Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
2014-March Volume 33 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
2014-March Volume 33 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Positive feedback regulation between Akt phosphorylation and fatty acid synthase expression in osteosarcoma

  • Authors:
    • Heng Wang
    • Qing Feng Luo
    • Ai Fen Peng
    • Xin Hua Long
    • Tao Fang Wang
    • Zhi Li Liu
    • Guo Mei Zhang
    • Rong Ping Zhou
    • Song Gao
    • Yang Zhou
    • Wen Zhao Chen
  • View Affiliations / Copyright

    Affiliations: Department of Orthopedics, First Affiliated Hospital of Nanchang University, Nanchang, Jiangxi, P.R. China, Department of Pathology, Cancer Hospital of Jiangxi Province, Nanchang, Jiangxi, P.R. China, Jiangxi University of Traditional Chinese Medicine, Nanchang, Jiangxi, P.R. China, Department of Orthopedics, Second Affiliated Hospital of Nanchang University, Nanchang, Jiangxi, P.R. China
  • Pages: 633-639
    |
    Published online on: December 23, 2013
       https://doi.org/10.3892/ijmm.2013.1602
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The activation of PI3K/Akt and the overexpression of fatty acid synthase (FASN) are frequently observed in human osteosarcoma (OS). In the present study, in order to investigate the possible association between the phosphorylation of Akt and FASN expression, immunohistochemical staining was conducted on 24 OS specimens from patients with pulmonary metastasis, which revealed a significant positive correlation between phosphorylated Akt (p-Akt) and the expression of FASN (R=0.469, P=0.04). To investigate the association between p-Akt and FASN in vitro, human U2-OS OS cells were treated with FASN-specific RNAi plasmid or LY294002 (an inhibitor of PI3k/Akt). The mRNA levels of Akt and FASN were measured by real-time PCR. Western blot analysis was also performed to detect the protein experession of PI3K, Akt, p-Akt and FASN. The results demonstrated that the PI3K/Akt signaling pathway modulates FASN expression; the inhibition of FASN resulted in the downregulation of p-Akt in the U2-OS cells. Furthermore, the effects induced by the inhibition of the activity of p-Akt or FASN on the malignant phenotype of U2-OS cells were investigated, demonstrating that the malignant phenotype was inhibited by suppressing the activity of PI3K/Akt or FASN in the U2-OS cells. The findings from our study suggest the existence of a positive feedback regulation between Akt phosphorylation and FASN expression and that this loop may play an important role in the malignant phenotype of OS cells.

Introduction

Osteosarcoma (OS) is one of the most common primary malignant bone tumors in children and adolescents. Following the advent of effective chemotherapy, the five-year survival rate for patients with OS treated with intensive multidrug chemotherapy and aggressive local control has been reported to be 55–80% (1–3). However, numerous studies have reported that the five-year survival rate of patients with metastatic diseases is <20% (4–6). The development of lung metastasis is the main cause of mortatlity in patients with OS. The identification and understanding of the molecular mechanisms responsible for metastasis would pose a significant impact on the management of OS.

Fatty acid synthase (FASN) is an enzyme which is considered crucial for endogenous lipogenesis in mammals, and is responsible for catalyzing the synthesis of long-chain fatty acids. In the majority of normal cells, FASN expression is usually not observed, due to the presence of abundant amounts of dietary lipids (7). However, FASN is overexpressed in a variety of human tumors (8–12), and has been strongly linked to cancer cell proliferation and apoptosis (13–16). We previously demonstrated that FASN may contribute to the metastasis of OS cells (17,18). However, its potential molecular mechanisms of action remain unclear.

PI3K/Akt plays a crucial role in the cell-extracellar matrix (ECM) and cell-cell adhesion. Due to lack of correct adhesion, the adhesion-dependent signals are interrupted, resulting in adhesion-related apoptosis, namely anoikis. PI3K/Akt signaling has been implicated in the regulation of FASN expression in breast cancer and prostate cancer cells (19,20). Wang et al reported that there was a positive feedback regulation between Akt phosphorylation and FASN expression in ovarian carcinoma cells (21). However, to our knowledge, the association between the phosphorylation of Akt and FASN protein expression in OS has not yet been documented.

In this study, we found that the inhibition of Akt phosphorylation by LY294002 (an inhibitor of PI3k/Akt), resulted in the downregulation of FASN expression. In addition, the downregulation of FASN expression inhibited Akt phosphorylation. Based on these findings, we confirmed the existence of a positive feedback loop between Akt phosphorylation and FASN expression; this feedback loop may play an important role in the malignant phenotype of OS cells.

