International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.
International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.
Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.
Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.
Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.
Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.
Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.
International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.
Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.
Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.
Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.
An International Open Access Journal Devoted to General Medicine.
In 2006, Sonoyama et al isolated a new population of mesenchymal stem cells from the root apical papilla of human tooth, which were designated as stem cells from apical papilla (SCAP) (1). SCAP expressed mesenchymal stem cell phenotypes, including STRO-1 and CD146, and a specific surface marker, i.e., CD24 (2–5). SCAP are considered the source of odontoblasts, which are responsible for the development of root dentin (3–7). In a minipig model, tooth root development was ceased when the apical papilla was surgically removed, whereas root development was completed when the apical papilla was conserved (6). SCAP have a significantly higher proliferation rate and mineralization capacity than dental pulp stem cells (DPSCs) (3,7). Findings of previous studies demonstrated that the proliferation ratio of SCAP was approximately 2 times greater than that of DPSCs in vitro (3,5). Additionally, both DPSCs and SCAP presented an initiative potential for mineralization and osteo/odontogenic gene expression, including alkaline phosphatase (ALP), osteocalcin (OCN), bone sialoprotein (BSP) and dentin sialophosphoprotein (DSPP) (3). Furthermore, the mineralization ratio of SCAP was significantly higher than that of DPSCs with osteo/odontogenic stimuli, which resulted in increased amounts of mineralized deposits in SCAP (3,5,7). As a novel seed cell for dental regeneration, SCAP are believed to have broad prospects. However, the genes that regulate the odontogenic differentiation of SCAP remain unclear.
Bone morphogenetic protein 2 (BMP2) is a key gene for modulating odontogenic differentiation in tooth development (8–10). It is involved in the regulation of odontogenic differentiation of dental pulp cells, and in the control of the mineralization processes of the dentin matrix (11). Co-cultured with recombinant human BMP2 (rhBMP2) medium, the odontogenic differentiation of DPSCs was promoted, resulting in an increased gene expression of DSPP in vitro, and an enhanced reparative dentin formation on amputated pulp (12). Yang et al constructed human BMP2 gene-transfected DPSCs (DPSCs/BMP2), and reported that the osteo/odontogenic differentiation genes, including ALP, OCN, collagen type I (Col I), BSP, DSPP and dentin matrix protein 1 (DMP1), were significantly enhanced at different time points, compared with DPSCs (13–15). Furthermore, rhBMP2-treated DPSCs presented significantly reduced proliferation compared with the control (16). However, the effects of BMP2 on the odontogenic differentiation of SCAP remain to be elucidated.
In this study, BMP2 gene was transfected into SCAP by lentiviral-mediated transfection to construct SCAP/BMP2. The proliferation capacity of SCAP/BMP2 was analyzed by CCK-8. The odontogenic differentiation potential of SCAP/BMP2 was evaluated by quantitative polymerase chain reaction (qPCR), ALP staining and alizarin red (AR) staining. We hypothesized that SCAP/BMP2 have greater odontogenic differentiation potential as compared to SCAP/Vector, when cultured without osteo/odontogenic stimuli. The results of the present study suggested the effects of the BMP2 gene on the odontogenic differentiation of SCAP.
The experiments were performed with the approval of the Ethics Committee of Guanghua School and Hospital of Stomatology, Sun Yat-sen University (Guangzhou, China). Human impacted wisdom teeth with immature roots were collected from 16- to 18-year-old patients at the Department of Oral Maxillofacial Surgery of the Guanghua Hospital of Stomatology. The extracted third molars were carefully rinsed by phosphate-buffered saline (PBS) with 100 U/ml penicillin and 100 mg/ml streptomycin, and then temporarily maintained in Hanks’ solution. The root apical papillae were gently separated from teeth roots, minced and digested by 3 mg/ml type I collagenase (Worthington Biochemical Co., Freehold, NJ, USA) and 4 mg/ml dispase (Gibco Life Technologies, Beijing, China) for 1 h at 37°C. Single-cell suspension was obtained by passing through a 70 μm strainer (BD Biosciences, Bedford, MA, USA). These isolated SCAP with 5×104/well density were seeded in 6-well plates (Corning Life Sciences, Oneonta, NY, USA) containing α-MEM (Invitrogen, Hong Kong, China) supplemented with 10% FBS (Gibco Life Technologies Australia Pty Ltd., Mulgrave Victoria, Australia), 100 U/ml penicillin-G and 100 mg/ml streptomycin, and then cultured with 5% CO2 at 37°C.
