglobin content were greater, whereas serum concentration of
high-density lipoprotein (HDL)-cholesterol and eGFR were lower in
the subjects with ischemic stroke than in the controls. In
individuals without CKD, age, the frequency of males, the
prevalence of hypertension and diabetes mellitus, as well as
systolic and diastolic blood pressure, serum concentrations of
LDL-cholesterol and creatinine, fasting plasma glucose level and
blood glycosylated hemoglobin content were greater, whereas the
serum concentration of HDL-cholesterol was lower in subjects with
ischemic stroke than in the controls.
| Table II.Characteristics of the study
subjects. |
Table II.
Characteristics of the study
subjects.
| Characteristic | Subjects with CKD
| Subjects without
CKD
|
|---|
| Ischemic
stroke | Controls | P-value | Ischemic
stroke | Controls | P-value |
|---|
| No. of
subjects | 227 | 747 | | 612 | 2858 | |
| Age (years) | 72.5±7.52 | 70.5±9.37 | 0.0010 | 68.5±10.4 | 64.6±11.3 | <0.0001 |
| Gender
(males/females, %) | 68.7/31.3 | 48.5/51.5 | <0.0001 | 55.9/44.1 | 43.8/56.2 | <0.0001 |
| Body mass index
(kg/m2) | 23.3±3.3 | 23.6±3.5 | 0.3000 | 23.7±3.4 | 23.3±3.3 | 0.0899 |
| Current or former
smoker (%) | 17.2 | 21.3 | 0.1784 | 15.9 | 18.6 | 0.1114 |
| Hypertension
(%) | 85.0 | 49.4 | <0.0001 | 65.0 | 37.1 | <0.0001 |
| Systolic blood
pressure (mmHg) | 154±28 | 138±23 | <0.0001 | 150±27 | 137±20 | <0.0001 |
| Diastolic blood
pressure (mmHg) | 83±16 | 79±14 | 0.0008 | 85±16 | 73±12 | <0.0001 |
|
Hypercholesterolemia (%) | 37.0 | 29.7 | 0.0384 | 25.7 | 23.5 | 0.2518 |
| Serum total
cholesterol (mmol/l) | 5.36±1.12 | 5.16±0.98 | 0.0251 | 5.09±1.03 | 5.12±0.88 | 0.6227 |
| Serum triglyceride
(mmol/l) | 1.74±1.14 | 1.62±1.00 | 0.1922 | 1.53±0.82 | 1.49±1.02 | 0.3513 |
| Serum
HDL-cholesterol (mmol/l) | 1.30±0.39 | 1.45±0.40 | <0.0001 | 1.25±0.37 | 1.50±0.39 | <0.0001 |
| Serum
LDL-cholesterol (mmol/l) | 3.29±0.93 | 2.97±0.87 | <0.0001 | 3.16±0.91 | 2.94±0.80 | 0.0002 |
| Diabetes mellitus
(%) | 48.5 | 20.1 | <0.0001 | 34.0 | 12.3 | <0.0001 |
| Fasting plasma
glucose (mmol/l) | 7.21±2.82 | 6.57±2.91 | 0.0058 | 7.26±2.90 | 6.39±2.59 | <0.0001 |
| Glycosylated
hemoglobin (%) | 6.08±1.40 | 5.55±1.23 | 0.0006 | 6.03±1.49 | 5.55±1.30 | <0.0001 |
| Serum creatinine
(μmol/l) | 96.9±89.0 | 81.5±60.4 | 0.0153 | 54.3±10.8 | 52.0±10.3 | 0.0003 |
| eGFR (ml
min−1 1.73 m−2) | 47.5±10.8 | 50.8±8.9 | <0.0001 | 77.8±15.1 | 78.5±15.9 | 0.4580 |
Evaluation of allele frequencies by the Chi-square
test revealed that eleven polymorphisms were related (P-value for
allele frequency of <0.05) to the prevalence of ischemic stroke
in individuals with CKD. Among these polymorphisms, the A→G
polymorphism (rs10992119) of the receptor tyrosine kinase-like
orphan receptor 2 gene (ROR2) was significantly (FDR for
allele frequency of <0.05) associated with the prevalence of
ischemic stroke (Table III). The
genotype distributions for 11 polymorphisms related to ischemic
stroke in individuals with CKD are also documented in Table III. In individuals without CKD,
another set of 11 polymorphisms was related (P-value for allele
frequency of <0.05) to the prevalence of ischemic stroke, but no
polymorphism was significantly (FDR for allele frequency of
<0.05) related to ischemic stroke (Table IV). The genotype distributions for
11 polymorphisms related to ischemic stroke in individuals without
CKD are also shown in Table IV. In
control subjects, the genotype distributions of these polymorphisms
with the exception of those of POLR1D and RUVBL2 were
in Hardy-Weinberg equilibrium (data not shown).
| Table III.Polymorphisms related (P-value for
allele frequency of <0.05) to ischemic stroke in subjects with
CKD as determined by the Chi-square test. |
Table III.