Materials and methods

Patient specimens

A total of 24 samples of OS tissues were obtained from patients with pulmonary metastatic disease who underwent surgery in our hospital (The First Hospital Affiliated to Nanchang University, Nanchang, China) from 2005 to 2012. The pulmonary metastasis survey was performed with plain films and chest CT scans at first diagnosis. All the patients had no history of prior treatment with anticancer drugs or radiotherapy. The samples were fixed with 10% formalin and embedded in paraffin and were then cut into 4-μm-thick sections. In all cases, informed consent was obtained from the relative departments and persons, and the study had the approval of the Ethics Committee of Nanchang University.

Immunohistochemistry

Immunohistochemical (S-P) staining with and hematoxylin and eosin (H&E) was performed on the paraffin-embedded tissue sections. Antigen retrieval was performed by heating the sections in 10 mmol/l citrate buffer (pH 6.0) for 20 min. FASN and phosphorylated Akt (p-Akt) antibodies (rabbit monoclonal antibody; antibody dilutions, 1:50; Epitomics, Inc., Burlingame, CA, USA) were used as the primary antibody at a final dilution as corresponding product specifications. The sections were then stained with diaminobenzidine (DAB) and counterstained using hematoxylin. The stained sections were evaluated and scored by two pathologists in a blinded manner without prior knowledge of the clinical pathological characteristics of the patients. According to the staining intensity by examining at least 500 cells in five representative areas, the expression level of p-Akt and FASN was measured and the intensity scores were recorded as follows: none, 0; weak, 1; moderate, 2; and intense, 3. According to the percentage of cancer cells with a positive expression of Akt and FASN, the percentage scores were recorded as follows: 0% (score 0); <10% (score 1); 10–49% (score 2); 50–79% (score 3); and 80–100% (score 4). The final score was averaged with the scores from the two pathologists; these scores were calculated by multiplying the intensity score by the percentage score. The sections with a final score of <4 were considered as negative (−), those with a score of 4–5 were considered as postivie (+), those with a score of 6–8 as double positive (++), and those with a score of 9–12 were considered as triple positive (+++).

Cell culture and transfection

The human OS cell line, U2-OS, was purchased from the American Type Culture Collection (ATCC; Manassas, VA, USA), and the cells were routinely cultured in RPMI-1640 medium (HyClone, Logan, UT, USA) supplemented with 10% fetal bovine serum (FBS) (Sigma, Lenexa, KS, USA) in a humidified 37°C incubator containing 5% CO2. The U2-OS cells were seeded in 6-well plates till 40% confluence on the day prior to transfection. The U2-OS cells were transfected with FASN-specific RNAi plasmid (MR-FASN) and the negative control RNAi plasmid (MR-Neg) using Lipofectamine 2000 according to the instructions of the manufacturer (Invitrogen Life Technologies (Carlsbad, CA, USA).

Real-time PCR

Semi-quantitive (real-time) PCR was used to detect the FASN mRNA expression levels. Total RNA was extracted from the cells using TRIzol reagent (Invitrogen Life Technologies). The total RNA concentration was determined by spectrophotometry at 260 nm and the purity was determined by calculating the 260/280 ratio with a BioPhotometer (Eppendorf, Hamburg, Germany). The two-step kit (Promega Corp., Madison, WI, USA) was used to to obtain cDNA according to the manufacturer’s instructions, which was then used as the template for amplification. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal standard. The gene primer sequences are listed in Table I. The cycling conditions were as follows: initial denaturation at 94°C for 3 min, followed by 35 amplification cycles of 94°C for 30 sec, 55°C for 30 sec and 72°C for 12 sec. Each real-time PCR assay contained 2 μl cDNA template, 10 μl SuperMix and 0.5 μl of every forward and reverse primer in a 20 μl reaction mixture. All experiments were repeated six times over multiple days.

Table I

Primer sequences of genes used in real-time PCR.

Table I

Primer sequences of genes used in real-time PCR.

Gene (size, bp)Primer sequence (5′→3′)
FASN (171)F AACTCCATGTTTGGTGTTTG
R CACATGCGGTTTAATTGTG
Akt (198)F TGCCACCATGAATGAGGTGAAT
R GCGTATGACAAAGGTGTTGGG
GAPDH (199)F CAGGGCTGCTTTTAACTCTGGT
R GATTTTGGAGGGATCTCGCT

[i] FASN, fatty acid synthase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; F, forward, R, reverse.

