Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
July-2014 Volume 34 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2014 Volume 34 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Apyrase protects against allergic airway inflammation by decreasing the chemotactic migration of dendritic cells in mice

  • Authors:
    • Ping Li
    • Jie Cao
    • Yifei Chen
    • Wei Wang
    • Jiong Yang
  • View Affiliations / Copyright

    Affiliations: Department of Pneumology, Zhongnan Hospital of Wuhan University, Wuhan, Hubei 430071, P.R. China
  • Pages: 269-275
    |
    Published online on: May 6, 2014
       https://doi.org/10.3892/ijmm.2014.1771
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Recent studies have demonstrated that extracellular adenosine 5'-triphosphate (eATP) is involved in allergic airway inflammation by activating purinergic receptors. eATP can be hydrolyzed by ectonucleotidases, such as CD39. In this study, we investigated the expression and distribution of CD39 in the lungs of mice, as well as the effects of apyrase on airway inflammation and the chemotactic migration of dendritic cells (DCs). A mouse model of asthma was developed with chicken ovalbumin (OVA)/aluminum hydroxide using female C57BL/6 mice. Apyrase was administered to OVA-sensitized mice prior to each challenge by intraperitoneal injection. The distribution of CD39 was detected by immunofluorescence. The mRNA and protein expression of CD39 was determined by quantitative PCR and western blot analysis, respectively. The levels of Th2 cytokines in the bronchoalveolar lavage fluid (BALF) were measured by enzyme-linked immunosorbent assay (ELISA). The effect of apyrase on the chemotactic migration of DCs towards ATP was explored by migration assay in vitro. In the lungs, CD39 was primarily located in the cytoplasm and cytomembrane of bronchial epithelial cells and CD39 expression was reduced in mice with allergic asthma. Treatment with apyrase markedly attenuated OVA-induced airway inflammation, including peribronchial eosinophilic inflammation and reduced the number of inflammatory cells, as well as the levels of cytokines in BALF. Furthermore, apyrase also markedly reduced the expression of GATA binding protein 3 (GATA3) and decreased the chemotactic migration of DCs towards ATP.Our data demonstrate that a reduction in CD39 expression may be associated with the development of allergic airway inflammation and that apyrase alleviates airway inflammation by decreasing the chemotactic migration of DCs towards eATP. Therefore, targeting at eATP or ectonucleotidases may provide a novel therapeutic approach for allergic asthma.

Introduction

Asthma is a chronic inflammatory disorder of the airways and is characterized by airway inflammation, airway hyperresponsiveness (AHR) to non-specific stimuli, as well as airway remodeling. Th2 cells are classically thought to drive the development of asthma through the release of Th2 cytokines, which are indispensable for the synthesis of immunoglobulin E (IgE), mucus production and AHR (1–3). In addition to Th2 cell-mediated adaptive immune response, asthma is strongly influenced by the innate immune responses from airway cells, such as epithelial cells, mast cells, natural killer T cells and dendritic cells (DCs) (4,5).

Adenosine 5′-triphosphate (ATP), as an endogenous danger signal, has unique features. It is found at high concentrations in the intracellular cytoplasm, at low levels in the extracellular or pericellular space in healthy tissue, is rapidly released upon cell damage and is inactivated by the powerful ubiquitous ectonucleoside triphosphate diphosphohydrolase (E-NTPDase) (6,7). Extracellular ATP (eATP) and other nucleotides [e.g., adenosine diphosphate (ADP), uridine 5′-triphosphate (UTP) and uridine diphosphate (UDP)] exert their effects by binding to purinergic P2-receptors (P2R), which can be subdivided into 2 families: the G-protein-coupled P2YR and the ligand-gated ion channel, P2XR. Both P2XR and P2YR are present in the lungs. Recent studies have indicated that eATP contributes to the pathogenesis of asthma through purinergic receptors, such as P2Y2, P2Y4, P2Y6 and P2X7 receptors (8–11).

However, purinergic signaling pathways are regulated by CD39/E-NTPDase1. CD39 belongs to the E-NTPDase family and is also known as E-NTPDase1. CD39 is primarily expressed on vascular endothelial cells and immune cells and hydrolyzes extracellular ATP and ADP to adenosine monophosphate (AMP). As ATP is typically a pro-inflammatory mediator and AMP is rapidly converted to the anti-inflammatory metabolite, adenosine, by ecto-5′-nucleotidase (also known as CD73), CD39 tends to promote an anti-inflammatory and immune suppressive milieu (7,12). Compelling studies have demonstrated the important roles of CD39 in the immunoregulatory function (13–17).

