Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
2014-January Volume 33 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
2014-January Volume 33 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Detection of mitochondrial DNA mutations by high-throughput sequencing in the blood of breast cancer patients

  • Authors:
    • Lin Hai Li
    • Tao Kang
    • Lidan Chen
    • Weiyun Zhang
    • Yang Liao
    • Jianyun Chen
    • Yuling Shi
  • View Affiliations / Copyright

    Affiliations: Graduate School of Southern Medical University, Guangzhou, Guangdong 510515, P.R. China, International Center for Metabolic Diseases, Southern Medical University, Guangzhou, Guangdong 510515, P.R. China, Department of Laboratory Medicine, Guangzhou General Hospital of Guangzhou Military Command, Guangzhou, Guangdong 510010, P.R. China
  • Pages: 77-82
    |
    Published online on: November 19, 2013
       https://doi.org/10.3892/ijmm.2013.1559
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Mitochondrial DNA mutations have been identified in serveral types of cancer. In breast cancer, germline and somatic mitochondrial DNA (mtDNA) mutations have been identified. A number of mtDNA mutations in breast cancer have been identified in protein-coding regions (in protein-coding genes, such as ND2, COX3, ND4, ND5 and CytB). Mutations in these structure proteins cause impaired electron transport function and lead to electron leakage and increased reactive oxygen species (ROS) production, which in turn increases oxidative stress and oxidative damage to the mitochondria, as well as to cells. These data establish an association between mtDNA mutations and breast cancer; however, there is no reliable prediction of breast cancer predisposition or progression based on mtDNA mutation patterns thus far. In this study, we used high-throughput sequencing to detect mtDNA mutations in the blood of breast cancer patients. Some of these mutations may be used as potential markers for breast cancer diagnosis.

Introduction

Human mitochondrial DNA (mtDNA) is a 16.6 kb circular double-stranded DNA molecule, which is present at a high copy number per cell. Thirteen of the 85 subunits comprising the oxidative phosphorylation system are encoded by mtDNA, including subunits within complex I (ND1, ND2, ND3, ND4, ND4L, ND5, ND6), complex III (CytB), complex IV (COI, COII, COIII) and complex V (ATPase6, ATPase8). Human mtDNA also contains 24 genes encoding 22 transfer RNAs (tRNAs) and 2 ribosomal RNAs (rRNAs) which are essential for protein synthesis within the mitochondria. Another important region in mtDNA is termed the D-loop, which is the initial site of heavy chain replication and the promoters for heavy and light chain transcription (1,2).

The mitochondrion functions as a powerhouse to generate adenosine triphosphate (ATP) through oxidative phosphorylation (OXPHOS). The mitochondrial OXPHOS also produces most of the cellular reactive oxygen species (ROS) at complexes I and III. It is believed that mtDNA mutations in the subunits of complexes I or III cause aberrant ROS production which may damage mtDNA, as well as nuclear DNA (3). In particular, the mitochondrion has relatively less sophisticated DNA protection and repair systems, and thus it is vulnerable to high mutation rates (4). The mitochondrion also plays central role in apoptosis (5,6), cell proliferation (7) and calcium signaling (8).

Germline and somatic mtDNA mutations have been found in primary breast cancer. One mtDNA population polymorphism has been found to be associated with an increased risk of breast cancer, suggesting that germline mtDNA mutations may be important in the etiology of breast cancer. This mutation occurs in the ND3 gene at nt 10398 in which the 10398A allele was linked to an increased risk of invasive breast cancer in African-American women, compared with African-American women with the 10398G allele. The 10398 allele was an independent risk factor for breast cancer in African-American women but no association was detectable in Caucasian women. It was thought that this mutation results in increased oxidative stress (9). However, Setiawan et al argued that there was no association between the 10398 allele and breast cancer in African-American women; however, their study did not provide detail information on the materials and methods that were used (10). Parrella et al reported that mtDNA mutations were detected in 61% of patients using direct sequencing. The affected genes included ND4, ND5 and CytB (11). Tan et al reported that 14 of the 19 breast tumors (74%) displayed at least one somatic mtDNA mutation. Twenty-seven somatic mutations were found and 22 of them occurred in the D-loop region. The affected genes included ND2, 16srRNA and ATPase6 (12). Gallardo et al reported mtDNA mutations of the COI gene in primary breast cancer. The mutation was expected to impair the interaction between subunit I and II of cytochrome c oxidase and the mutant had a reduced complex IV activity by 50% (13). Other studies have reported mtDNA mutations in the ND1, CoIII, tRNA-I and tRNA-T genes (11,14). It is believed that mtDNA mutations in structure proteins of the mitochondria cause impaired electron transport function and lead to electron leakage and increased ROS production, which in turn increases oxidative stress and oxidative damage to the mitochondria in the process of transformation and cancer progression. There is no direct evidence on breast cancer to support the ROS theory thus far; however, there is experimental evidence on prostate cancer to support this theory. Petros et al reported that cybrids with pathogenic mtDNA ATP6 T8993G generated tumors 7-fold larger than the wild-type (T8993T) cybrids. The mutant tumors generated significantly more ROS (15).