Western blot analysis of protein expression

Total protein from the cells was extracted using RIPA lysis buffer containing 60 μg/ml phenylmethylsulfonyl fluoride (PMSF). The protein concentrations were determined using the BCA protein assay kit (Boster Biotechnology Co., Wuhan, China). The protein samples were denatured at 100°C for 10 min and then preserved at −20°C for later use. The proteins were separated by SDS-polyacrylamide gel electrophoresis and transblotted onto PVDF membranes. The PVDF membranes were probed first with primary antibodies PI3K, Akt and p-Akt (Ser473) antibody (1:1,000 dilution), FASN antibody (1:500 dilution) (both from Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA)and β-actin antibody (1:2,000; Cell Signaling Technology, Inc., Danvers, MA, USA) overnight at 4°C. Following incubation with the appropriate anti-rabbit or anti-mouse horseradish peroxidase-conjugated secondary antibody (1:5,000; Boster Biotechnology Co.) for 1.5 h at room temperature, immunoreactive bands were visualized by chemiluminescence dissolvent (Thermo Scientific, Rockford, IL, USA) and exposured to X-ray film (Kodak, Rochester, NY, USA). The determination of the grayscale value was processed using ImageJ sofware. All experiments were repeated six times over multiple days.

Cell proliferation assay

Cells (4×103/200 μl/well) were seeded in 96-well plates. Viable proliferating cells were detected by 3-(4,-dimethy-lthiazol-2-yl)-2,-diphenyl-tetrazoliumbromide (MTT) assay at various time periods (24, 48 and 72 h), using five wells per time period. Cell viability was expressed as the optical density (OD), which was detected by an enzyme-linked immunoabsorbent assay reader (MK3; Thermo Scientific) at a 490-nm wavelength. All experiments were repeated six times over multiple days.

Analysis of cell apoptosis

Cells (5×105) were harvested, washed with PBS and resuspended in binding buffer, followed by mixing with Annexin V-FITC and propidium iodide (both from KeyGen Biotech. Co., Ltd., Nanjing, China). The cells were analyzed by a BD FACSCalibur flow cytometer (BD Biosciences, San Jose, CA, USA). All experiments were repeated six times over multiple days.

Transwell invasion assays

Cell invasion was measured in 24-well plates by Transwell assay using a chamber containing the polyethylene terephthalate filter membrane with 8-μm pores (BD Biosciences). The cells (6×104/200 μl/chamber) were seeded in the upper chamber with RPMI-1640 medium containing 10 g/l BSA, and the lower well was filled with 500 μl RPMI-1640 medium supplemented with 10% FBS as a chemoattractant. Following incubation for 24 h, the chambers were stained with crystal violet. The invaded cells were counted from ten randomly selected fields under an inverted microscope. All experiments were repeated six times over multiple days.

Wound healing assays

Cell migration was assessed by determining the ability of the cells to move into a cellular space in a two-dimensional in vitro ‘wound healing assay’. In brief, the cells were grown to confluence in 6-well tissue culture plastic dishes to a density of 5×106 cells/well. The cells were denuded by dragging a rubber policeman (Fisher Scientific, Hampton, NH, USA) through the center of the plate. The cultures were rinsed with PBS and replaced with fresh DMEM alone or containing 10% FBS, following which the cells were incubated at 37°C for 24 h. Images were captured at 0 and 24 h and the migrated distance was measured using ImageJ software (NIH, Bethesda, MD, USA). All experiments were repeated six times over multiple days.

Statistical analysis

Statistical comparisons were performed using SPSS software version 13.0 (SPSS Inc., Chicago, IL, USA). The correlation of FASN with p-Akt protein in the OS tissues was evaluated using the Wilcoxon rank sum test. All measurement data are presented as the means ± SD, and the one-way ANOVA with a post-hoc test (Student-Newman-Keuls test) was performed for statistical analysis. A P-value <0.05 was considered to indicate a statistically significant difference.

Results

Correlation between FASN and p-Akt protein expression in OS

To explore the possible association between FASN expression and the phosphorylation of Akt in OS, FASN and p-Akt (Ser473) protein expression in the OS tissues from patients with pulmonary metastatic disease was detected. The results revealed that FASN protein was expressed in the cytoplasm of the OS tissues, and the p-Akt protein was expressed in the nucleus and cytoplasm (Fig. 1A–C). There was a significant positive relationship between FASN and p-Akt expression (R=0.469, P=0.04). These data suggest that a possible connection between FASN expression and the phosphorylation of Akt exists in OS.

Figure 1

Immunohistochemical staining used to examine fatty acid synthase (FASN) and phosphorylated Akt (p-Akt) (Ser473) expression. (A) Hematoxylin and eosin (H&E) staining in osteosarcoma (OS) tissues from patients with pulmonary metastasis (x400). (B) FASN protein is shown as brownish-yellow particle deposition and is expressed in the cytoplasm. (C) p-AKT is shown as brownish-yellow particle deposition and is expressed in the cytoplasm and nucleus.

