Introduction
Tubular epithelial-mesenchymal transition (EMT) is
the critical initiating agent in tubulointerstitial fibrosis
(1–3). The dissolution of tight junctions
(TJs) is an early event in EMT (4,5),
which is preceded by the downregulation of adhesion molecules,
including claudins, occludin, zona occludens protein 1 (also known
as tight junction protein 1; ZO-1) and desmoplakin. Transforming
growth factor (TGF)-β1 plays a vital role in EMT regulation. The
Smad, RhoA/ROCK and p38/MAPK signaling pathways play important
roles in TGF-β-induced EMT in different epithelial cells (6–10).
Tian et al (11) provided
evidence of the function of TGF-β1-induced RhoA activation in renal
proximal tubular epithelial cells. Our previous study suggested
that the RhoA/ROCK signaling pathway mediates TGF-β1-induced EMT in
rat peritoneal mesothelial cells (RPMCs) (12), and the changes characteristic of
EMT were partially reversed by Y-27632, a ROCK inhibitor. In
another previous study, we suggested that the Smad signaling
pathway mediates TGF-β1-induced EMT in human peritoneal mesothelial
cells (HPMCs) (13). It remains
unclear, however, whether the RhoA/ROCK signaling pathway mediates
TGF-β1-induced EMT by promoting the dissolution of TJs in renal
proximal tubular epithelial cells. In this study, we selected the
HK-2 cell line to investigate this process, as these cells are
commonly used as an in vitro model of normal human proximal
tubular cells (14). We aimed to
determine the role of the RhoA/ROCK signaling pathway in regulating
the TGF-β1-induced dissolution of TJs in HK-2 cells. In addition,
we explored the potential of this process as a therapeutic target
for the prevention of early-stage EMT.
Materials and methods
In vitro cell culture
The human renal proximal tubular epithelial cell
line, HK-2, which was purchased from ATCC (Manassas, VA, USA) and
maintained in a defined medium [1:1 mixture of DMEM and Ham’s F-12
(Gibco/Invitrogen, Carlsbad, CA, USA) containing 10% fetal bovine
serum (FBS), penicillin (100 U/ml), streptomycin (100 μg/ml),
insulin (0.5 μg/ml), transferrin (5 μg/ml) and hydrocortisone (1
μg/ml)] at 37°C in a 5% CO2 environment. After the cells
achieved 80% cell confluency, the medium was changed to FBS-free
DMEM/F12. First, 5 ng/ml TGF-β1, which is a concentration commonly
used in EMT in in vitro studies (15) (Pepro Tech Inc., Rocky Hill, NJ,
USA), was added at different time points (0, 12, 24 and 48 h).
Second, the HK-2 cells were divided into three groups: a control
group (FBS-free DMEM/F12 for 24 h); a TGF-β1 group (5 ng/ml TGF-β1
treatment for 24 h); and a TGF-β1 + Y-27632 group [pre-treated with
10 μM Y-27632 (Calbiochem, San Diego, CA, USA) and then treated
with TGF-β1 for 24 h]. mRNA and protein expression were determined
by real-time PCR and western blot analysis, respectively.
Gene expression
Total RNA from the HK-2 cells was isolated using
TRIzol reagent. Real-time PCR was performed with an Applied
Biosystems 7300 Real-Time PCR System (Applied Biosystems, Bedford,
MA, USA) using a SYBR-Green PCR reagent kit (Invitrogen). The
change in mRNA levels was determined using the 2−ΔΔCT
method, where ΔCT is the value from the threshold cycle (CT) of the
treated sample subtracted from the CT value of the untreated or
zero time point control sample. The relative amount of mRNA in the
sample was normalized to β-actin mRNA. The PCR primers were as
follows: occludin (106 bp) sense, 5′TCCAGAGTCTTCCTATAAATCCAC3′ and
antisense, 5′ACCACCGCTGCTGTAACG3′; ZO-1 (134 bp) sense,
5′TGGTGTCCTACCTAATTCAACTCA3′ and antisense,
5′CGCCAGCTACAAATATTCCAACA3′; β-actin (231 bp) sense,
5′ACTCTTCCAGCCTTCCTTCC3′ and antisense,
5′GAGGAGCAATGATCTTGATCTTC3′. The primers were synthesized by
Invitrogen Shanghai (Shanghai, China).