The multipotential of SCAP was confirmed by osteogenic and adipogenic differentiation induction. Briefly, SCAP were cultured with OriCell™ Human Mesenchymal Stem Cell Osteogenic Differentiation Medium and OriCell Human Mesenchymal Stem Cell Adipogenic Differentiation Medium (both from Cyagen Biosciences Inc., Guangzhou, China) for 32 and 8 days, respectively. AR solution and Oil Red O reagent kit (Jiancheng Bioengineering Institute, Nanjing, China) were used to visualize the mineralized nodules and lipid droplets, respectively.
The phenotypes of the passage 2 SCAP were evaluated by FCM for the expression of STRO-1/Alexa Fluor 647-APC (BioLegend, San Diego, CA, USA), CD146/PE, CD24/FITC and CD45/FITC (all from BD Pharmingen, San Diego, CA, USA).
Human BMP2 gene primers were designed by Oligo 7.0 software (Molecular Biology Insights, Inc., Plymouth, MN, USA) according to the NCBI GenBank no. KC294426.1. PCR primers were designed as follows: forward, GCCGAATTCA TGGTGGCCGGGACCCGCTG (the underlined is tje EcoRI site) and reverse, GCCGGATCCCTAGCGACACCCACAAC CCTC (the underlined is the BamHI site). For PCR amplification, the primers were processed with a pre-denaturation step (95°C for 3 min), followed by 30 cycles of denaturation (95°C for 15 sec), annealing (55°C for 30 sec), and extension (72°C for 1 min), then stored at 72°C for 7 min prior to termination of the amplification action at 4°C for 10 min. The amplified primers were subsequently treated with EcoRI and BamHI, and the fragment containing human BMP2 gene was combined into the lentivirus vector pCDH-CMV-MCS-EF1-copGFP (pCDH; System Biosciences, Mountain View, CA, USA) to construct the recombinant plasmid, i.e., pCDH-BMP2.
A volume of 5 ml 293FT cell (System Biosciences) suspensions with 2.4×105 cells/ml density was bred on a 10 cm dish 2 days prior to transfection, and was cultured by DMEM (Invitrogen) with 10% FBS. The recombinant plasmid pCDH-BMP2, packaging plasmid psPAX.2 and envelope plasmid pMD2.G (the latter two from Cyagen) were co-transfected into 293FT cells by Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) (17,18). The supernatant of 293FT cells was assembled after 48 h, centrifuged at 1,000 × g 37°C for 10 min, and filtered by 0.2 μm syringe filter (Millipore Corp., Bedford, MA, USA). To obtain an optimum multiplicity of infection (MOI), SCAP were infected with pCDH-BMP2 plasmid at different MOI values (5, 10, 20, 50 and 70) to obtain SCAP/BMP2. Green fluorescent protein (GFP) fluoresce of SCAP/BMP2 was assessed under a fluorescence microscope (Carl Zeiss Microimaging GmbH, Gottingen, Germany), and the transfection efficiency was evaluated by the GFP expression proportion of the cells. SCAP/Vector was constructed by infecting SCAP with blank vector and served as the control. The BMP2 gene expression of SCAP/Vector and SCAP/BMP2 was assessed by qPCR and western blot analysis 4 days after transfection. SCAP/Vector and SCAP/BMP2 were bred in 25 cm2 culture flasks containing α-MEM with 10% FBS, and cultured with 5% CO2 at 37°C. The culture medium was changed at 48-h intervals.
SCAP/Vector and SCAP/BMP2 were seeded in 96-well plates with a density of 2×103 cells/well and were cultured in α-MEM with 10% FBS. The cell proliferation rate was analyzed using a cell counting kit-8 (CCK-8; Dojindo, Tokyo, Japan) on the 1st, 2nd, 4th and 8th day following gene transfection.