Inhibiting the phosphorylation of Akt suppresses the malignant phenotype of U2-OS cells

To determine the effects of the inhibition of Akt phosphorylation on the malignant phenotype of OS cells, the U2-OS cells were treated with LY294002 (an inhibitor of PI3k/Akt) at various concentrations (0, 5, 10, 20, 40, 80 and 160 μM) for 24, 48 and 72 h. Cell proliferation and apoptosis were assessed by MTT and FACS assays, respectively. The migration and invasion abitility of the cells was investigated using wound healing and Transwell assays, respectively. In the MTT assays, the results revealed that LY294002 induced U2-OS cell apoptosis and inhibited cell growth in a dose- and time-dependent manner (Fig. 2A) and the IC50 was 47.96 μM for 24 h. The concentration of 40 μM was selected for further experiments. Furthermore, in FACS assays, the results revealed that LY294002 induced U2-OS cell apoptosis in a dose- and time-dependent manner (Fig. 2B and C). In the the wound healing assay, the migration rate of the cells treated with 40 μM LY294002 was significantly lower than that of the control (untreated) cells (P<0.05) (Fig. 3). The percentage of invading cells in the group treated with the p-Akt inhibitor (LY294002) was 36.1±5.0%, compared with 89.1±6.4% in the control group (P<0.05) (Fig. 4).

Figure 2

Inhibition of Akt phosphorylation induces apoptosis and inhibits the growth of U2-OS cell. (A) The U2-OS cells were treated with LY294002 (an inhibitor of PI3K/Akt) at different concentrations for 24, 48 and 72 h. LY294002 inhibited U2-OS cell proliferation in a dose- and time-dependent manner. (B and C) FACS analysis of U2-OS cells treated with LY294002 at different concentrations for 24 h. LY294002 induced U2-OS cell apoptosis in a dose-dependent manner.

Figure 3

(A) Wound healing assay was performed to determine the effects of the downregulation of fatty acid synthase (FASN) or the inhibition of Akt phosphorylation on U2-OS cell migration. (B) Bars represent the means + SD (n=6); *,**P<0.05 vs. control group (MR-Neg).

Figure 4

(A) Transwell invasion assay to evaluate the effects of the downregulation of fatty acid synthase (FASN) or the inhibition of Akt phosphorylation on U2-OS cell invasion. (B) Bars represent the means + SD (n=6); *,**P<0.05 vs. control group (MR-Neg).

Inhibition FASN suppresses U2-OS cell migration and invasion

In a previous study, we demonstrated that the suppression of FASN expression induces U2-OS cell apoptosis and inhibits cell growth in vivo and in vitro (17). Therefore, in this study, we evaluated the effects of the downregulation FASN on U2-OS cell migration and invasion. The migration and invasion ability of the cells was significantly lower in the cells transfected with the FASN-specific RNAi plasmid than those transfected with the negative RNAi plasmid (P<0.05) (Figs. 3 and 4).

Downregulation of FASN expression inhibits the phosphorylation of Akt

To investigate the effects of silencing FASN on the phosphorylation of Akt in OS, the U2-OS OS cells were transfected with the FASN-specific RNAi plasmid to inhibit FASN expression. The mRNA expression of FASN and Akt was detected by real-time PCR, and western blot analysis was used to measure the protein expression of FASN, PI3K, Akt and p-Akt. The downregulation of FASN inhibited the activation of the PI3K/Akt signaling pathway. However, the mRNA expression of Akt was not affected by the downregulation of FASN in the U2-OS cells (Fig. 5A and B).

Figure 5

(A) Western blot analysis for the detection of the expression of phosphorylated Akt (p-Akt), Akt and fatty acid synthase (FASN) protein. The downregulation of of FASN inhibited Akt phosphorylation, and the inhibition of Akt phosphorylation downregulated FASN protein expression. (B) Real-time PCR was performed to measure the mRNA expression of Akt and FASN. The inhibition of Akt phosphorylation downregulated FASN mRNA expression; however, the downregulation of FASN had no significant inhibitory effect on Akt phosphorylation.

Inhibition of Akt phosphorylation downregulates FASN in U2-OS cells

In order to determine the effects of the inhibition of the phosphorylation of Akt on the mRNA and protein expression of FASN in OS, the U2-OS cells were treated with LY294002 (an inhibitor of PI3K/Akt). The mRNA and protein expression of FASN was measured by RT-PR and western blot analysis, respectively. The results revealed that both the mRNA and protein expression of FASN was decreased by the inhibition of Akt phosphorylation (Fig. 5).