Polymorphisms related (P-value for
allele frequency of <0.05) to ischemic stroke in subjects with
CKD as determined by the Chi-square test.
| Gene Symbol | Polymorphism | dbSNP | Ischemic stroke
(%) | Controls (%) | P-value
(genotype) | P-value
(allele) | FDR (allele) |
|---|
| ROR2 | A→G | rs10992119 | | | 0.0027 | 0.0006 | 0.0478 |
| AA | | 6 (2.7) | 52 (7.0) | | | |
| AG | | 70 (31.1) | 284 (38.3) | | | |
| GG | | 149 (66.2) | 406 (54.7) | | | |
| SORCS2 | C→T | rs17828052 | | | 0.0010 | 0.0056 | 0.2255 |
| CC | | 179 (79.2) | 625 (84.9) | | | |
| CT | | 40 (17.7) | 108 (14.7) | | | |
| TT | | 7 (3.1) | 3 (0.4) | | | |
| LLGL2 | A→G | rs1671021 | | | 0.0345 | 0.0121 | 0.2694 |
| AA | | 181 (79.7) | 529 (71.0) | | | |
| AG | | 42 (18.5) | 197 (26.4) | | | |
| GG | | 4 (1.8) | 19 (2.6) | | | |
| CELSR1 | A→C | rs9615362 | | | 0.0128 | 0.0135 | 0.2694 |
| AA | | 0 | 0 | | | |
| AC | | 12 (5.3) | 16 (2.2) | | | |
| CC | | 213 (94.7) | 726 (97.8) | | | |
| CDH4 | A→G | rs11698886 | | | 0.0634 | 0.0264 | 0.3277 |
| AA | | 24 (10.7) | 123 (16.6) | | | |
| AG | | 108 (48.0) | 355 (47.8) | | | |
| GG | | 93 (41.3) | 264 (35.6) | | | |
| RAB6C | C→G | rs6719989 | | | 0.0714 | 0.0268 | 0.3277 |
| CC | | 166 (73.8) | 594 (80.1) | | | |
| CG | | 54 (24.0) | 141 (19.0) | | | |
| GG | | 5 (2.2) | 7 (0.9) | | | |
|
PPP1R12B | G→T | rs930734 | | | 0.0612 | 0.0300 | 0.3277 |
| GG | | 130 (57.8) | 362 (48.8) | | | |
| GT | | 80 (35.5) | 319 (43.0) | | | |
| TT | | 15 (6.7) | 61 (8.2) | | | |
| CCDC86 | G→T | rs480081 | | | 0.0864 | 0.0372 | 0.3277 |
| GG | | 28 (12.5) | 60 (8.1) | | | |
| GT | | 95 (42.2) | 302 (40.7) | | | |
| TT | | 102 (45.3) | 380 (51.2) | | | |
| AKAP12 | A→G | rs756009 | | | 0.0379 | 0.0386 | 0.3277 |
| AA | | 0 | 0 | | | |
| AG | | 0 | 14 (1.9) | | | |
| GG | | 225 (100) | 728 (98.1) | | | |
| ZC3H3 | A→G | rs7464822 | | | 0.1331 | 0.0416 | 0.3277 |
| AA | | 2 (0.9) | 4 (0.5) | | | |
| AG | | 29 (12.8) | 63 (8.6) | | | |
| GG | | 195 (86.3) | 669 (90.9) | | | |
| RUVBL2 | C→T | rs1062708 | | | 0.0847 | 0.0474 | 0.3277 |
| CC | | 73 (32.3) | 210 (28.6) | | | |
| CT | | 116 (51.3) | 355 (48.2) | | | |
| TT | | 37 (16.4) | 171 (23.2) | | | |
| Table IV.Polymorphisms related (P-value for
allele frequency of <0.05) to ischemic stroke in subjects
without CKD as determined by the Chi-square test. |
Table IV.