Protein expression
Protein expression was evaluated by western blot
analysis according to a previously described method (16). Total protein from the HK-2 cells
was isolated using RIPA lysis buffer (Beijing Dingguo Changsheng
Biotechnology Co. Ltd., Beijing, China) containing a cocktail of
protease inhibitors. Primary antibodies included anti-occludin
(1:400) and anti-ZO-1 (1:500) (Santa Cruz Biotechnology, Inc. Santa
Cruz, CA, USA). The absorbance signal was analyzed using Image
Station 4000 MM (Kodak, Rochester, NY, USA).
Immunofluorescence
Immunohistochemical staining was performed on the
HK-2 cells using anti-ZO-1 and anti-occludin antibodies (Santa Cruz
Biotechnology, Inc.). HK-2 cells were grown on poly-L-lysine-coated
glass coverslips (BD Biosciences, San Jose, CA, USA) to 40–50%
confluence, serum-deprived overnight (DMEM + 1% FBS), and then
treated with TGF-β1 in the presence or absence of a 2-h
pre-treatment with Y-27632. Following fixation with acetone, the
cells were permeabilized in 1% Triton X-100 (Sigma-Aldrich, St.
Louis, MO, USA) and blocked with 5% BSA. The cells were incubated
with primary antibodies (to ZO-1 and occludin) overnight at 4°C.
The slides were then washed and incubated with the appropriate
FITC-conjugated secondary antibody. The cells were then incubated
with Hoechst 33342 (Invitrogen) for nuclear staining and mounted
with propyl gallate under glass coverslips. Finally, the cells were
visualized by immunofluorescence with a laser scanning Nikon
microscope at ×20 magnification. Each experiment was repeated three
times.
Statistical analysis
The Data presented in this study are expressed as
the means ± SE. One-way ANOVA was used to assess the measurement
data and the least significant difference t-test was used to assess
statistical differences between pairs of groups. A P-value <0.05
was considered to indicate a statistically significant
difference.
Results
TGF-β1 downregulates occludin and ZO-1
expression in HK-2 cells
The HK-2 cells were exposed to TGF-β1 as indicated
above, and the mRNA and protein levels of occludin were assessed by
real-time PCR and western blot analysis, respectively. Treatment
with TGF-β1 decreased occludin mRNA (Fig. 1A) and protein (Fig. 1B) levels as compared with those of
the control group in a time-dependent manner. The mRNA and protein
levels were significantly decreased after 24 (P<0.05) and 48 h
of treatment (P<0.05), suggesting that TGF-β1 induced the
dissolution of TJs in the HK-2 cells.
 | Figure 1TGF-β1 downregulates the expression
level of occludin in HK-2 cells. (A and B) Treatment with TGF-β1
decreased the expression of occludin in a time-dependent manner in
the HK-2 cells at the mRNA and protein level, respectively. (A) The
2−ΔΔCT value of occludin relative to that of β-actin in
HK-2 cells following exposure to TGF-β1 (5 ng/ml, 0–48 h). The
expression of occludin decreased in a time-dependent manner in the
HK-2 cells treated with TGF-β1 (columns 2–4). The 2−ΔΔCT
values for occludin mRNA levels in HK-2 cells treated with TGF-β1
for 12, 24 and 48 h were 0.917±0.028 (P>0.05), 0.560±0.055
(P<0.05) and 0.306±0.047 (P<0.05), respectively. (B)
Densitometry value for occludin relative to that of β-actin
detected by western blot analysis in HK-2 cells following exposure
to TGF-β1 (5 ng/ml, 0–48 h). The ratios of occludin protein
relative to those of β-actin in HK-2 cells treated with TGF-β1 for
12, 24 and 48 h were 0.883±0.038 (P>0.05), 0.730±0.072
(P<0.05), and 0.528±0.046 (P<0.05), respectively.