Studies in this field have established an association between mtDNA mutations and breast cancer. However, evidence for a direct association between these mtDNA mutations and breast cancer is still lacking in terms of the function of the mutant and the development of breast cancer. There has even been some debate between different research groups (9,10,16). Moreover, there is no reliable prediction of breast cancer predisposition or progression based on mtDNA mutation patterns identified thus far.

Materials and methods

All blood samples were collected according to procedures approved by the Institutional Review Board of the Guangzhou General Hospital of Guangzhou Military Command. There were 58 blood samples from breast cancer patients and 58 samples from age-matched healthy individuals used in this study. mtDNA from total cellular DNA was enriched by PCR-based strategies.

In PCR-based enrichment, two sets of primers were designed to amplify amplicons that cover the mtDNA genome. The primers used in this study were as follos: Mito-8kb-A-Fwd, GACGGGCTCACATCACCCCATAA/Mito-8kb-A-Rev, GCG TACGGCCAGGGCTATTGGT and Mito-8kb-B-Fwd, GGT GGCTGGCACGAAATTGACC/Mito-8kb-B-Rev, GCC ACAACTAACCTCCTCGGACTCCT.

Purified, blunt-ended PCR products were subsequently fragmented by sonication. Fragmented DNA was then end-repaired, A-tailed and ligated with an adaptor oligonucleotide from the Ion Torrent genomic DNA library preparation kit (Life Technologies, South San Francisco, USA) in accordance with the manufacturer’s instructions. Adaptor-ligated products were then size-selected by gel purification and sequenced by Ion Torrent PGM. The Mitomap (http://www.mitomap.org) and mtDB (http://www.genpat.uu.se/mtDB/) databases were used to identify sequence variants.

Results

High-throughput sequencing and quality control were performed. Quality scores were all above 200 and the sequence content was steady (Fig. 1). Thus, the sequence data were ready for use in further analysis.

Figure 1

Quality control of sequencing data. (A) Quality scores across all bases. (B) Sequence content across all bases.

In the following step, we compared data from the blood of breast cancer patients and the controls in 4 pairs of samples (Figs. 2–5). There were two pools of 28 blood samples from patients or controls in pair 1 and pair 2. For pair 3 and pair 4, there was one patient sample and one age-matched control. The reported variants were confirmed. In addition, we found a new mtDNA variant (13564 A>G). In this study, mitochondrial genomes were fully sequenced from blood DNA obtained from the patients with breast cancer and the normal controls. The new mtDNA variants may be potential biomarkers for the early detection of breast cancer. There are several advantages of using mtDNA as a potential biomarker for cancer-specific mutation studies. The genome is well characterized, with 16,568 bp harboring 37 genes. Secondly, a high copy number is an advantage over nuclear DNA for the detection of sequence variants. In addition, DNA repair is less efficient in the mitochondria than nuclear genomes; therefore, mutations are more easily identified.

Figure 2

Single-nucleotide polymorphisms (SNPs) and heteroplasmy in pair 1 samples. (A) SNPs, (B) heteroplasmy.

Figure 5

Single-nucleotide polymorphisms (SNPs) and heteroplasmy in pair 4 samples. (A) SNPs, (B) heteroplasmy.