The total RNA of the SCAP/Vector and SCAP/BMP2 was extracted using TRIzol (Invitrogen) on the 1st, 4th, 8th, and 16th day following gene transfection. The RNA quantity was assessed by a spectrophotometer (Model 400-MR; Varian Inc., Palo Alto, CA, USA). For each sample, 2 μg RNA was utilized to synthesize cDNA by RevertAid First Strand cDNA Synthesis kit (Thermo Fisher Scientific Inc., Beijing, China). Real-time reaction was performed by iQ SYBR-Green Supermix and regulated by spectrofluorimetric thermal iCycler iQ5 (both from Bio-Rad, Hercules, CA, USA). The BMP2 and odontogenic differentiation genes, including ALP, OCN, DSPP and DMP1, were assessed by qPCR. Each sample was assessed 3 times. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was selected as the housekeeping gene (Table I). The gene-specific primers were amplified with a denaturation step (95°C for 3 min); followed by 39 cycles of denaturation (95°C for 10 sec), annealing (55°C for 10 sec), and extension (72°C for 30 sec).
Western blot analysis was performed as described in a previous study (19). Briefly, the total proteins were calculated by a Bio-Rad Blue protein assay (Bio-Rad Laboratories, Richmond, CA, USA). Protein was distinguished with rabbit polyclonal antibody against human BMP2 (1:500 dilution; Abcam, Cambridge, UK) and human GAPDH (1:5,000 dilution).
SCAP/Vector and SCAP/BMP2 were cultured in 6-well plates at the initial density of 5×104 cells/well, in α-MEM containing 10% FBS. After 16 days incubation, an ALP staining kit (Jiancheng Bioengineering Institute) was applied to demarcate ALP granules. Microscopic images were captured at a magnification of ×100, ×200, ×400 and ×800, respectively. The AR staining solution was used to demarcate mineralized deposits. AR staining images were captured at a magnification of ×0 and ×200.
Data of cell proliferation and odontogenic differentiation gene expression were expressed as the mean ± standard deviation. A two-way ANOVA test was used to analyze the differences between SCAP/Vector and SCAP/BMP2 (SPSS,Inc., Chicago, IL, USA). The significance was set as P<0.05.
The apical papillae were kidney-shaped (Fig. 1A). Isolated cells from apical papilla presented a spindle appearance with extending cytoplasmic processes (Fig. 1B). After 32 days osteogenic induction of SCAP, a mass of mineralized deposits formed and presented positive Alizarin Red staining (Fig. 1C). After 8 days adipogenic induction, a few lipid droplets formed and showed positive Oil Red O staining (Fig. 1D). The representative FCM results confirmed that the freshly isolated SCAP had a typical FSC/SSC character (Fig. 2A) as reported previously (3). The isolated cells expressed mesenchymal stem cell (MSC) phenotypes, including STRO-1 and CD146, and a specific phenotype CD24 (Fig. 2B–D). The expression of CD45, a hematopoietic stem cell character, was negative (Fig. 2E).
When the MOI value increased from 5 to 70, the transfection efficiency was enhanced from 2% to >90% 48 h after transfection (Fig. 3A and B). When the MOI value was 70, the SCAP/Vector and SCAP/BMP2 presented a high GFP expression proportion 4 days following gene transfection. However, the morphology of the transfected stem cells was slightly slimmer (Fig. 3C) as compared to SCAP. The BMP2 gene expression was higher in SCAP/BMP2 (6.23±0.04) than in SCAP/Vector (1.00±0.12) (P<0.01) 4 days after transfection (Fig. 3D). The western blot analysis confirmed that BMP2 expression in SCAP/BMP2 was significantly increased compared with SCAP/Vector (Fig. 3E).
No significant difference of cell proliferation was found between SCAP/Vector and SCAP/BMP2 (Fig. 4). The average optical density (OD) of the two groups of cells generally increased from 0.2 to 0.8 during the observation period.