*P<0.05 vs. control group. |
The HK-2 cells were exposed to TGF-β1 as indicated
above, and the mRNA and protein levels of ZO-1 were assessed by
real-time PCR and western blot analysis, respectively. Treatment
with TGF-β1 decreased the mRNA (Fig.
2A) and protein (Fig. 2B)
levels of ZO-1 as compared with those of the control group in a
time-dependent manner. The mRNA and protein levels were
significantly decreased after 24 (P<0.05) and 48 h of treatment
(P<0.05), providing further evidence that TGF-β1 induced the
dissolution of TJs in HK-2 cells.
 | Figure 2TGF-β1 downregulates the level of ZO-1
in HK-2 cells. (A and B) TGF-β1 treatment decreased the expression
of ZO-1 in a time-dependent manner in HK-2 cells at the mRNA and
protein level, respectively. (A) The 2−ΔΔCT value of
ZO-1 relative to that of β-actin in HK-2 cells following exposure
to TGF-β1 (5 ng/ml, 0–48 h). The expression of ZO-1 decreased in a
time-dependent manner in HK-2 cells treated with TGF-β1 (columns
2–4). The 2−ΔΔCT values of the ZO-1 mRNA expression
level in HK-2 cells treated with TGF-β1 for 12, 24 and 48 h were
0.895±0.117 (P>0.05), 0.406±0.021 (P<0.05), and 0.345±0.008
(P<0.05), respectively. (B) Densitometry value of ZO-1 relative
to that of β-actin detected by western blot analysis in HK-2 cells
following exposure to TGF-β1 (5 ng/ml, 0–48 h). The ratios of ZO-1
protein relative to those of β-actin in HK-2 cells treated with
TGF-β1 for 12, 24 and 48 h were 0.916±0.036 (P>0.05),
0.691±0.027 (P<0.05) and 0.442±0.012 (P<0.05), respectively.
*P<0.05 vs. control group. |
Y-27632 attenuates the downregulation of
occludin and ZO-1 induced by TGF-β1 in HK-2 cells
The HK-2 cells were pre-treated with 10 μM Y-27632
for 2 h and then treated with 5 ng/ml TGF-β1 for 48 h. The
expression of occludin was assessed by real-time PCR,
immunofluorescence and western blot analysis (Fig. 3). Treatment with TGF-β1 decreased
the expression of occludin (Fig. 3B;
D and E column 2) compared with that of the control group
(Fig. 3A; D and E column 1)
(P<0.05). This decrease in occudin expression was attenuated in
the cells treated with TGF-β1 + Y-27632 (Fig. 3C; D and E column 3), and was not
significantly different from that in the control group (P>0.05).
Thus, the TGF-β1-induced downregulation in occludin expression in
the HK-2 cells was attenuated by the ROCK inhibitor, Y-27632.
The HK-2 cells were pre-treated with 10 μM Y-27632
for 2 h and then treated with 5 ng/ml TGF-β1 for 48 h. The
expression of ZO-1 was assessed by real-time PCR,
immunofluorescence and western blot analysis (Fig. 4). Treatment with TGF-β1 decreased
the expression of ZO-1 (Fig. 4B; D
and E column 2) compared with that of the control group
(Fig. 4A; D and E column 1)
(P<0.05). This decrease in ZO-1 expression was attenuated in the
cells treated with TGF-β1 + Y-27632 (Fig. 4C; D and E column 3), and was not
significantly different from that in the control group (P>0.05).
These results suggested that the TGF-β1-induced downregulation in
ZO-1 expresision in the HK-2 cells was attenuated by the ROCK
inhibitor, Y-27632.