Discussion

Evidence indicates an association between mtDNA mutations and breast cancer; however, there is no reliable prediction of breast cancer predisposition or progression based on mtDNA mutation patterns thus far. In this study, we compared mtDNA sequence data from the blood of breast cancer patients and controls. We confirmed the reported variants and found a new mtDNA variant (13564 A>G). As some studies have suggested, there may be two classes of cancer mtDNA mutations: tumorigenic mutations and adaptive mutations. Tumorigenic mutations would be advantageous in the initial phases of tumor growth, while the adaptive mutations would be advantageous in the late phases of tumor growth when the tumor becomes vascularized (17). Furthermore, since the two classes of mtDNA mutations have different functions in cancer cells, they may be expected to arise and be lost from the tumor cells at different phases during tumor growth. This could be the reason that the heteroplasmid 294 nt ND1 deletion mtDNA has been shown to be present in 50% of the mtDNAs in primary renal cell carcinoma but absent in the subsequent metastatic tumors from the same patient (17,18). The same may occur in breast cancer. Moreover, Rajasimha et al reported that the selection against pathogenic mtDNA mutations occurs in a stem cell population. They found that the percentage of pathogenic mtDNA mutations in the blood decreases exponentially over time compared with that in hematopoietic stem cells and leukocyte precursors (19). Therefore, it can be argued that primary breast cancer cells may not be the right cell population to detect tumorigenic mtDNA mutations. In other words, studies carried out on primary breast cancer cells to date have been unable to detect tumorigenic mtDNA mutations. Thus, perhaps it would be more effective to detect tumorigenic mtDNA mutations in breast cancer stem cells.

Solid evidence supports the hypothesis that breast cancer follows a cancer stem cell model. In 2003, Al-Hajj et al reported that they were able to identify and isolate a minority group of breast cancer cells using the surface marker, CD44+/CD24−/low/Lin−. Only a few of these cells (only 100 cells) were able to form tumors in mice, whereas of the rest cell population (tens of thousands cells) failed to form tumors. Furthermore, this tumorigenic subpopulation could be serially passaged and the subsequent tumors had a heterogeneity similar to the parental tumor: CD44+/CD24−/low/Lin− tumorigenic cells, as well as the phenotypically diverse mixed populations of non-tumorigenic cells (20). There may be some concern in terms of species incompatibilities since they used a model in which human breast cancer cells were grown in immunocompromised mice. However, breast cancer stem cells were confirmed in following studies using mouse models of breast cancer. In 2008, Cho et al isolated and characterized cancer stem cells in MMTV-Wnt-1 murine breast tumors. They demonstrated that Thy1+CD24+ cancer cells were highly enriched cells capable of regenerating new tumors compared with the cells of the tumor that did not have this marker profile (21). Similarly, Zhang et al identified breast cancer stem cells in a p53-null mouse model of breast cancer using the Lin−/CD29high/CD24high marker (22). Vaillant et al identified breast cancer stem cells in MMTV-Wnt-1, as well as in p53+/− mouse models using the luminal epithelial progenitor marker, CD61/β3 integrin (23). It seems that several sets of markers can be used to isolate breast stem cells, although the functions of these markers in stem cells remain unclear. In 2007, Ginestier et al isolated normal and malignant human mammary stem cells using aldehyde dehydrogenase (ALDH)1 as a marker. They demonstrated that normal and cancer human mammary epithelial cells with increased ALDH activity had stem cell/progenitor properties. In breast tumors, a high ALDH activity identified the tumorigenic cell fraction which was capable of self-renewal and generating tumors. The subsequent tumors recapitulated the heterogeneity of the parental tumor. Furthermore, the expression of ALDH1 detected by immunostaining correlated with a poor prognosis in a series of 577 breast carcinomas (24). In 2009, Charafe-Jauffret et al isolated breast cancer stem cells in 23 breast cancer cell lines using ALDH assay followed by FACS. They confirmed the stem cell properties of ALDH-positive populations in vitro and in NOD/SCID xenografts (25). Taken together, using high-throughput sequencing, the findings from our study provide new evidence to support the association between mtDNA mutations and breast cancer. As a next step, it would be helpful to detect tumorigenic mtDNA mutations in breast cancer stem cells to expand these findings.