Given that extracellular nucleotides play important roles in the pathogenesis of asthma, little is known about the role of associated ectonucleotidases, such as CD39 in allergic asthma. Thereby, we hypothesized that CD39 expression is abnormal in allergic asthma and that the exogenous supplementation of apyrase may attenuate allergic airway inflammation. To confirm these assumptions, we first analyzed CD39 expression levels in the lungs of asthmatic mice. Second, airway inflammation was evaluated in ovalbumin (OVA)-sensitized mice treated with apyrase prior to each OVA challenge. Third, the expression of GATA binding protein (GATA3), which controls Th2 cell differentiation, was measured. Finally, we attempted to explore whether apyrase affects the chemotactic migration of DCs towards eATP.

Materials and methods

Animals

Female 6- to 8-week old C57BL/6 mice were obtained from the Center for Animal Experiment of Wuhan University (Wuhan, China) and maintained in the Animal Biosafety Level 3 Laboratory of the university. All animals were bred at the animal facilities under specific pathogen-free conditions. Animal experiments were conducted under the approval of the Institutional Animal Care and Use Committee of Wuhan University.

Murine model of allergic asthma

The mice were immunized intraperitoneally with 20 μg OVA (Sigma-Aldrich, St. Louis, MO, USA) adsorbed to 2 mg aluminum hydroxide (Thermo Fisher Scientific Inc., Rockford, IL, USA) in 200 μl PBS on days 0 and 14 and challenged with 100 μg OVA in 50 μl PBS by intranasal (i.n.) administration for over 3 consecutive days (days 25–27). Age- and gender-matched control mice were treated in the same manner with PBS as a substitute for OVA. Apyrase (diluted with PBS, 0.2 IU/g body weight; Sigma-Aldrich) or PBS was intraperitoneally administered to the OVA-sensitized mice prior to each OVA challenge.

Histological analysis and immunofluorescence

At 48 h after the final challenge, the mice were sacrificed and the left lungs were excised. The lungs were fixed in 4% paraformaldehyde (PFA) buffer, dehydrated, embedded and sectioned. Paraffin-embedded 5-μm sections were stained with hematoxylin and eosin (H&E) to evaluate airway inflammation and periodic acid-Schiff (PAS) to evaluate goblet cell hyperplasia and mucus secretion. A total of 4–5 sections were evaluated per lung under a magnification of ×200. The inflammation degree of peribronchial and perivascular regions was assessed on a subjective scale of 0–3, as previously described (18). A value of 0 was regarded as undetectable inflammation, a value of 1 as occasional cuffing with inflammatory cells, a value of 2 as bronchi or vessels surrounded by a thin layer of inflammatory cells (1–5 layer cells), and a value of 3 was regarded as bronchi or vessels surrounded by a thick layer of inflammatory cells (>5 layers of cells).

The location of CD39 in the lungs obtained from the mice was detected by immunofluorescence. Briefly, 5-μm-thick sections were incubated with a rabbit anti-mouse CD39 antibody (Santa Cruz Biotechnology, Inc., Dallas, TX, USA) overnight at 4°C. For detection, Rhodamine-labeled goat anti-rabbit secondary antibody (Santa Cruz Biotechnology, Inc.) was used. The nuclei were stained with 4,6-diamidino-2-phenylindole dihydrochloride hydrate (DAPI; Sigma-Aldrich).

Collection of cells and supernatants in the bronchoalveolar lavage fluid (BALF)

At 48 h after the final challenge, the mice were sacrificed and bronchoalveolar lavage was performed 3 times with 0.5-ml aliquots of PBS containing 1 mM sodium EDTA. Cells in the BALF were collected by centrifugation and were counted with a hemocytometer. Smears of cells were prepared by cytospin and stained with Wright-Giemsa in order to differentiate the inflammatory cells (eosinophils, neutrophils and lymphocytes). Approximately 400 cells were counted in each random location. The supernatants in the BALF were collected and stored at −70°C until use.