The relative peak expression of ALP in SCAP/Vector was on the 8th day after transfection, while for SCAP/BMP2 the expresion was on the 16th day. The ALP expression in SCAP/BMP2 was significantly enhanced on the 1st day (P<0.05), 8th day (P<0.01) and 16th day (P<0.01) compared with SCAP/Vector (Fig. 5). The relative peak expression of OCN in SCAP/Vector was on the 8th day, while in SCAP/BMP2 it was on the 16th day. The OCN expression in SCAP/BMP2 was significantly upregulated on the 16th day after gene transfection (P<0.01) compared with SCAP/Vector. The relative peak expression of DSPP in SCAP/Vector was on the 8th day, while in SCAP/BMP2 it was on the 16th day. The DSPP expression in SCAP/BMP2 was significantly upregulated on the 1st (P<0.01), 4th (P<0.05), 8th (P<0.01) and 16th (P<0.01) day compared with SCAP/Vector. The relative peak expression of DMP1 in SCAP/Vector and SCAP/BMP2 was on the 16th day. The DMP1 expression in SCAP/BMP2 was significantly upregulated at the four time points (P<0.01) compared with SCAP/Vector.
A positive ALP expression, defined as golden staining granules and strips, was observed in both the SCAP/Vector and SCAP/BMP2 (Fig. 6). The quantity and brightness of ALP staining in SCAP/BMP2 was greater than that of SCAP/Vector. ALP expression was observed in intracellular as well as extracullar mineralized deposits.
The SCAP/BMP2 demonstrated significantly stronger AR staining compared with SCAP/Vector on visual inspection (Fig. 7). More and larger mineralization deposits were observed in SCAP/BMP2 compared with SCAP/Vector under a microscope. For SCAP/BMP2, an intensive GFP expression was found in the mineralized deposits.
Dental papilla is commonly regarded as the source for tooth formation and ultimately converts to dentin and dental pulp tissue (1). SCAP, as a novel population of multipotential stem cells isolated from the dental papilla, have the capacity to differentiate into osteoblasts, odontoblast-like cells and adipocytes in vitro (1–7). Sonoyama et al induced the osteo/odontogenic differentiation of SCAP by using basic culture medium (α-MEM and 15% FBS) plus 10 nmol/l dexamethasone, 10 mmol/l β-glycerophosphate, 50 μg/ml ascorbate phosphate, and 10 nmol/l 1,25 dihydroxyvitamin D3 (1,5). SCAP formed mineralized deposits progressively after 4–8 weeks of induction. In the present study, the osteogenic differentiation of SCAP was induced using Human Mesenchymal Stem Cell Osteogenic Differentiation Medium which contains a similar formula to that described by Sonoyama et al. Mineralized deposits were formed following induction for 32 days. Sonoyama et al induced the adiogenic differentiation of SCAP by using the basic culture medium plus 0.5 mmol/l hydrocortisone, 60 mmol/l indomethacin, 10 mg/ml insulin and 0.5 mmol/l isobutylmethylxanthine (1). Results of those studies showed that the adipogenic differentiation capacity of SCAP was not as qualitative as bone marrow mesenchymal stem cells, and few lipid droplets were formed after 3 weeks. In the present study, lipid droplet formation of SCAP was induced with Human Mesenchymal Stem Cell Adipogenic Differentiation Medium for 8 days. The results of the present study confirmed that SCAP have the capacity for osteogenic and adipogenic differentiation.