Discussion

Previous studies have demonstrated that cancers with a high expression of FASN always undergo a significant endogenous fatty acid biosynthesis and display a biologically aggressive subset (22,23). Moreover, the overexpression of FASN is an early event in tumor development and is more pronounced in tumors with a poor prognosis (24). Importantly, we previously demonstrated that the inhibition of FASN with pharmacological inhibitors is selectively cytotoxic to human OS cells and leads to a significant antitumor effect (17). Although very little is known about the mechanisms underlying the upregulation of the FAS protein in cancer cells, studies have revealed that FASN is also upregulated at the mRNA level (25,26), and increasing evidence indicates that Akt activity modulates FASN expression in tumor cells (20,27). Previous studies have revealed that activated PI3K stimulates the binding of sterol regulatory element-binding protein (SREBP)-1c, a SREBP family transcription factor, which controls genes involved in lipogenesis to a SREBP-binding site in the FASN promoter, thus inducing FASN transcription (28–30). Of note, the inhibition of FASN activity by either cerulenin or C75 has been shown to inhibit the prodution of p-Akt (19,31). These findings suggest the existence of a positive bidirectional association between p-Akt and FASN expression in cancer cells.

In the current study, we found that there was a positive correlation between p-Akt and FASN protein expression in OS tissues. This indicates that a possible connection between the phosphorylation of Akt and FASN expression may exist. In order to investigate whether the inhibition of the phosphorylation of Akt suppresses FASN expression in OS, LY294002, an inhibitor of PI3k/Akt, was used to downregulate the phosphorylation of Akt in U2-OS cells. The results revealed that the mRNA and protein expression of FASN was markedly inhibited by LY294002, which suggests that p-Akt regulates FASN by affecting the transcription and translation in U2-OS cells.

To determine the effects of the inhibition of FASN on the phosphorylation of Akt in OS cells, the U2-OS cells were transfected with the FASN-specific RNAi plasmid to inhibit FASN expression. We found that the protein expression of both total Akt and p-Akt was decreased in the FASN-silenced U2-OS cells. However, the mRNA expression of Akt did not differ between the cells treated with the FASN-specific RNAi plasmid and those treated with the negative RNAi plasmid. These data suggest that FASN regulates PI3K/Akt at the translational rather than the transcriptional level. However, the mechanism(s) responsible for the inhibition of Akt activity by the downregulation of FASN remain unclear. Currently, several mechanisms are likely to contribute to FASN-mediated p-Akt regulation: i) FASN-mediated lipogenesis produces phospholipids that are incorporated into cell membranes and partition into lipid rafts, which accommodate ErbBs and form signaling platforms. FASN blockade destabilizes these lipid rafts, which triggers the degradation of ErbBs and impedes the membrane recruitment of downstream mediators of Akt, thereby causing the downregulation of p-Akt (32,33); ii) the FASN promoter contains several sterol regulatory element-binding protein-1 (Sp1) sites enabling FASN to activate Akt (34,35).

Recently, a number of studies have demonstrated that FASN and PI3K/Akt play an important role in the proliferation, invasion and migration of cancer cells (36–39). In this study, we observed that the suppression of FASN expression by RNAi or the inhibition of the activity of PI3K/Akt blocked cell proliferation and migration and increased the apoptotic rate in the U2-OS cells. This suggests that FASN and PI3K/Akt play a key role in the maintenance of the malignant phenotype of OS cells.

In conclusion, the data presented in this study, confirm the existence of a positive feedback loop between Akt phosphorylation and FASN expression. Moreover, this feedback loop plays an important role in the malignant phenotype of OS cells. However, the detailed mechanisms of the bidirectional association between FASN expression and the phosphorylation of Akt in OS cells are currently unknown. Thus, further studies are required to provide further clarification.

Acknowledgements

The present study was supported by grants from the National Natural Science Foundation of China (no. 81260400) and the Natural Science Fundation of Jiangxi Province (no. 20114BAB205093).

References

1 

Meyers PA, Schwartz CL, Krailo M, Kleinerman ES, Betcher D, Bernstein ML, et al: Osteosarcoma: a randomized, prospective trial of the addition of ifosfamide and/or muramyl tripeptide to cisplatin, doxorubicin, and high-dose methotrexate. J Clin Oncol. 23:2004–2011. 2005. View Article : Google Scholar : PubMed/NCBI

2 

Bacci G, Forni C, Longhi A, Ferrari S, Mercuri M, Bertoni F, et al: Local recurrence and local control of non-metastatic osteosarcoma of the extremities: a 27-year experience in a single institution. J Surg Oncol. 96:118–123. 2007.PubMed/NCBI

3 

Jawad MU, Cheung MC, Clarke J, Koniaris LG and Scully SP: Osteosarcoma: improvement in survival limited to high-grade patients only. J Cancer Res Clin Oncol. 137:597–607. 2011. View Article : Google Scholar : PubMed/NCBI