Acknowledgements

This study was funded by grants from Guangdong Province, the China Science and Technology Development Project of Guangdong Province (2010B011300018-7) and the Natural Science Foundation of Guangdong Province (8451051501000491).

References

1 

Attardi G and Schatz G: Biogenesis of mitochondria. Annu Rev Cell Biol. 4:289–333. 1988. View Article : Google Scholar

2 

Lightowlers RN, Chinnery PF, Turnbull DM and Howell N: Mammalian mitochondrial genetics: heredity, heteroplasmy and disease. Trends Genet. 13:450–455. 1997. View Article : Google Scholar : PubMed/NCBI

3 

Wallace DC: A mitochondrial paradigm of metabolic and degenerative diseases, aging, and cancer: a dawn for evolutionary medicine. Annu Rev Genet. 39:359–407. 2005. View Article : Google Scholar : PubMed/NCBI

4 

DiMauro S and Schon EA: Mitochondrial DNA mutations in human disease. Am J Med Genet. 106:18–26. 2001. View Article : Google Scholar : PubMed/NCBI

5 

Wang X: The expanding role of mitochondria in apoptosis. Genes Dev. 15:2922–2933. 2001.PubMed/NCBI

6 

Kroemer G and Reed JC: Mitochondrial control of cell death. Nat Med. 6:513–519. 2000. View Article : Google Scholar

7 

Rustin P: Mitochondria, from cell death to proliferation. Nat Genet. 30:352–353. 2002. View Article : Google Scholar : PubMed/NCBI

8 

Babcock DF and Hille B: Mitochondrial oversight of cellular Ca2+ signaling. Curr Opin Neurobiol. 8:398–404. 1998. View Article : Google Scholar : PubMed/NCBI

9 

Canter JA, Kallianpur AR, Parl FF and Millikan RC: Mitochondrial DNA G10398A polymorphism and invasive breast cancer in African-American women. Cancer Res. 65:8028–8033. 2005.

10 

Setiawan VW, Chu LH, John EM, et al: Mitochondrial DNA G10398A variant is not associated with breast cancer in African-American women. Cancer Genet Cytogenet. 181:16–19. 2008. View Article : Google Scholar : PubMed/NCBI

11 

Parrella P, Xiao Y, Fliss M, et al: Detection of mitochondrial DNA mutations in primary breast cancer and fine-needle aspirates. Cancer Res. 61:7623–7626. 2001.PubMed/NCBI

12 

Tan DJ, Bai RK and Wong LJ: Comprehensive scanning of somatic mitochondrial DNA mutations in breast cancer. Cancer Res. 62:972–976. 2002.PubMed/NCBI

13 

Gallardo ME, Moreno-Loshuertos R, Lopez C, et al: m.6267G>A: a recurrent mutation in the human mitochondrial DNA that reduces cytochrome c oxidase activity and is associated with tumors. Hum Mutat. 27:575–582. 2006.

14 

Zhu W, Qin W, Bradley P, Wessel A, Puckett CL and Sauter ER: Mitochondrial DNA mutations in breast cancer tissue and in matched nipple aspirate fluid. Carcinogenesis. 26:145–152. 2005. View Article : Google Scholar : PubMed/NCBI

15 

Petros JA, Baumann AK, Ruiz-Pesini E, et al: mtDNA mutations increase tumorigenicity in prostate cancer. Proc Natl Acad Sci USA. 102:719–724. 2005. View Article : Google Scholar : PubMed/NCBI

16 

Salas A, Yao YG, Macaulay V, Vega A, Carracedo A and Bandelt HJ: A critical reassessment of the role of mitochondria in tumorigenesis. PLoS Med. 2:e2962005. View Article : Google Scholar : PubMed/NCBI

17 

Brandon M, Baldi P and Wallace DC: Mitochondrial mutations in cancer. Oncogene. 25:4647–4662. 2006. View Article : Google Scholar

18 

Horton TM, Petros JA, Heddi A, et al: Novel mitochondrial DNA deletion found in a renal cell carcinoma. Genes Chromosomes Cancer. 15:95–101. 1996. View Article : Google Scholar : PubMed/NCBI