SCAP were found to express MSC phenotypes, including STRO-1, CD146, CD24, CD105, CD73, CD90, CD29, CD44 and CD49 (4). STRO-1, a marker that is recognized as a trypsin insensitive epitope of perivascular cells, has been used to isolate MSC populations from dental pulps and apical papilla (4,13). STRO-1 selected DPSCs and SCAP showed an enhanced ability of osteo/odontogenic differentiation. Findings of previous studies have shown that the expression of STRO-1 among SCAP is usually >18%. Additionally, the STRO-1 expression of passage 1 SCAP is up to 20–30% (4,7). CD146 is one of the most employed key markers to characterize perivascular multipotent stem cells in connective tissues. The range of CD146 among SCAP is 47.3–84.8% (3). In the present study, the representative expression of STRO-1 of passage 2 SCAP was 21.8%, while the expression of CD146 was 60.3%. These results are consistent with those of previous studies. CD24 is considered a specific marker for SCAP, which is undetectable in other MSCs, including DPSCs (1). The CD24 expression of SCAP ranges from 3.2 to 15.3% (4), and its expression decreases with an upregulated expression of ALP during the odontogenic differentiation of SCAP (1). In the present study, the CD24 expression of passage 2 SCAP was 12.2%, which is consistent with that identified in previous studies. The FCM results confirmed that the phenotypes of the cells isolated from the apical papilla in this study are characteristic of SCAP.
Stem cells cultured with dexamethasone have been confirmed to form more mineralized deposits in vitro (20). Stem cells cultured with L-ascorbic acid-2-phosphate have also been reported to result in an upregulated cell proliferation and osteogenic differentiation (20–22). Culturing cells with mineralization stimuli may partly obscure the positive effects, which may due to BMP2 gene transfection. Therefore, the cell-culturing media without external supplements of dexamethasone or any other mineralization stimuli were specifically selected for the present in vitro study.
In tooth development, BMP2 was found to express during the whole process of differentiation and maturation of odontoblasts (8,9). BMP2 is crucial in the regulation of odontoblast differentiation and dentin formation. BMP2 gene transfection has been considered an effective strategy in the improvement of the odontogenic differentiation potential of DPSCs in vitro (13,14,16), leading to a significantly increased gene expression of ALP, OCN, COL I, BSP, DSP and DMP1. In the present study, the odontogenic differentiation mRNA expression, including ALP, OCN, DSPP and DMP1, was also significantly upregulated in SCAP/BMP2 compared with SCAP/Vector. Although in this study, BMP2 expression was only tested on the 4th day following gene transfection in, other studies have proven that lentivirus transfection can mediate a stable expression of target genes in cells (23–25).
ALP, which was detected during the process of cell mineralization, is considered an early marker of osteo/odontogenic differentiation of stem cells derived from dental tissues (2,3,11,13,26–30). Results of the present study have shown that SCAP/BMP2 had significantly upregulated ALP expressions on the 1st, 8th and 16th day compared with SCAP/Vector, which was similar to that in DPSCs/BMP2 (13). Additionally, ALP and AR staining demonstrated that SCAP/BMP2 formed more ALP granules and mineralized deposits compared with SCAP/Vector. OCN is a marker of the late stages of osteo/odontogenic differentiation, which regulates the mineral phase of bone and dentin (3). In a previous study it was found that DPSCs/BMP2 had a significantly upregulated expression of OCN on the 8th and 16th day after transfection (13), while in the present study SCAP/BMP2 showed a significantly upregulated expression of OCN on the 16th day. DSPP is a significant part of the dentin non-collagenous proteins, which play a key role in the dentin mineralization process (3,26). It is usually synthesized by terminally differentiated odontoblasts during the secretory phase, and is regarded as a late-stage marker of odontogenic differentiation. In the present study, qPCR showed that lentiviral-mediated BMP2 gene transfection significantly enhanced the expression of DSPP gene at the four time-points, which was similar to a previous report (13). DMP1 is an acidic phosphorylated extracellular matrix protein (12,31). Although DMP1 is not exclusively expressed in odontogenic differentiation, it has been considered an important marker for odontoblasts (26,32). DMP1 has dual functions, as a transcription factor that targets the nucleus and as an extracellular matrix protein that initiates mineralization (29). In the present study, DMP1 expression in SCAP/BMP2 was significantly improved, which was also consistent with a previous report (13). These results provided evidence that the specific transfection of the BMP2 gene enhanced the odontogenic differentiation of SCAP.