Polymorphisms related (P-value for
allele frequency of <0.05) to ischemic stroke in subjects
without CKD as determined by the Chi-square test.
| Gene Symbol | Polymorphism | dbSNP | Ischemic stroke
(%) | Controls (%) | P-value
(genotype) | P-value
(allele) | FDR (allele) |
|---|
| CELSR1 | C→T | rs4044210 | | | 0.0113 | 0.0121 | 0.5894 |
| CC | | 0 | 0 | | | |
| CT | | 34 (5.6) | 96 (3.4) | | | |
| TT | | 577 (94.4) | 2723 (96.6) | | | |
| CELSR1 | C→T | rs6007897 | | | 0.0115 | 0.0123 | 0.5894 |
| CC | | 0 | 0 | | | |
| CT | | 32 (5.2) | 89 (3.2) | | | |
| TT | | 579 (94.8) | 2730 (96.8) | | | |
| PTPRN2 | C→T | rs1638021 | | | 0.0463 | 0.0129 | 0.5894 |
| CC | | 289 (47.3) | 1479 (52.5) | | | |
| CT | | 262 (42.9) | 1117 (39.6) | | | |
| TT | | 60 (9.8) | 223 (7.9) | | | |
| SEMA3F | A→G | rs12632110 | | | 0.0614 | 0.0192 | 0.5894 |
| AA | | 144 (23.5) | 571 (20.3) | | | |
| AG | | 313 (51.2) | 1417 (50.3) | | | |
| GG | | 155 (25.3) | 829 (29.4) | | | |
| ZNF607 | G→T | rs17306508 | | | 0.0832 | 0.0266 | 0.5894 |
| GG | | 517 (84.9) | 2498 (88.2) | | | |
| GT | | 88 (14.5) | 321 (11.3) | | | |
| TT | | 4 (0.6) | 14 (0.5) | | | |
| ITPK1 | C→T | rs2295394 | | | 0.0885 | 0.0291 | 0.5894 |
| CC | | 364 (59.6) | 1547 (54.9) | | | |
| CT | | 215 (35.2) | 1088 (38.6) | | | |
| TT | | 32 (5.2) | 184 (6.5) | | | |
| POLR1D | C→T | rs14105 | | | 0.0908 | 0.0323 | 0.5894 |
| CC | | 248 (40.7) | 1059 (37.4) | | | |
| CT | | 280 (46.0) | 1305 (46.1) | | | |
| TT | | 81 (13.3) | 469 (16.5) | | | |
| NDST1 | C→G | rs2545342 | | | 0.1085 | 0.0362 | 0.5894 |
| CC | | 5 (0.8) | 37 (1.3) | | | |
| CG | | 110 (18.0) | 597 (21.2) | | | |
| GG | | 497 (81.2) | 2182 (77.5) | | | |
| RUVBL2 | C→T | rs753307 | | | 0.0111 | 0.0377 | 0.5894 |
| CC | | 304 (49.9) | 1358 (47.9) | | | |
| CT | | 262 (43.0) | 1159 (40.9) | | | |
| TT | | 43 (7.1) | 316 (11.2) | | | |
| CARD14 | C→T | rs8068452 | | | 0.0374 | 0.0447 | 0.5894 |
| CC | | 36 (5.9) | 257 (9.1) | | | |
| CT | | 248 (40.7) | 1137 (40.1) | | | |
| TT | | 325 (53.4) | 1439 (50.8) | | | |
|
RABGAP1L | C→G | rs12078839 | | | 0.0144 | 0.0451 | 0.5894 |
| CC | | 480 (78.8) | 2308 (81.5) | | | |
| CG | | 118 (19.4) | 506 (17.8) | | | |
| GG | | 11 (1.8) | 19 (0.7) | | | |
Multivariable logistic regression analysis with
adjustment for age, gender, serum concentration of creatinine, and
the prevalence of hypertension, diabetes mellitus and
hypercholesterolemia revealed that the A→G polymorphism of
ROR2 (recessive and additive 2 models) was significantly
(P<0.05) associated with ischemic stroke in individuals with
CKD, with the G allele representing a risk factor for this
condition (Table V). A stepwise
forward selection procedure was performed to examine the effects of
the ROR2 genotype as well as of age, gender, serum
concentration of creatinine, and the prevalence of hypertension,
diabetes mellitus and hypercholesterolemia on ischemic stroke
(Table VI). Hypertension, diabetes
mellitus, gender, age, ROR2 genotype (recessive model) and
hypercholesterolemia, in descending order of statistical
significance, were significant (P<0.05) and independent
determinants of ischemic stroke in individuals with CKD.
| Table V.Multivariable logistic regression
analysis of a polymorphism associated with ischemic stroke by the
Chi-square test in individuals with CKD. |
Table V.