19 

Rajasimha HK, Chinnery PF and Samuels DC: Selection against pathogenic mtDNA mutations in a stem cell population leads to the loss of the 3243A-->G mutation in blood. Am J Hum Genet. 82:333–343. 2008. View Article : Google Scholar : PubMed/NCBI

20 

Al-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ and Clarke MF: Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci USA. 100:3983–3988. 2003. View Article : Google Scholar : PubMed/NCBI

21 

Cho RW, Wang X, Diehn M, et al: Isolation and molecular characterization of cancer stem cells in MMTV-Wnt-1 murine breast tumors. Stem Cells. 26:364–371. 2008. View Article : Google Scholar : PubMed/NCBI

22 

Zhang M, Behbod F, Atkinson RL, et al: Identification of tumor-initiating cells in a p53-null mouse model of breast cancer. Cancer Res. 68:4674–4682. 2008. View Article : Google Scholar : PubMed/NCBI

23 

Vaillant F, Asselin-Labat ML, Shackleton M, Forrest NC, Lindeman GJ and Visvader JE: The mammary progenitor marker CD61/beta3 integrin identifies cancer stem cells in mouse models of mammary tumorigenesis. Cancer Res. 68:7711–7717. 2008. View Article : Google Scholar : PubMed/NCBI

24 

Ginestier C, Hur MH, Charafe-Jauffret E, et al: ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell. 1:555–567. 2007. View Article : Google Scholar : PubMed/NCBI

25 

Charafe-Jauffret E, Ginestier C, Iovino F, et al: Breast cancer cell lines contain functional cancer stem cells with metastatic capacity and a distinct molecular signature. Cancer Res. 69:1302–1313. 2009. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Li LH, Kang T, Chen L, Zhang W, Liao Y, Chen J and Shi Y: Detection of mitochondrial DNA mutations by high-throughput sequencing in the blood of breast cancer patients. Int J Mol Med 33: 77-82, 2014.
APA
Li, L.H., Kang, T., Chen, L., Zhang, W., Liao, Y., Chen, J., & Shi, Y. (2014). Detection of mitochondrial DNA mutations by high-throughput sequencing in the blood of breast cancer patients. International Journal of Molecular Medicine, 33, 77-82. https://doi.org/10.3892/ijmm.2013.1559
MLA
Li, L. H., Kang, T., Chen, L., Zhang, W., Liao, Y., Chen, J., Shi, Y."Detection of mitochondrial DNA mutations by high-throughput sequencing in the blood of breast cancer patients". International Journal of Molecular Medicine 33.1 (2014): 77-82.
Chicago
Li, L. H., Kang, T., Chen, L., Zhang, W., Liao, Y., Chen, J., Shi, Y."Detection of mitochondrial DNA mutations by high-throughput sequencing in the blood of breast cancer patients". International Journal of Molecular Medicine 33, no. 1 (2014): 77-82. https://doi.org/10.3892/ijmm.2013.1559
Copy and paste a formatted citation
x
Spandidos Publications style
Li LH, Kang T, Chen L, Zhang W, Liao Y, Chen J and Shi Y: Detection of mitochondrial DNA mutations by high-throughput sequencing in the blood of breast cancer patients. Int J Mol Med 33: 77-82, 2014.
APA
Li, L.H., Kang, T., Chen, L., Zhang, W., Liao, Y., Chen, J., & Shi, Y. (2014). Detection of mitochondrial DNA mutations by high-throughput sequencing in the blood of breast cancer patients. International Journal of Molecular Medicine, 33, 77-82. https://doi.org/10.3892/ijmm.2013.1559
MLA
Li, L. H., Kang, T., Chen, L., Zhang, W., Liao, Y., Chen, J., Shi, Y."Detection of mitochondrial DNA mutations by high-throughput sequencing in the blood of breast cancer patients". International Journal of Molecular Medicine 33.1 (2014): 77-82.
Chicago
Li, L. H., Kang, T., Chen, L., Zhang, W., Liao, Y., Chen, J., Shi, Y."Detection of mitochondrial DNA mutations by high-throughput sequencing in the blood of breast cancer patients". International Journal of Molecular Medicine 33, no. 1 (2014): 77-82. https://doi.org/10.3892/ijmm.2013.1559
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team