In summary, human dental papilla stem cells were successfully transfected by BMP2 gene lentiviral plasmid. Under the circumstances without mineralization stimuli, SCAP/BMP2 expressed more odontogenic differentiation genes, revealed more ALP granules, and formed more mineralization deposits than SCAP/Vector. These results are consistent with our hypothesis. Transfection of a homologous BMP2 gene may therefore be an effective strategy to improve the tissue engineering applications of SCAP.
We would like to thank Dr Chenfei Zhang (Clinical Associate Professor in Endodontics, The University of Hong Kong) for his sincere aid in the starting period of this study. We would also like to thank all the staff and postgraduate students of the Guanghua School of Stomatology, Sun Yat-sen University, who assisted in the clinical sample collection and laboratory analysis. This study was supported by the Guangdong Medical Science Research Fund (B2012142), Fundamental Research Funds for Sun Yat-sen University (12YKPY68) and National Natural Science Found of China (81170932).
|
Sonoyama W, Liu Y, Fang D, et al: Mesenchymal stem cell-mediated functional tooth regeneration in swine. PLoS One. 1:e792006. View Article : Google Scholar : PubMed/NCBI | |
|
Wu J, Huang GT, He W, et al: Basic fibroblast growth factor enhances stemness of human stem cells from the apical papilla. J Endod. 38:614–622. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Bakopoulou A, Leyhausen G, Volk J, et al: Comparative analysis of in vitro osteo/odontogenic differentiation potential of human dental pulp stem cells (DPSCs) and stem cells from the apical papilla (SCAP). Arch Oral Biol. 56:709–721. 2011. View Article : Google Scholar | |
|
Bakopoulou A, Leyhausen G, Volk J, Koidis P and Geurtsen W: Comparative characterization of (neg)/CD146(pos) and STRO-1 (neg)/CD146(pos) apical papilla stem cells enriched with flow cytometry. Arch Oral Biol. 58:1556–1568. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Sonoyama W, Liu Y, Yamaza T, et al: Characterization of the apical papilla and its residing stem cells from human immature permanent teeth: a pilot study. J Endod. 34:166–171. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Huang GT, Sonoyama W, Liu Y, Liu H, Wang S and Shi S: The hidden treasure in apical papilla: the potential role in pulp/dentin regeneration and bioroot engineering. J Endod. 34:645–651. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Huang GT, Gronthos S and Shi S: Mesenchymal stem cells derived from dental tissues vs. those from other sources: their biology and role in regenerative medicine. J Dent Res. 88:792–806. 2009.PubMed/NCBI | |
|
Yang W, Harris MA, Cui Y, Mishina Y, Harris SE and Gluhak-Heinrich J: Bmp2 is required for odontoblast differentiation and pulp vasculogenesis. J Dent Res. 91:58–64. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Wang Y, Li L, Zheng Y, et al: BMP activity is required for tooth development from the lamina to bud stage. J Dent Res. 91:690–695. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Rakian A, Yang WC, Gluhak-Heinrich J, et al: Bone morphogenetic protein-2 gene controls tooth root development in coordination with formation of the periodontium. Int J Oral Sci. 5:75–84. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Saito T, Ogawa M, Hata Y and Bessho K: Acceleration effect of human recombinant bone morphogenetic protein-2 on differentiation of human pulp cells into odontoblasts. J Endod. 30:205–208. 2004. View Article : Google Scholar : PubMed/NCBI | |
|
Iohara K, Nakashima M, Ito M, Ishikawa M, Nakasima A and Akamine A: Dentin regeneration by dental pulp stem cell therapy with recombinant human bone morphogenetic protein 2. J Dent Res. 83:590–595. 2004. View Article : Google Scholar : PubMed/NCBI | |
|
Yang X, van der Kraan PM, van den Dolder J, et al: STRO-1 selected rat dental pulp stem cells transfected with adenoviral-mediated human bone morphogenetic protein 2 gene show enhanced odontogenic differentiation. Tissue Eng. 13:2803–2812. 2007. View Article : Google Scholar | |
|