4 

Mialou V, Philip T, Kalifa C, Perol D, Gentet JC, Marec-Berard P, et al: Metastatic osteosarcoma at diagnosis: prognostic factors and long-term outcome--the French pediatric experience. Cancer. 04:1100–1109. 2005. View Article : Google Scholar : PubMed/NCBI

5 

Hegyi M, Semsei AF, Jakab Z, Antal I, Kiss J, Szendroi M, et al: Good prognosis of localized osteosarcoma in young patients treated with limb-salvage surgery and chemotherapy. Pediatr Blood Cancer. 57:415–22. 2011. View Article : Google Scholar : PubMed/NCBI

6 

Stokkel MP, Linthorst MF, Borm JJ, Taminiau AH and Pauwels EK: A reassessment of bone scintigraphy and commonly tested pretreatment biochemical parameters in newly diagnosed osteosarcoma. J Cancer Res Clin Oncol. 128:393–399. 2002. View Article : Google Scholar

7 

Kuhajda FP: Fatty acid synthase and cancer: new application of an old pathway. Cancer Res. 66:5977–5980. 2006. View Article : Google Scholar : PubMed/NCBI

8 

Alo PL, Amini M, Piro F, Pizzuti L, Sebastiani V, Botti C, et al: Immunohistochemical expression and prognostic significance of fatty acid synthase in pancreatic carcinoma. Anticancer Res. 27:2523–2527. 2007.PubMed/NCBI

9 

Walter K, Hong SM, Nyhan S, Canto M, Fedarko N, Klein A, et al: Serum fatty acid synthase as a marker of pancreatic neoplasia. Cancer Epidemiol Biomarkers Prev. 18:2380–2385. 2009. View Article : Google Scholar : PubMed/NCBI

10 

Okawa Y, Hideshima T, Ikeda H, Raje N, Vallet S, Kiziltepe T, et al: Fatty acid synthase is a novel therapeutic target in multiple myeloma. Br J Haemato. 141:659–671. 2008. View Article : Google Scholar

11 

Migita T, Ruiz S, Fornari A, Fiorentino M, Priolo C, Zadra G, et al: Fatty acid synthase: a metabolic enzyme and candidate oncogene in prostate cancer. J Natl Cancer Inst. 101:519–532. 2009. View Article : Google Scholar : PubMed/NCBI

12 

Silva SD, Cunha IW, Younes RN, Soares FA, Kowalski LP and Graner E: ErbB receptors and fatty acid synthase expression in aggressive head and neck squamous cell carcinomas. Oral Dis. 16:774–780. 2010. View Article : Google Scholar : PubMed/NCBI

13 

Saati GE and Archer MC: Inhibition of fatty acid synthase and Sp1 expression by 3,3′-diindolylmethane in human breast cancer cells. Nutr Cancer. 63:790–794. 2011.

14 

Notarnicola M, Pisanti S, Tutino V, Bocale D, Rotelli MT, Gentile A, et al: Effects of olive oil polyphenols on fatty acid synthase gene expression and activity in human colorectal cancer cells. Genes Nutr. 6:63–69. 2011. View Article : Google Scholar : PubMed/NCBI

15 

Notarnicola M, Messa C, Refolo MG, Tutino V, Miccolis A and Caruso MG: Polyunsaturated fatty acids reduce fatty acid synthase and hydroxy-methyl-glutaryl CoA-reductase gene expression and promote apoptosis in HepG2 cell line. Lipids Health Dis. 10:102011. View Article : Google Scholar : PubMed/NCBI

16 

Zecchin KG, Rossato FA, Raposo HF, Melo DR, Alberici LC, Oliveira HC, et al: Inhibition of fatty acid synthase in melanoma cells activates the intrinsic pathway of apoptosis. Lab Invest. 91:232–240. 2011. View Article : Google Scholar : PubMed/NCBI

17 

Long XH, Mao JH, Peng AF, Zhou Y, Huang SH and Liu ZL: Tumor suppressive microRNA-424 inhibits osteosarcoma cell migration and invasion via targeting fatty acid synthase. Exp Ther Med. 5:1048–1052. 2013.PubMed/NCBI

18 

Liu ZL, Wang G, Peng AF, Luo QF, Zhou Y and Huang SH: Fatty acid synthase expression in osteosarcoma and its correlation with pulmonary metastasis. Oncol Lett. 4:878–882. 2012.PubMed/NCBI

19 

Liu X, Shi Y, Giranda VL and Luo Y: Inhibition of the phosphatidylinositol 3-kinase/Akt pathway sensitizes MDA-MB468 human breast cancer cells to cerulenin-induced apoptosis. Mol Cancer Ther. 5:494–501. 2006. View Article : Google Scholar : PubMed/NCBI

20 

Van de Sande T, De Schrijver E, Heyns W, Verhoeven G and Swinnen JV: Role of the phosphatidylinositol 3′-kinase/PTEN/Akt kinase pathway in the overexpression of fatty acid synthase in LNCaP prostate cancer cells. Cancer Res. 62:642–646. 2002.