Multivariable logistic regression
analysis of a polymorphism associated with ischemic stroke by the
Chi-square test in individuals with CKD.
| Gene | Polymorphism | Dominant
| Recessive
| Additive 1
| Additive 2
|
|---|
| P-value | OR (95% CI) | P-value | OR (95% CI) | P-value | OR (95% CI) | P-value | OR (95% CI) |
|---|
| ROR2 | A→G
(rs10992119) | 0.0546 | | 0.0100 | 1.57
(1.12–2.23) | 0.1791 | | 0.0280 | 2.76
(1.20–7.53) |
| Table VI.Effects of genotypes and other
characteristics on ischemic stroke among individuals with CKD as
determined by a stepwise forward selection procedure
(P<0.05). |
Table VI.
Effects of genotypes and other
characteristics on ischemic stroke among individuals with CKD as
determined by a stepwise forward selection procedure
(P<0.05).
| Variable | P-value | R2 |
|---|
| Hypertension | <0.0001 | 0.0952 |
| Diabetes
mellitus | <0.0001 | 0.0405 |
| Gender | <0.0001 | 0.0224 |
| Age | 0.0003 | 0.0123 |
| ROR2
(GG vs. AA + AG) | 0.0095 | 0.0064 |
|
Hypercholesterolemia | 0.0276 | 0.0046 |
Finally, we examined the relation of the A→G
polymorphism of ROR2 to intermediate phenotypes, including
systolic and diastolic blood pressure, fasting plasma glucose
level, blood glycosylated hemoglobin content, serum concentrations
of total cholesterol, triglycerides and HDL-cholesterol, and Body
Mass Index (BMI). The Chi-square test did not detect any relation
between ROR2 genotype and either of the intermediate
phenotypes (data not shown).
Discussion
The main cause of ischemic stroke is
atherothrombosis, with the principal and treatable risk factors
including hypertension, diabetes mellitus, dyslipidemia and smoking
(20). In addition to these
conventional risk factors, genetic variants are important in the
etiology of ischemic stroke (21).
Prediction of the risk for ischemic stroke on the basis of genetic
information would be useful for deciding how aggressively to target
the clinical risk factors that are currently amenable to treatment.
In this study we examined the possible relations of 150
polymorphisms to the prevalence of ischemic stroke in 4,444
Japanese individuals and showed that the A→G polymorphism
(rs10992119) in intron 1 of ROR2 was significantly
associated with ischemic stroke in individuals with CKD.
ROR2 encodes a receptor tyrosine kinase and
type 1 transmembrane protein that exists on the cell surface
(22,23). Receptor tyrosine kinases are
glycoproteins that play important roles in regulating intracellular
signaling pathways that control cell proliferation,
differentiation, migration, metabolism and apoptosis (24,25).
Human ROR2 is expressed in many tissues during development
and plays an important role in developmental morphogenesis,
including skeletal morphogenesis and bone and cartilage formation
(26). Mutations in ROR2
have been reported to cause either of two genetic skeletal
disorders: loss-of-function mutations cause Robinow syndrome
whereas gain-of-function mutations cause Brachydactyly type B
(27,28). Recently, ROR2 was
demonstrated to function as an oncogene and was found to be
expressed in gastric cancer with signet ring cell features
(29). An increase in ROR2
mRNA expression was observed in the majority of renal cell
carcinomas, and protein expression was confirmed at the tumor cell
level (30). However, the
association between ROR2 and atherosclerotic disease has not
been reported. In the present study, we showed that the A→G
polymorphism of ROR2 (rs10992119) was significantly
associated with the prevalence of ischemic stroke in individuals
with CKD, with the G allele representing a risk factor for
this condition. Given that the ROR genotype did not relate
to intermediate phenotypes and that rs10992119 is located in intron
1, the underlying mechanism remains unclear.