Yang X, Walboomers XF, van den Dolder J, et al: Non-viral bone morphogenetic protein 2 transfection of rat dental pulp stem cells using calcium phosphate nanoparticles as carriers. Tissue Eng Part A. 14:71–81. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Yang X, van der Kraan PM, Bian Z, Fan M, Walboomers XF and Jansen JA: Mineralized tissue formation by BMP2-transfected pulp stem cells. J Dent Res. 88:1020–1025. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Yang X, Walboomers XF, van den Beucken JJ, Bian Z, Fan M and Jansen JA: Hard tissue formation of STRO-1-selected rat dental pulp stem cells in vivo. Tissue Eng Part A. 15:367–375. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Lahmy R, Soleimani M, Sanati MH, Behmanesh M, Kouhkan F and Mobarra N: Pancreatic islet differentiation of human embryonic stem cells by microRNA overexpression. J Tissue Eng Regen Med. 30: View Article : Google Scholar : 2013.PubMed/NCBI | |
|
Hwang SY, Foley J, Numaga-Tomita T, Petranka JG, Bird GS and Putney JW Jr: Deletion of Orai1 alters expression of multiple genes during osteoclast and osteoblast maturation. Cell Calcium. 52:488–500. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Wei X, Wu L, Ling J, et al: Differentially expressed protein profile of human dental pulp cells in the early process of odontoblast-like differentiation in vitro. J Endod. 34:1077–1084. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Langenbach F and Handschel J: Effects of dexamethasone, ascorbic acid and β-glycerophosphate on the osteogenic differentiation of stem cells in vitro. Stem Cell Res Ther. 4:1172013. | |
|
Hitomi K, Torii Y and Tsukagoshi N: Increase in the activity of alkaline phosphatase by L-ascorbic acid 2-phosphate in a human osteoblast cell line, HuO-3N1. J Nutr Sci Vitaminol (Tokyo). 38:535–544. 1992. View Article : Google Scholar : PubMed/NCBI | |
|
Shima N, Kimoto M, Yamaguchi M and Yamagami S: Increased proliferation and replicative lifespan of isolated human corneal endothelial cells with L-ascorbic acid 2-phosphate. Invest Ophthalmol Vis Sci. 52:8711–8717. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Choi KS, Ahn SY, Kim TS, et al: Characterization and biodistribution of human mesenchymal stem cells transduced with lentiviral-mediated BMP2. Arch Pharm Res. 34:599–606. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Kutner RH, Zhang XY and Reiser J: Production, concentration and titration of pseudotyped HIV-1-based lentiviral vectors. Nat Protoc. 4:495–505. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Reiser J: Production and concentration of pseudotyped HIV-1-based gene transfer vectors. Gene Ther. 7:910–913. 2000. View Article : Google Scholar : PubMed/NCBI | |
|
Li R, Peng L, Ren L, Tan H and Ye L: Hepatocyte growth factor exerts promoting functions on murine dental papilla cells. J Endod. 35:382–388. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Choi MH, Noh WC, Park JW, Lee JM and Suh JY: Gene expression pattern during osteogenic differentiation of human periodontal ligament cells in vitro. J Periodontal Implant Sci. 41:167–175. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Yu J, Deng Z, Shi J, et al: Differentiation of dental pulp stem cells into regular-shaped dentin-pulp complex induced by tooth germ cell conditioned medium. Tissue Eng. 12:3097–3105. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Wang C, Ren L, Peng L, Xu P, Dong G and Ye L: Effect of Wnt6 on human dental papilla cells in vitro. J Endod. 36:238–243. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Chen K, Xiong H, Huang Y and Liu C: Comparative analysis of in vitro periodontal characteristics of stem cells from apical papilla (SCAP) and periodontal ligament stem cells (PDLSCs). Arch Oral Biol. 58:997–1006. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Yue J, Wu B, Gao J, et al: DMP1 is a target of let-7 in dental pulp cells. Int J Mol Med. 30:295–301. 2012.PubMed/NCBI | |
|
Feng JQ, Huang H, Lu Y, et al: The Dentin matrix protein 1 (Dmp1) is specifically expressed in mineralized, but not soft, tissues during development. J Dent Res. 82:776–780. 2003. View Article : Google Scholar : PubMed/NCBI |