21 

Wang HQ, Altomare DA, Skele KL, Poulikakos PI, Kuhajda FP, Di Cristofano A, et al: Positive feedback regulation between AKT activation and fatty acid synthase expression in ovarian carcinoma cells. Oncogene. 24:3574–3582. 2005. View Article : Google Scholar : PubMed/NCBI

22 

Menendez JA and Lupu R: Fatty acid synthase-catalyzed de novo fatty acid biosynthesis: from anabolic-energy-storage pathway in normal tissues to jack-of-all-trades in cancer cells. Arch Immunol Ther Exp (Warsz). 52:414–426. 2004.

23 

Menendez JA, Ropero S, Mehmi I, Atlas E, Colomer R and Lupu R: Overexpression and hyperactivity of breast cancer-associated fatty acid synthase (oncogenic antigen-519) is insensitive to normal arachidonic fatty acid-induced suppression in lipogenic tissues but it is selectively inhibited by tumoricidal α-linolenic and gamma-linolenic fatty acids: A novel mechanism by which dietary fat can alter mammary tumorigenesis. Int J Oncol. 24:1369–1383. 2004.PubMed/NCBI

24 

Porter D, Lahti-Domenici J, Keshaviah A, Bae YK, Argani P, Marks J, et al: Molecular markers in ductal carcinoma in situ of the breast. Mol Cancer Res. 362–375. 2003.PubMed/NCBI

25 

Swinnen JV, Vanderhoydonc F, Elgamal AA, Eelen M, Vercaeren I, Joniau S, et al: Selective activation of the fatty acid synthesis pathway in human prostate cancer. Int J Cancer. 88:176–179. 2000. View Article : Google Scholar : PubMed/NCBI

26 

Milgraum LZ, Witters LA, Pasternack GR and Kuhajda FP: Enzymes of the fatty acid synthesis pathway are highly expressed in in situ breast carcinoma. Clin Cancer Res. 3:2115–2120. 1997.PubMed/NCBI

27 

Yeh CW, Chen WJ, Chiang CT, Lin-Shiau SY and Lin JK: Suppression of fatty acid synthase in MCF-7 breast cancer cells by tea and tea polyphenols: a possible mechanism for their hypolipidemic effects. Pharmacogenomics J. 3:267–276. 2003.PubMed/NCBI

28 

Bandyopadhyay S, Pai SK, Watabe M, Gross SC, Hirota S, Hosobe S, et al: FAS expression inversely correlates with PTEN level in prostate cancer and a PI 3-kinase inhibitor synergizes with FAS siRNA to induce apoptosis. Oncogene. 24:5389–5395. 2005. View Article : Google Scholar : PubMed/NCBI

29 

Swinnen JV, Heemers H, Deboel L, Foufelle F, Heyns W and Verhoeven G: Stimulation of tumor-associated fatty acid synthase expression by growth factor activation of the sterol regulatory element-binding protein pathway. Oncogene. 19:5173–81. 2000. View Article : Google Scholar

30 

Yang Y, Morin PJ, Han WF, Chen T, Bornman DM, Gabrielson EW and Pizer ES: Regulation of fatty acid synthase expression in breast cancer by sterol regulatory element binding protein-1c. Exp Cell Res. 282:132–137. 2003. View Article : Google Scholar : PubMed/NCBI

31 

Alli PM, Pinn ML, Jaffee EM, McFadden JM and Kuhajda FP: Fatty acid synthase inhibitors are chemopreventive for mammary cancer in neu-N transgenic mice. Oncogene. 24:39–46. 2005. View Article : Google Scholar : PubMed/NCBI

32 

Scheid MP, Marignani PA and Woodgett JR: Multiple phosphoinositide 3-kinase-dependent steps in activation of protein kinase B. Mol Cell Biol. 22:6247–6260. 2002. View Article : Google Scholar : PubMed/NCBI

33 

Li N, Lu H, Chen C, Bu X and Huang P: Loss of fatty acid synthase inhibits the ‘HER2-PI3K/Akt axis’ activity and malignant phenotype of Caco-2 cells. Lipids Health Dis. 12:832013.