RNA extraction and quantitative PCR (qPCR)

The right upper lung lobes were measured for gene transcript levels. Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and cDNA was synthesized using ReverTra Ace qPCR RT Master Mix (Toyobo, Tokyo, Japan) according to the manufacturer’s instructions. qPCR was conducted in triplicate using SYBR Premix Ex Taq™ (Takara Bio, Inc., Otsu, Japan). The primer sequences are presented in Table I. The thermal cycling conditions were as follows: denaturation at 95°C for 1 min, followed by 40 cycles of denaturation at 95°C for 10 sec, annealing at 61°C for 10 sec and extension at 72°C for 10 sec. The data were normalized to the internal reference gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The relative expression of the target gene was calculated using the comparative 2−ΔΔCt method.

Table I

Primer sequences and product sizes.

Table I

Primer sequences and product sizes.

Gene namePrimer sequences (5′→3′)Product size (bp)
CD39/ENTPD-1
 Sense CATCCAAGCATCACCAGACT154
 AntisenseATGAT CTTGGCACCCTGGAA
GATA3
 Sense AGGGACATCCTGCGCGAACTGT166
 Antisense CATCTTCCGGTTTCGGGTCTGG
GAPDH
 Sense TGTGTCCGTCGTGGATCTGA150
 Antisense TTGCTGTTGAAGTCGCAGGAG

[i] CD39/ENTPD-1, ectonucleoside triphosphate diphosphohydrolase-1; GATA3, GATA binding protein 3; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Western blot analysis

Protein was extracted from the right median lobes using radioimmunoprecipitation assay (RIPA) lysis buffer (Beyotime Institute of Biotechnology, Haimen, China). Total protein (60 μg) was separated by electrophoresis on SDS-PAGE gels, transferred onto PVDF membranes (Millipore Corp., Billerica, MA, USA), blocked with TBST-containing 5% non-fat dried milk at room temperature for 1 h and probed with rabbit anti-mouse CD39 or GAPDH (1:200, Santa Cruz Biotechnology, Inc.). The membranes were incubated with primary antibody overnight at 4°C and then with horseradish peroxidase (HRP)-conjugated anti-rabbit secondary antibody (1:5,000; Santa Cruz Biotechnology, Inc.) at room temperature for 1 h. Chemoluminescence images were captured with ECL (Beyotime Institute of Biotechnology) using the Fusion Fx7 image acquisition system (Vilber Lourmat, Marne La Vallée, France). The quantification of the bands was performed by densitometry using ImageJ software. The CD39 protein expression level was calculated by densitometry relative to GAPDH.

Detection of cytokines

The levels of cytokines were measured by enzyme-linked immunosorbent assay (ELISA) according to the manufacturer’s instructions. The lower limit of detection was 4 pg/ml for interleukin (IL)-4 and IL-5. All ELISA kits for cytokines were purchased from eBioscience, Inc. (San Diego, CA, USA).

Generation of bone marrow-derived DCs (BMDCs)

Immature DCs were prepared from bone marrow progenitors. Bone marrow mononuclear cells were prepared from femur bone marrow suspensions of C57BL/6 male mice (5–6 weeks old) and then cultured at a density of 2×106 cells/ml in RPMI-1640 supplemented with 10% fetal bovine serum (FBS), 10 ng/ml recombinant murine granulocyte-macrophage colony-stimulating factor (GM-CSF) and 10 ng/ml recombinant murine IL-4 (both from PeproTech, Rocky Hill, NJ, USA). Non-adherent cells were gently washed out on the 3rd day of culture. On days 5 and 7, the medium was refreshed. The purity of the DCs was at least 90%. On day 8, the BMDCs were incubated with 1 μg/ml lipopolysaccharide (LPS; Sigma-Aldrich) overnight and collected for subsequent experiments.

Migration assay of DCs in vitro

A migration assay was performed in 24-well Transwell chambers with 5 μm pore size polycarbonate filters (Corning Life Sciences, Tewksbury, MA, USA). Various concentrations of ATP diluted in RPMI-1640 containing 0.5% bovine serum albumin (BSA) were added to the lower chambers in a volume of 0.6 ml; 0.1 ml RPMI-1640 containing DCs (2×105 cells/well) was added to the upper chambers followed by culture at 37°C for 4 h. In some experiments, apyrase (1 IU) was added to the medium containing ATP in the lower chambers. The number of migrated DCs to the lower chambers was calculated using a hemocytometer. The results are presented as the chemotactic index and calculated as the number of cells in the lower chamber containing the different stimuli divided by the number of cells in the chamber containing medium alone.