There were several limitations in our study. i) We
used eGFR instead of a directly measured GFR to define CKD. We did
not have information regarding the underlying renal disease for
each subject; ii) it is possible that the polymorphism associated
with ischemic stroke in the present study is in linkage
disequilibrium with other polymorphisms in the same gene or in
other nearby genes that are actually responsible for the
development of this condition; iii) given that the association of
the ROR2 polymorphism with ischemic stroke in the present
study was not replicated in independent subject panels, our study
was considered to be hypothesis generating; iv) given that the
study population comprised only Japanese individuals, validation of
our findings is required in other ethnic groups; and v) the
functional relevance of the identified polymorphism of ROR2
with the pathogenesis of ischemic stroke remains to be
determined.
In conclusion, our present results suggest that
ROR2 may be a susceptibility locus for ischemic stroke in
Japanese individuals with CKD, although the functional relevance to
this condition was not determined. Determination of the genotype
for this polymorphism may prove informative for the assessment of
the genetic risk for ischemic stroke in such individuals.
Validation of our findings will require their replication with
independent subject panels of various ethnic groups.
Acknowledgements
This work was supported in part by the
Grants-in-Aid for Scientific Research from the Ministry of
Education, Culture, Sports, Science and Technology of Japan (nos.
18209023, 18018021 and 19659149 to Y.Y.).
References
|
1.
|
Bak S, Gaist D, Sindrup SH, Skytthe A and
Christensen K: Genetic liability in stroke: a long-term follow-up
study of Danish twins. Stroke. 33:769–774. 2002. View Article : Google Scholar : PubMed/NCBI
|
|
2.
|
Tournier-Lasserve E: New players in the
genetics of stroke. N Engl J Med. 347:1711–1712. 2002. View Article : Google Scholar : PubMed/NCBI
|
|
3.
|
Touzé E and Rothwell PM: Heritability of
ischaemic stroke in women compared with men: a genetic
epidemiological study. Lancet Neurol. 6:125–133. 2007.PubMed/NCBI
|
|
4.
|
Matarín M, Brown WM, Scholz S, et al: A
genome-wide genotyping study in patients with ischaemic stroke:
initial analysis and data release. Lancet Neurol. 6:414–420.
2007.PubMed/NCBI
|
|
5.
|
Kubo M, Hata J, Ninomiya T, et al: A
nonsynonymous SNP in PRKCH (protein kinase C eta) increases the
risk of cerebral infarction. Nat Genet. 39:212–217. 2007.
View Article : Google Scholar : PubMed/NCBI
|
|
6.
|
Ikram MA, Seshadri S, Bis JC, et al:
Genomewide association studies of stroke. N Engl J Med.
360:1718–1728. 2009. View Article : Google Scholar : PubMed/NCBI
|
|
7.
|
Irie F, Iso H, Sairenchi T, et al: The
relationships of proteinuria, serum creatinine, glomerular
filtration rate with cardiovascular disease mortality in Japanese
general population. Kidney Int. 69:1264–1271. 2006. View Article : Google Scholar
|
|
8.
|
Yahalom G, Schwartz R, Schwammenthal Y, et
al: Chronic kidney disease and clinical outcome in patients with
acute stroke. Stroke. 40:1296–1303. 2009. View Article : Google Scholar : PubMed/NCBI
|
|
9.
|
Muntner P, He J, Hamm L, Loria C and
Whelton PK: Renal insufficiency and subsequent death resulting from
cardiovascular disease in the United States. J Am Soc Nephrol.
13:745–753. 2002.PubMed/NCBI
|
|
10.
|
Matsuo S, Imai E, Horio M, et al: Revised
equations for estimated GFR from serum creatinine in Japan. Am J
Kidney Dis. 53:982–992. 2009. View Article : Google Scholar : PubMed/NCBI
|
|
11.
|
Levey AS, Eckardt KU, Tsukamoto Y, et al:
Definition and classification of chronic kidney disease: a position
statement from Kidney Disease: Improving Global Outcomes (KDIGO).
Kidney Int. 67:2089–2100. 2005. View Article : Google Scholar : PubMed/NCBI
|
|
12.
|
A committee established by the Director of
the National Institute of Neurological Disorders and Stroke,
National Institutes of Health: Special Report from the National
Institute of Neurological Disorders and Stroke. Classification of
Cerebrovascular Diseases III. Stroke. 21:637–676. 1990. View Article : Google Scholar : PubMed/NCBI
|
|
13.
|
Yamada Y, Fuku N, Tanaka M, et al:
Identification of CELSR1 as a susceptibility gene for
ischemic stroke in Japanese individuals by a genome-wide
association study. Atherosclerosis. 207:144–149. 2009.
|
|
14.
|
Oguri M, Kato K, Yokoi K, et al:
Association of a polymorphism of BCHE with ischemic stroke
in Japanese individuals with chronic kidney disease. Mol Med Rep.