34 

Jin HO, An S, Lee HC, Woo SH, Seo SK, Choe TB, et al: Hypoxic condition- and high cell density-induced expression of Redd1 is regulated by activation of hypoxia-inducible factor-1alpha and Sp1 through the phosphatidylinositol 3-kinase/Akt signaling pathway. Cell Signal. 19:1393–1403. 2007. View Article : Google Scholar : PubMed/NCBI

35 

Roder K, Wolf SS, Larkin KJ and Schweizer M: Interaction between the two ubiquitously expressed transcription factors NF-Y and Sp1. Gene. 234:61–69. 1999. View Article : Google Scholar : PubMed/NCBI

36 

Deepa PR, Vandhana S and Krishnakumar S: Fatty acid synthase inhibition induces differential expression of genes involved in apoptosis and cell proliferation in ocular cancer cells. Nutr Cancer. 65:311–316. 2013. View Article : Google Scholar : PubMed/NCBI

37 

Rahman MT, Nakayama K, Ishikawa M, Rahman M, Katagiri H, Katagiri A, et al: Fatty acid synthase is a potential therapeutic target in estrogen receptor-/progesterone receptor-positive endometrioid endometrial cancer. Oncology. 84:166–173. 2013. View Article : Google Scholar

38 

Zhou JD, Shen F, Ji JS, Zheng K, Huang M and Wu JC: FAM9C plays an anti-apoptotic role through activation of the PI3K/Akt pathway in human hepatocellular carcinoma. Oncol Rep. 2013. View Article : Google Scholar

39 

Yothaisong S, Dokduang H, Techasen A, Namwat N, Yongvanit P, Bhudhisawasdi V, et al: Increased activation of PI3K/AKT signaling pathway is associated with cholangiocarcinoma metastasis and PI3K/mTOR inhibition presents a possible therapeutic strategy. Tumour Biol. 34:3637–3648. 2013. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang H, Luo QF, Peng AF, Long XH, Wang TF, Liu ZL, Zhang GM, Zhou RP, Gao S, Zhou Y, Zhou Y, et al: Positive feedback regulation between Akt phosphorylation and fatty acid synthase expression in osteosarcoma. Int J Mol Med 33: 633-639, 2014.
APA
Wang, H., Luo, Q.F., Peng, A.F., Long, X.H., Wang, T.F., Liu, Z.L. ... Chen, W.Z. (2014). Positive feedback regulation between Akt phosphorylation and fatty acid synthase expression in osteosarcoma. International Journal of Molecular Medicine, 33, 633-639. https://doi.org/10.3892/ijmm.2013.1602
MLA
Wang, H., Luo, Q. F., Peng, A. F., Long, X. H., Wang, T. F., Liu, Z. L., Zhang, G. M., Zhou, R. P., Gao, S., Zhou, Y., Chen, W. Z."Positive feedback regulation between Akt phosphorylation and fatty acid synthase expression in osteosarcoma". International Journal of Molecular Medicine 33.3 (2014): 633-639.
Chicago
Wang, H., Luo, Q. F., Peng, A. F., Long, X. H., Wang, T. F., Liu, Z. L., Zhang, G. M., Zhou, R. P., Gao, S., Zhou, Y., Chen, W. Z."Positive feedback regulation between Akt phosphorylation and fatty acid synthase expression in osteosarcoma". International Journal of Molecular Medicine 33, no. 3 (2014): 633-639. https://doi.org/10.3892/ijmm.2013.1602
Copy and paste a formatted citation
x
Spandidos Publications style
Wang H, Luo QF, Peng AF, Long XH, Wang TF, Liu ZL, Zhang GM, Zhou RP, Gao S, Zhou Y, Zhou Y, et al: Positive feedback regulation between Akt phosphorylation and fatty acid synthase expression in osteosarcoma. Int J Mol Med 33: 633-639, 2014.
APA
Wang, H., Luo, Q.F., Peng, A.F., Long, X.H., Wang, T.F., Liu, Z.L. ... Chen, W.Z. (2014). Positive feedback regulation between Akt phosphorylation and fatty acid synthase expression in osteosarcoma. International Journal of Molecular Medicine, 33, 633-639. https://doi.org/10.3892/ijmm.2013.1602
MLA
Wang, H., Luo, Q. F., Peng, A. F., Long, X. H., Wang, T. F., Liu, Z. L., Zhang, G. M., Zhou, R. P., Gao, S., Zhou, Y., Chen, W. Z."Positive feedback regulation between Akt phosphorylation and fatty acid synthase expression in osteosarcoma". International Journal of Molecular Medicine 33.3 (2014): 633-639.
Chicago
Wang, H., Luo, Q. F., Peng, A. F., Long, X. H., Wang, T. F., Liu, Z. L., Zhang, G. M., Zhou, R. P., Gao, S., Zhou, Y., Chen, W. Z."Positive feedback regulation between Akt phosphorylation and fatty acid synthase expression in osteosarcoma". International Journal of Molecular Medicine 33, no. 3 (2014): 633-639. https://doi.org/10.3892/ijmm.2013.1602
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team