Discussion
Tubular interstitial fibrosis is an important
component of chronic kidney disease (CKD). The key event of tissue
fibrosis involves EMT induced by TGF-β1, which involves the
differentiation of epithelial cells into fibroblasts. TJs are the
most apical component of the intercellular junctional complex and
play a vital role in maintaining epithelial polarity (17). Occludin and ZO-1 are key
components of TJs. The dissociation of TJs is an early, significant
event in EMT (18). According our
results, the decreased expression of ZO-1 and occludin was observed
in the HK-2 cells treated with TGF-β1 as early as 12 h, and this
decrease continued at 24 and 48 h after treatment in a
time-dependent manner, suggesting that the dissolution of TJs is a
critical event during EMT.
Previous studies have suggested that the RhoA/ROCK
signaling pathway is involved in actin reorganization and cell
migration. It has been confirmed that RhoA is activated by TGF-β1
and is part of an important signaling pathway in TGF-β1-induced EMT
(11,12). ROCK is a characteristic,
downstream protein in the Rho signaling pathway and an important
kinase involved in the regulation of cell movement and cytoskeletal
organization (19–21). Y-27632, a 4-aminopyridine-type
chemical used in studies on cell biology and pharmacology, is
generally accepted to be a specific ROCK inhibitor.
Previous studies on the Rho/ROCK pathway have mainly
focused on the regulation of the cytoskeleton and the mechanisms by
which the Rho/ROCK pathway mediates EMT (22–25). Our previous study revealed that
TGF-β1 induced the downregulation of vimentin (a cytoskeletal
protein) and the upregulation of α-SMA via the RhoA/ROCK signaling
pathway in RPMCs (12). Other
stueis, however, have shown that the Rho/ROCK signaling pathway may
also mediate the downregulation of claudin-4, which is a component
of TJs in corneal, gastric epithelial and Madin-Darby canine kidney
epithelial cells (26–28), indicating that the Rho/ROCK
signaling pathway may play a role in the dissolution of TJs.
Nevertheless, it is unclear whether the RhoA/ROCK signaling pathway
mediates TGF-β1-induced EMT by targeting TJs and inducing their
dissolution in HK-2 cells.
In this study, the ROCK inhibitor, Y-27632,
attenuated the downregulation in ZO-1 and occludin expression at
the gene and protein level, which was induced by TGF-β1 by blocking
the Rho/ROCK signaling pathway. These results reveal that the
Rho/ROCK signaling pathway plays a key role in the dissolution of
TJs, an early and reversible event in EMT. However, it was observed
that following treatment with TGF-β1 and Y-27632, the ZO-1 mRNA
levels were only half of the control levels, which suggests that
RhoA/ROCK is not the only regulator of ZO-1 expression.
In conclusion, in this study, we determined that the
dissolution of TJs occurs in HK-2 cells exposed to TGF-β1, possiby
involving the activation of the Rho/ROCK signaling pathway.
Understanding the involvement of the Rho/ROCK signaling pathway in
EMT is critical, particularly during the early stages of this
process. Since EMT plays a critical role in renal disease, the
results from this study may aid in the development of more
effective diagnostic markers and therapeutic strategies for
patients with CKD.
References
|
1
|
Rastaldi MP: Epithelial-mesenchymal
transition and its implications for the development of renal
tubulointerstitial fibrosis. J Nephrol. 19:407–412. 2006.PubMed/NCBI
|
|
2
|
Li MX and Liu BC: Epithelial to
mesenchymal transition in the progression of tubulointerstitial
fibrosis. Chinese Med J. 120:1925–1930. 2007.PubMed/NCBI
|
|
3
|
Liu Y: Cellular and molecular mechanisms
of renal fibrosis. Nat Rev. 7:684–696. 2011.PubMed/NCBI
|
|
4
|
Blanco D, Vicent S, Elizegi E, Pino I,
Fraga MF, Esteller M, Saffiotti U, Lecanda F and Montuenga LM:
Altered expression of adhesion molecules and epithelial-mesenchymal
transition in silica-induced rat lung carcinogenesis. Lab Invest.