Statistical analysis

The data are expressed as the means ± SD, representing at least 2 independent experiments with consistent results (n=4–6 mice per group). The data from 1 representative experiment of 3 are shown. The differences were compared using the unpaired Student’s t-test for 2 groups or one-way ANOVA analysis for 3 groups. Statistical analysis was performed using SPSS 17.0 software (IBM SPSS, Chicago, IL, USA). A value of P<0.05 was considered to indicate a statistically significant difference.

Results

OVA-induced airway inflammation leads to a reduced expression of CD39 in lung tissue

We investigated the distribution of CD39 in the lungs obtained from mice by immunofluorescence assay. As shown in Fig. 1A, CD39 was located at the cytomembrane and cytoplasm of bronchial epithelial cells (red area indicates the positive location). The fluorescence intensity was reduced in the lungs from OVA-sensitized and challenged (asthma) mice compared to that in the lungs from PBS-sensitized and challenged (control) mice. We further assessed the expression levels of CD39 in the lungs from the control and asthmatic mice. At the mRNA level, CD39 expression was decreased in the asthmatic mice, as shown by qPCR (Fig. 1B). A marked decrease in CD39 protein expression was also observed in the asthmatic mice, as shown by western blot analysis (Fig. 1C). These data indicate that a reduction in CD39 expression is associated with OVA-induced allergic airway inflammation.

Figure 1

Ovalbumin (OVA)-induced airway inflammation leads to a reduction in CD39 expression. (A) Representative micrographs of immunofluorescence of CD39 in the lungs from the control and asthmatic (asthma) mice are shown. CD39 was detected with Rhodamine-labeled secondary antibody and located at the cytomembrane and cytoplasm of bronchial epithelial cells. Control: PBS sensitization and challenge; asthma, OVA sensitization and challenge. (B) CD39 mRNA expression was significantly reduced in the lungs from asthmatic mice compared to control mice. (C) CD39 protein expression was significantly reduced in the lungs from asthma mice compared to control mice. One representative experiment of 3 is shown. The data are presented as the means ± SD, (n=4–6 mice per group). **P<0.01 and *P<0.05; original magnification, ×200.

Treatment with apyrase attenuates OVA-induced tissue eosinophilia, mucus production and airway inflammation

Having shown that a reduced CD39 expression is associated with OVA-induced allergic airway inflammation, we exogenously supplemented apyrase, an eATP scavenger, to investigate its effects on airway inflammation. Lung tissues were collected 48 h after the final OVA challenge. In histological analysis, the OVA-exposed mice showed cardinal pathological features of asthma-like inflammation. In contrast to the PBS-sensitized and challenged controls (Fig. 2A), OVA-sensitized and challenged mice displayed numerous inflammatory cells in the peribronchiolar and perivascular zones (Fig. 2B). Compared to treatment with PBS, treatment with apyrase markedly decreased the number of eosinophil-rich inflammatory cells infiltrating the peribronchiolar and perivascular regions (Fig. 2C). As shown in Fig. 2D–F, PAS staining was used to detect goblet cells. In contrast to the controls (Fig. 2D), the OVA-exposed mice (Fig. 2E) showed goblet cell hyperplasia in the airways, which was significantly reduced by treatment with apyrase (Fig. 2F). OVA exposure markedly increased the inflammation scores of the peribronchial and perivascular regions (Fig. 3), compared to PBS sensitization and challenge. The increased lung inflammation following exposure to OVA was reduced by approximately 40% following treatment with apyrase. Taken together, these results reveal that apyrase significantly reduces OVA-induced inflammatory cell infiltration into the lungs, goblet cell hyperplasia in the airways and airway inflammation.

Figure 2

Apyrase attenuates ovalbumin (OVA)-induced tissue eosinophilia and mucus production. (A–C) Representative micrographs of hematoxylin and eosin (H&E) staining of lung sections are shown. (D–F) Representative micrographs of periodic acid-Schiff (PAS) staining of lung sections are shown. The group was coded as sensitization/treatment/challenge. (A and D) PBS/PBS/PBS. (B and E) OVA/PBS/OVA. (C and F) OVA/apyrase/OVA, (n=4–6 mice per group).

Figure 3

Apyrase reduces the inflammation score in ovalbumin (OVA)-exposed mice. Peribronchial and perivascular inflammation was measured 48 h after the final challenge. The inflammation score was significantly increased in the OVA-sensitized and challenged mice and the administration of apyrase decreased the inflammation score. The group was coded as sensitization/treatment/challenge. The data are presented as the means ± SD. (n=4–6 mice per group). *P<0.05.