2:779–785. 2009.PubMed/NCBI
|
|
15.
|
Yamada Y, Kato K, Oguri M, et al:
Association of genetic variants with atherothrombotic cerebral
infarction among Japanese individuals with metabolic syndrome. Int
J Mol Med. 21:801–808. 2008.PubMed/NCBI
|
|
16.
|
Yamada Y, Metoki N, Yoshida H, et al:
Genetic factors for ischemic and hemorrhagic stroke in Japanese
individuals. Stroke. 39:2211–2218. 2008. View Article : Google Scholar : PubMed/NCBI
|
|
17.
|
Yamada Y, Metoki N, Yoshida H, et al:
Genetic risk for ischemic and hemorrhagic stroke. Arterioscler
Thromb Vasc Biol. 26:1920–1925. 2006. View Article : Google Scholar : PubMed/NCBI
|
|
18.
|
Itoh Y, Mizuki N, Shimada T, et al:
High-throughput DNA typing of HLA-A, -B, -C and -DRB1 loci by a
PCR-SSOP-Luminex method in the Japanese population. Immunogenetics.
57:717–729. 2005. View Article : Google Scholar : PubMed/NCBI
|
|
19.
|
Benjamini Y and Hochberg Y: Controlling
the false discovery rate: a practical and powerful approach to
multiple testing. J Royal Stat Soc Ser B. 57:289–300. 1995.
|
|
20.
|
Goldstein LB, Adams R, Becker K, et al:
Primary prevention of ischemic stroke: a statement for healthcare
professionals from the Stroke Council of the American Heart
Association. Stroke. 32:280–299. 2001. View Article : Google Scholar
|
|
21.
|
Humphries SE and Morgan L: Genetic risk
factors for stroke and carotid atherosclerosis: insights into
pathophysiology from candidate gene approaches. Lancet Neurol.
3:227–235. 2004. View Article : Google Scholar : PubMed/NCBI
|
|
22.
|
Masiakowski P and Carroll RD: A novel
family of cell surface receptors with tyrosine kinase-like domain.
J Biol Chem. 267:26181–26190. 1992.PubMed/NCBI
|
|
23.
|
Forrester WC: The Ror receptor tyrosine
kinase family. Cell Mol Life Sci. 59:83–96. 2002. View Article : Google Scholar : PubMed/NCBI
|
|
24.
|
Stommel JM, Kimmelman AC, Ying H, et al:
Coactivation of receptor tyrosine kinases affects the response of
tumor cells to targeted therapies. Science. 318:287–290. 2007.
View Article : Google Scholar : PubMed/NCBI
|
|
25.
|
Schlessinger J: Cell signaling by receptor
tyrosine kinases. Cell. 103:211–225. 2000. View Article : Google Scholar : PubMed/NCBI
|
|
26.
|
Yoda A, Oishi I and Minami Y: Expression
and function of the Ror-family receptor tyrosine kinases during
development: lessons from genetic analyses of nematodes, mice and
humans. J Recept Signal Transduct Res. 23:1–15. 2003. View Article : Google Scholar : PubMed/NCBI
|
|
27.
|
Afzal AR, Rajab A, Fenske CD, et al:
Recessive Robinow syndrome, allelic to dominant brachydactyly type
B, is caused by mutation of ROR2. Nat Genet. 25:419–422. 2000.
View Article : Google Scholar : PubMed/NCBI
|
|
28.
|
Oldridge M, Fortuna AM, Maringa M, et al:
Dominant mutations in ROR2, encoding an orphan receptor tyrosine
kinase, cause brachydactyly type B. Nat Genet. 24:275–278. 2000.
View Article : Google Scholar : PubMed/NCBI
|
|
29.
|
Katoh M and Katoh M: Comparative genomics
on ROR1 and ROR2 orthologs. Oncol Rep. 14:1381–1384.
2005.PubMed/NCBI
|
|
30.
|
Wright TM, Brannon AR, Gordan JD, et al:
Ror2, a developmentally regulated kinase, promotes tumor growth
potential in renal cell carcinoma. Oncogene. 28:2513–2523. 2009.
View Article : Google Scholar : PubMed/NCBI
|