84:999–1012. 2004. View Article : Google Scholar : PubMed/NCBI
|
|
5
|
Ozdamar B, Bose R, Barrios-Rodiles M, Wang
HR, Zhang Y and Wrana JL: Regulation of the polarity protein Par6
by TGFbeta receptors controls epithelial cell plasticity. Science.
307:1603–1609. 2005. View Article : Google Scholar : PubMed/NCBI
|
|
6
|
Kolosova I, Nethery D and Kern JA: Role of
Smad2/3 and p38 MAP kinase in TGF-beta1-induced
epithelial-mesenchymal transition of pulmonary epithelial cells. J
Cell Physiol. 226:1248–1254. 2011. View Article : Google Scholar : PubMed/NCBI
|
|
7
|
Lampropoulos P, Zizi-Sermpetzoglou A,
Rizos S, Kostakis A, Nikiteas N and Papavassiliou AG: TGF-beta
signalling in colon carcinogenesis. Cancer Lett. 314:1–7. 2011.
View Article : Google Scholar
|
|
8
|
Lv ZM, Wang Q, Wan Q, Lin JG, Hu MS, Liu
YX and Wang R: The role of the p38 MAPK signaling pathway in high
glucose-induced epithelial-mesenchymal transition of cultured human
renal tubular epithelial cells. PloS One. 6:e228062011. View Article : Google Scholar : PubMed/NCBI
|
|
9
|
Matsuzaki K: Smad phosphoisoform signaling
specificity: the right place at the right time. Carcinogenesis.
32:1578–1588. 2011. View Article : Google Scholar : PubMed/NCBI
|
|
10
|
Schneider D and Janshoff A: Inhibition of
actin dynamics during epithelial-to-mesenchymal transition. Biochem
Biophys Res Commun. 419:221–225. 2012. View Article : Google Scholar : PubMed/NCBI
|
|
11
|
Tian YC, Fraser D, Attisano L and Phillips
AO: TGF-beta1-mediated alterations of renal proximal tubular
epithelial cell phenotype. Am J Physiol. 285:F130–F142.
2003.PubMed/NCBI
|
|
12
|
Zhang H, Liu X, Liu Y, Yi B and Yu X:
Epithelial-mesenchymal transition of rat peritoneal mesothelial
cells via Rhoa/Rock pathway. In Vitro Cell Dev Biol. 47:165–172.
2010. View Article : Google Scholar : PubMed/NCBI
|
|
13
|
Zhang H, Liu FY and Liu YH: Effect of
TGF-beta1 stimulation on the smad signal transduction pathway of
human peritoneal mesothelial cells. Zhong Nan Da Xue Xue Bao Yi Xue
Ban. 29:142–147. 2004.(In Chinese).
|
|
14
|
Ryan MJ, Johnson G, Kirk J, Fuerstenberg
SM, Zager RA and Torok-Storb B: HK-2: an immortalized proximal
tubule epithelial cell line from normal adult human kidney. Kidney
Int. 45:48–57. 1994. View Article : Google Scholar : PubMed/NCBI
|
|
15
|
Black D, Lyman S, Qian T, Lemasters JJ,
Rippe RA, Nitta T, Kim JS and Behrns KE: Transforming growth factor
beta mediates hepatocyte apoptosis through Smad3 generation of
reactive oxygen species. Biochimie. 89:1464–1473. 2007. View Article : Google Scholar : PubMed/NCBI
|
|
16
|
Sun L, Xiao L, Nie J, Liu FY, Ling GH, Zhu
XJ, Tang WB, Chen WC, Xia YC, Zhan M, Ma MM, Peng YM, Liu H, Liu YH
and Kanwar YS: p66Shc mediates high-glucose and angiotensin
II-induced oxidative stress renal tubular injury via
mitochondrial-dependent apoptotic pathway. Am J Physiol.
299:F1014–F1025. 2010.PubMed/NCBI
|
|
17
|
Ronaldson PT, Demarco KM,
Sanchez-Covarrubias L, Solinsky CM and Davis TP: Transforming
growth factor-beta signaling alters substrate permeability and
tight junction protein expression at the blood-brain barrier during
inflammatory pain. J Cereb Blood Flow Metab. 29:1084–1098. 2009.