Treatment with apyrase reduces the number of inflammatory cells in BALF following exposure to OVA

BALF was collected 48 h after the final OVA challenge and the number of the total cells and the different inflammatory cells were counted. Exposure to OVA markedly increased the number of eosinophils, lymphocytes and neutrophils, compared to PBS sensitization and challenge (Fig. 4). The administration of apyrase markedly reduced the number of eosinophils, lymphocytes and neutrophils in BALF, compared to the PBS-treated asthmatic mice. In addition, a reduction in the number of total cells was observed in the apyrase-treated mice.

Figure 4

Apyrase reduces ovalbumin (OVA)-induced inflammatory cells in bronchoalveolar lavage fluid (BALF). Differential cell counts were performed on approximately 400 cells in each of 4 different random locations to identify eosinophils (Eos), lymphocytes (Lym) and neutrophils (Neu). The group was coded as sensitization/treatment/challenge. The data are presented as the means ± SD, (n=4–6 mice per group). ***P<0.001.

Administration of apyrase markedly decreases the levels of Th2 cytokines in BALF and the expression of GATA3 in lung tissue

Given the essential role of Th2 cytokines in triggering the allergic inflammatory response, we detected the levels of IL-4 and IL-5 in BALF. OVA sensitization and challenge markedly increased the concentration of cytokines in BALF, as shown by ELISA (Fig. 5A) compared to PBS sensitization and challenge. The increased levels of cytokines in BALF were significantly reduced by apyrase treatment.

Figure 5

The levels of Th2 cytokines in the bronchoalveolar lavage fluid (BALF) and the expression of GATA3 in the lungs were significantly decreased in the apyrase-treated mice. (A) The levels of cytokines in the BALF were increased in the OVA-exposed mice and the increased levels were decreased by apyrase. (B) The expression of GATA3 in the lung tissues was increased in the ovalbumin (OVA)-exposed mice and the increased level was decreased by apyrase. The group was coded as sensitization/treatment/challenge. The data are presented as the means ± SD. (n=4–6 mice per group). ***P<0.001, **P<0.01, *P<0.05.

GATA3, the key transcription factor, controls the differentiation of Th2 cells. We further determined whether apyrase decreases GATA3 mRNA expression in the lungs obtained from asthmatic mice. In the OVA-exposed mice, the mRNA level of GATA3 was increased by 4-fold in the lung tissues compared with that in the PBS-sensitized and challenged control mice (Fig. 5B). The administration of apyrase effectively reduced the expression of GATA3 in the lung tissues compared with the PBS-treated asthmatic mice (Fig. 5B).

Apyrase decreases the chemotactic migration of DCs towards ATP

Our results revealed that apyrase attenuated airway inflammation. ATP is a chemoattractant for DCs in vitro (8,19). Therefore, we explored whether apyrase decreases the chemotactic migration of DCs towards ATP. Various concentrations of ATP were added to the medium in the lower chamber. As shown in Fig. 6A, the DCs showed the strongest chemotactic activity with 10 μM ATP. Apyrase was then added to the medium containing 10 μM ATP. We found that upon the administration of apyrase, the chemotactic migration of DCs towards ATP was markedly decreased compared to the cells treated with ATP alone (Fig. 6B).

Figure 6

Apyrase decreased the chemotactic migration of dendritic cells (DCs) towards adenosine 5′-triphosphate (ATP). (A) A two-chamber Transwell system was used to evaluate the chemotactic migration of DCs towards ATP (various concentrations) in an in vitro assay. (B) Apyrase decreased the chemotactic migration of DCs towards ATP. The data are presented as the means ± SD. **P<0.01, ***P<0.001. One representative experiment of 3 is shown.

Discussion

CD39 is an integral membrane protein that hydrolyzes ATP and is constitutively expressed in the spleen, thymus, lung and placenta (20,21). CD39 is structurally characterized by 2 transmembrane regions, a small cytoplasmic region and a large extracellular region that is essential for the catabolic activity of the enzyme (22). Increasing evidence demonstrates the regulation of immunity by CD39 in infectious diseases (23–26), autoimmune diseases (27–29) and ischemia-reperfusion injury (30,31). However, little is known of the role of CD39 in allergic asthma.