View Article : Google Scholar
|
|
18
|
Inumaru J, Nagano O, Takahashi E, Ishimoto
T, Nakamura S, Suzuki Y, Niwa S, Umezawa K, Tanihara H and Saya H:
Molecular mechanisms regulating dissociation of cell-cell junction
of epithelial cells by oxidative stress. Genes Cells. 14:703–716.
2009. View Article : Google Scholar : PubMed/NCBI
|
|
19
|
Deroanne CF, Hamelryckx D, Ho TT, Lambert
CA, Catroux P, Lapiere CM and Nusgens BV: Cdc42 downregulates MMP-1
expression by inhibiting the ERK1/2 pathway. J Cell Sci.
118:1173–1183. 2005. View Article : Google Scholar : PubMed/NCBI
|
|
20
|
Dovas A, Choi Y, Yoneda A, Multhaupt HA,
Kwon SH, Kang D, Oh ES and Couchman JR: Serine 34 phosphorylation
of rho guanine dissociation inhibitor (RhoGDIalpha) links signaling
from conventional protein kinase C to RhoGTPase in cell adhesion. J
Biol Chem. 285:23296–23308. 2010. View Article : Google Scholar : PubMed/NCBI
|
|
21
|
Leung TH, Ching YP, Yam JW, Wong CM, Yau
TO, Jin DY and Ng IO: Deleted in liver cancer 2 (DLC2) suppresses
cell transformation by means of inhibition of RhoA activity. Proc
Natl Acad Sci USA. 102:15207–15212. 2005. View Article : Google Scholar : PubMed/NCBI
|
|
22
|
Edlund S, Landstrom M, Heldin CH and
Aspenstrom P: Transforming growth factor-beta-induced mobilization
of actin cytoskeleton requires signaling by small GTPases Cdc42 and
RhoA. Mol Biol Cell. 13:902–914. 2002. View Article : Google Scholar : PubMed/NCBI
|
|
23
|
Lee HT and Kay EP: FGF-2 induced
reorganization and disruption of actin cytoskeleton through PI
3-kinase, Rho, and Cdc42 in corneal endothelial cells. Mol Vision.
9:624–634. 2003.PubMed/NCBI
|
|
24
|
Patel S, Takagi KI, Suzuki J, Imaizumi A,
Kimura T, Mason RM, Kamimura T and Zhang Z: RhoGTPase activation is
a key step in renal epithelial mesenchymal transdifferentiation. J
Am Soc Nephrol. 16:1977–1984. 2005. View Article : Google Scholar : PubMed/NCBI
|
|
25
|
Ruiz-Loredo AY, Lopez E and Lopez-Colome
AM: Thrombin promotes actin stress fiber formation in RPE through
Rho/ROCK-mediated MLC phosphorylation. J Cell Physiol. 226:414–423.
2011. View Article : Google Scholar : PubMed/NCBI
|
|
26
|
Lapointe TK, O’Connor PM, Jones NL, Menard
D and Buret AG: Interleukin-1 receptor phosphorylation activates
Rho kinase to disrupt human gastric tight junctional claudin-4
during Helicobacter pylori infection. Cell Microbiol.
12:692–703. 2010. View Article : Google Scholar : PubMed/NCBI
|
|
27
|
Yin J and Yu FS: Rho kinases regulate
corneal epithelial wound healing. Am J Physiol. 295:C378–C387.
2008. View Article : Google Scholar : PubMed/NCBI
|
|
28
|
Bruewer M, Hopkins AM, Hobert ME, Nusrat A
and Madara JL: RhoA, Rac1, and Cdc42 exert distinct effects on
epithelial barrier via selective structural and biochemical
modulation of junctional proteins and F-actin. Am J Physiol.
287:C327–C335. 2004. View Article : Google Scholar : PubMed/NCBI
|