In the present study, we found that CD39 was located at the surface of bronchial epithelial cells and the CD39 expression was reduced in the lungs obtained from allergic asthmatic mice, which was associated with the pathogenesis of allergic asthma. In addition, CD39 expression is decreased in patients with Crohn’s disease (32). Furthermore, the deletion of CD39 has been demonstrated to increase the disease severity and pre-treatment of apyrase has been shown to improve the outcome in a murine model of DSS-induced colitis (32). These findings demonstrate a protective role of CD39 in inflammatory diseases. In our study, the administration of apyrase, a soluble factor with enzymatic activity essentially identical to CD39, to OVA-sensitized mice attenuated airway inflammation, which was consistent with the results of a previous study (8). This mainly included a significant decrease in airway eosinophilic inflammation, goblet cell hyperplasia and the levels of Th2 cytokines in BALF.

Th2 cells play a crucial role in allergic asthma by triggering the recruitment of eosinophils and mast cells and inducing goblet cell hyperplasia (33). However, the polarization of Th2 cells is regulated by the transcription factor, GATA3 (34). In our study, the expression of GATA3 was markedly increased in the lungs obtained from OVA-sensitized and challenged mice compared to those from PBS-sensitized and challenged mice. In a previous study of ours, GATA3 mRNA expression was decreased in allergic asthma patients (33). Treatment with apyrase reduced its expression in the lungs, which resulted in the reduced levels of Th2-cytokines.

DCs are pivotal for the initiation and maintenance of adaptive Th2 cell responses to inhaled allergens in asthma (4). Our findings demonstrated that ATP induced the migration of DCs, which was in accordance with a previous study that demonstrated that ATP promoted the migration of DCs by activating P2Y2 receptor (9). However, in our study, apyrase reduced the chemotactic migration of DCs, which was associated with the hydrolysis of ATP by apyrase. Furthermore, in another study of ours, we showed that ATP induced the migration of mast cells and the exogenous administration of soluble CD39 inhibited the migration of ATP-induced mast cells in an in vitro assay (unpublished data).

In conclusion, the present study provides evidence of the role of associated ectonucleotidases in a murine model of OVA/aluminum hydroxide-induced allergic asthma. As shown by our resutls, the reduced CD39 expression was associated with the development of allergic airway inflammation. Apyrase decreased the expression of GATA3 and reduced the chemotactic migration of DCs towards ATP, which resulted in the alleviation of airway inflammation. Thereby, targeting eATP or ectonucleotidases may provide a novel therapeutic approach for allergic asthma.

Acknowledgements

We would like to thank the National Natural Science Foundation of China. We would also like to thank the faculties at the Center for Medical Research, Hubei Key Laboratory of Allergy and Immune-Related Disease of Wuhan University. This study was supported by a grant from the National Natural Science Foundation of China (81170029).

References

1 

Lloyd CM and Hessel EM: Functions of T cells in asthma: more than just T(H)2 cells. Nat Rev Immun. 10:838–848. 2010. View Article : Google Scholar : PubMed/NCBI

2 

Adcock IM, Caramori G and Chung KF: New targets for drug development in asthma. Lancet. 372:1073–1087. 2008. View Article : Google Scholar : PubMed/NCBI

3 

Holgate ST and Polosa R: Treatment strategies for allergy and asthma. Nat Rev Immunol. 8:218–230. 2008. View Article : Google Scholar

4 

Lambrecht BN and Hammad H: Biology of lung dendritic cells at the origin of asthma. Immunity. 31:412–424. 2009. View Article : Google Scholar : PubMed/NCBI

5 

Kim HY, DeKruyff RH and Umetsu DT: The many paths to asthma: phenotype shaped by innate and adaptive immunity. Nat Immunol. 11:577–584. 2010. View Article : Google Scholar : PubMed/NCBI

6 

Trautmann A: Extracellular ATP in the immune system: more than just a ‘danger signal’. Sci signal. 2:pe62009.

7 

Robson SC, Wu Y, Sun X, Knosalla C, Dwyer K and Enjyoji K: Ectonucleotidases of CD39 family modulate vascular inflammation and thrombosis in transplantation. Semin Thromb Hemost. 31:217–233. 2005. View Article : Google Scholar : PubMed/NCBI

8 

Idzko M, Hammad H, van Nimwegen M, et al: Extracellular ATP triggers and maintains asthmatic airway inflammation by activating dendritic cells. Nat Med. 13:913–919. 2007. View Article : Google Scholar : PubMed/NCBI

9 

Müller T, Robaye B, Vieira RP, et al: The purinergic receptor P2Y2 receptor mediates chemotaxis of dendritic cells and eosinophils in allergic lung inflammation. Allergy. 65:1545–1553. 2010.PubMed/NCBI

10 

Müller T, Vieira RP, Grimm M, et al: A potential role for P2X7R in allergic airway inflammation in mice and humans. Am J Respir Cell Mol Biol. 44:456–464. 2011.PubMed/NCBI

11 

Manthei DM, Jackson DJ, Evans MD, et al: Protection from asthma in a high-risk birth cohort by attenuated P2X(7) function. J Allergy Clin Immunol. 130:496–502. 2012. View Article : Google Scholar : PubMed/NCBI

12 

Crikis S, Lu B, Murray-Segal LM, et al: Transgenic overexpression of CD39 protects against renal ischemia-reperfusion and transplant vascular injury. Am J Transplant. 10:2586–2595. 2010. View Article : Google Scholar : PubMed/NCBI

13 

Künzli BM, Berberat PO, Dwyer K, et al: Variable impact of CD39 in experimental murine colitis. Dig Dis Sci. 56:1393–1403. 2011.PubMed/NCBI

14 

Künzli BM, Nuhn P, Enjyoji K, et al: Disordered pancreatic inflammatory responses and inhibition of fibrosis in CD39-null mice. Gastroenterology. 134:292–305. 2008.PubMed/NCBI

15 

Dwyer KM, Deaglio S, Gao W, Friedman D, Strom TB and Robson SC: CD39 and control of cellular immune responses. Purinergic Signal. 3:171–180. 2007. View Article : Google Scholar : PubMed/NCBI

16 

Deaglio S and Robson SC: Ectonucleotidases as regulators of purinergic signaling in thrombosis, inflammation, and immunity. Adv Pharmacol. 61:301–332. 2011. View Article : Google Scholar : PubMed/NCBI

17 

Antonioli L, Pacher P, Vizi ES and Haskó G: CD39 and CD73 in immunity and inflammation. Trends Mol Med. 19:355–367. 2013. View Article : Google Scholar : PubMed/NCBI

18 

Kwak YG, Song CH, Yi HK, et al: Involvement of PTEN in airway hyperresponsiveness and inflammation in bronchial asthma. J Clin Invest. 111:1083–1092. 2003. View Article : Google Scholar : PubMed/NCBI

19 

Idzko M, Dichmann S, Ferrari D, et al: Nucleotides induce chemotaxis and actin polymerization in immature but not mature human dendritic cells via activation of pertussis toxin-sensitive P2y receptors. Blood. 100:925–932. 2002. View Article : Google Scholar

20 

Enjyoji K, Sévigny J, Lin Y, et al: Targeted disruption of cd39/ATP diphosphohydrolase results in disordered hemostasis and thromboregulation. Nat Med. 5:1010–1017. 1999. View Article : Google Scholar : PubMed/NCBI

21 

Kapojos JJ, van den Berg A, Borghuis T, et al: Enhanced ecto-apyrase activity of stimulated endothelial or mesangial cells is downregulated by glucocorticoids in vitro. Eur J Pharmacol. 501:191–198. 2004. View Article : Google Scholar : PubMed/NCBI

22 

Heine P, Braun N, Sévigny J, Robson SC, Servos J and Zimmermann H: The C-terminal cysteine-rich region dictates specific catalytic properties in chimeras of the ectonucleotidases NTPDase1 and NTPDase2. Eur J Biochem. 268:364–373. 2001. View Article : Google Scholar : PubMed/NCBI

23 

Paletta-Silva R and Meyer-Fernandes JR: Adenosine and immune imbalance in visceral leishmaniasis: the possible role of ectonucleotidases. J Trop Med. 2012:6508742012. View Article : Google Scholar : PubMed/NCBI

24 

Souza Vdo C, Schlemmer KB, Noal CB, et al: E-NTPDase and E-ADA activities are altered in lymphocytes of patients with indeterminate form of Chagas’ disease. Parasitol Int. 61:690–696. 2012.PubMed/NCBI

25 

Fan J, Zhang Y, Chuang-Smith ON, et al: Ecto-5′-nucleotidase: a candidate virulence factor in Streptococcus sanguinis experimental endocarditis. PloS One. 7:e380592012.

26 

Théâtre E, Frederix K, Guilmain W, et al: Overexpression of CD39 in mouse airways promotes bacteria-induced inflammation. J Immunol. 189:1966–1974. 2012.PubMed/NCBI

27 

Fletcher JM, Lonergan R, Costelloe L, et al: CD39+Foxp3+ regulatory T cells suppress pathogenic Th17 cells and are impaired in multiple sclerosis. J Immunol. 183:7602–7610. 2009.PubMed/NCBI

28 

Moncrieffe H, Nistala K, Kamhieh Y, et al: High expression of the ectonucleotidase CD39 on T cells from the inflamed site identifies two distinct populations, one regulatory and one memory T cell population. J Immunol. 185:134–143. 2010. View Article : Google Scholar : PubMed/NCBI

29 

Peelen E, Damoiseaux J, Smolders J, et al: Th17 expansion in MS patients is counterbalanced by an expanded CD39+ regulatory T cell population during remission but not during relapse. J Neuroimmunol. 240–241:97–103. 2011.PubMed/NCBI

30 

Hart ML, Gorzolla IC, Schittenhelm J, Robson SC and Eltzschig HK: SP1-dependent induction of CD39 facilitates hepatic ischemic preconditioning. J Immunol. 184:4017–4024. 2010. View Article : Google Scholar

31 

Bönner F, Borg N, Burghoff S and Schrader J: Resident cardiac immune cells and expression of the ectonucleotidase enzymes CD39 and CD73 after ischemic injury. PloS One. 7:e347302012.PubMed/NCBI

32 

Friedman DJ, Künzli BM, A-Rahim YI, et al: CD39 deletion exacerbates experimental murine colitis and human polymorphisms increase susceptibility to inflammatory bowel disease. Proc Nat Acad Sci USA. 106:16788–16793. 2009. View Article : Google Scholar

33 

Chen X, Gao YD and Yang J: Elevated interferon regulatory factor 4 levels in patients with allergic asthma. J Asthma. 49:441–449. 2012. View Article : Google Scholar : PubMed/NCBI

34 

Stellato C, Gubin MM, Magee JD, et al: Coordinate regulation of GATA-3 and Th2 cytokine gene expression by the RNA-binding protein HuR. J Immunol. 187:441–449. 2001. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Li P, Cao J, Chen Y, Wang W and Yang J: Apyrase protects against allergic airway inflammation by decreasing the chemotactic migration of dendritic cells in mice. Int J Mol Med 34: 269-275, 2014.
APA
Li, P., Cao, J., Chen, Y., Wang, W., & Yang, J. (2014). Apyrase protects against allergic airway inflammation by decreasing the chemotactic migration of dendritic cells in mice. International Journal of Molecular Medicine, 34, 269-275. https://doi.org/10.3892/ijmm.2014.1771
MLA
Li, P., Cao, J., Chen, Y., Wang, W., Yang, J."Apyrase protects against allergic airway inflammation by decreasing the chemotactic migration of dendritic cells in mice". International Journal of Molecular Medicine 34.1 (2014): 269-275.
Chicago
Li, P., Cao, J., Chen, Y., Wang, W., Yang, J."Apyrase protects against allergic airway inflammation by decreasing the chemotactic migration of dendritic cells in mice". International Journal of Molecular Medicine 34, no. 1 (2014): 269-275. https://doi.org/10.3892/ijmm.2014.1771
Copy and paste a formatted citation
x
Spandidos Publications style
Li P, Cao J, Chen Y, Wang W and Yang J: Apyrase protects against allergic airway inflammation by decreasing the chemotactic migration of dendritic cells in mice. Int J Mol Med 34: 269-275, 2014.
APA
Li, P., Cao, J., Chen, Y., Wang, W., & Yang, J. (2014). Apyrase protects against allergic airway inflammation by decreasing the chemotactic migration of dendritic cells in mice. International Journal of Molecular Medicine, 34, 269-275. https://doi.org/10.3892/ijmm.2014.1771
MLA
Li, P., Cao, J., Chen, Y., Wang, W., Yang, J."Apyrase protects against allergic airway inflammation by decreasing the chemotactic migration of dendritic cells in mice". International Journal of Molecular Medicine 34.1 (2014): 269-275.
Chicago
Li, P., Cao, J., Chen, Y., Wang, W., Yang, J."Apyrase protects against allergic airway inflammation by decreasing the chemotactic migration of dendritic cells in mice". International Journal of Molecular Medicine 34, no. 1 (2014): 269-275. https://doi.org/10.3892/ijmm.2014.1771
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team