Effects of icariin on the regulation of the OPG‑RANKL‑RANK system are mediated through the MAPK pathways in IL‑1β‑stimulated human SW1353 chondrosarcoma cells

  • Authors:
    • Zeming Wang
    • Li Ding
    • Sihan Zhang
    • Tao Jiang
    • Yongmian Yang
    • Rongheng Li
  • View Affiliations

  • Published online on: September 30, 2014     https://doi.org/10.3892/ijmm.2014.1952
  • Pages: 1720-1726
Metrics: HTML 0 views | PDF 0 views     Cited By (CrossRef): 0 citations

Abstract

Arthrodial cartilage degradation and subchondral bone remodeling comprise the most predominant pathological changes in osteoarthritis (OA). Moreover, accumulating evidence indicates that the abnormal expression of osteoprotegerin (OPG), receptor activator of nuclear factor kappa-B ligand (RANKL) and receptor activator of nuclear factor kappa-B (RANK) plays a vital role in the collapse of cartilage and subchondral bone. In the present study, the effects of icariin on the expression levels of these 3 factors in interleukin (IL)‑1β‑stimulated SW1353 chondrosarcoma cells were investigated. The SW1353 chondrosarcoma cells were cultured in the presence or absence of icariin and mitogen‑activated protein kinase signaling pathway inhibitors, and were then stimulated with IL‑1β. Cell viability was assessed by MTT assay. The mRNA and protein expression of OPG, RANKL and RANK was analyzed by quantitative reverse transcription polymerase chain reaction (RT-qPCR) and ELISA, respectively. In addition, the levels of phosphorylated p38 (p‑p38) and phosphorylated extracellular signal‑regulated kinase (p-ERK)1/2 were detected by western blot analysis. The results from western blot analysis revealed that treatment with icariin decreased the levels of p‑p38 and increased the levels of p‑ERK1/2 in the IL‑1β‑stimulated SW1353 cells. In addition, treatment with icariin decreased the levels of RANK and RANKL. Furthermore, the suppressive effects of icariin on OPG and OPG/RANKL were greater than those exhibited by the p38 signaling pathway inhibitor (SB203580). The findings of the the present study suggest that icariin has therapeutic potential for use in the treatment of OA.

Introduction

Arthrodial cartilage degradation, subchondral bone remodeling and osteophyte formation are involved in the development of osteoarthritis (OA) and are the result of mechanical and biological factors (1). OA is divided into 2 categories, primary and secondary OA. The prevalence of primary OA in women increases with age. Glucocorticoids and non-steroidal anti-inflammatory drugs are the recommended treatments for OA; however, these drugs are associated with elevated risks, such as gastrointestinal disorders and osteoporosis and have thus failed to obstruct the progression of OA. Due to the economic burden and limited efficacy of these drugs, safer and more well tolerated agents are required for the treatment of OA.

Although the exact mechansisms involved in the pathogenesis of OA remain to be elucidated, cartilage degradation and subchondral bone remodeling are the most commonly observed changes. Both of these processes are involved in the progression of OA and are interconnected and cannot be separated from each other; however, there is controversy as to which of these processes is the initial etiological factor in OA (2,3). In particular, OA is characterized by an imbalance in bone metabolism that results in subchondral bone osteoporosis at the early stages of OA and bone sclerosis at the late stages (2,4,5), in which the osteoprotegerin (OPG)-receptor activator of nuclear factor kappa-B ligand (RANKL)-receptor activator of nuclearfactor kappa-B (RANK) system has been proven to play a critical role (6). OPG, as a secreted member of the tumor necrosis factor receptor family, inhibits bone resorption through competitive binding to RANKL and prevents it from binding to its receptor, RANK, on the surface of osteoclasts. Therefore, the OPG/RANKL ratio is a decisive factor in bone metabolism (7). It has also been demonstrated that OPG and RANKL are detected in the superficial zone of normal articular cartilage, but extend to the middle zone of OA cartilage (8). Previous studies have found that OPG/RANKL and OPG levels are significantly decreased in chondrocytes in knee OA and in patients with OA, but are increased at the late stages of OA (811). Generally, OPG exerts dual effects based on its ability to suppress chondrocyte apoptosis (12) and alleviate growth plate cartilage destruction (13); it stimulates the production fo 2 catabolic factors, protease-activated receptor-2 (PAR-2) and matrix metalloproteinase (MMP)-13 (11); on the contrary, RANKL aggravates cartilage degradation (14). Thus, maintaining the OPG/RANKL ratio within a normal range represents a strategy for protecting cartilage. The OPG-RANKL-RANK system has been shown to be a common downstream target in OA and is inappropriately activated by interleukin (IL)-1β (15) during OA and downregulated by 1α,25(OH)2D3 (16,17). In addition, pro-inflammatory cytokines, most prominently IL-1β and 1α,25(OH)2D3, have been shown to contribute to the progression of OA by inducing the expression of OPG, RANKL and RANK. Various pathways have also been shown to mediate the expression of OPG, RANKL and RANK during the progression of OA, and these include mitogen-activated protein kinases (MAPKs) (18,19), EP2/EP4 receptor (20) and the Wnt/β-catenin signaling pathway (7).

Plant-derived agents have received considerable attention for their potential for use as substitute therapies for the treatment of OA in recent years, as they have fewer complications and multiple curative effects (21,22). For instance, icariin, a prenylated flavonol glycoside, is the cardinal active constituent of the crude extract of the herb Epimedium pubescens which has been traditionally used in the treatment of age-related diseases in Asia (23). Icariin exhibits both proliferative and anti-inflammatory (24,25) properties. It has also been reported that icariin protects chondrocytes from inflammatory and apoptotic responses and promotes extracellular matrix synthesis (22,26,27), during OA, thus preventing bone loss (28,29). Taken together, these data suggest that icariin has therapeutic potential for use in the treatment of OA.

In the present study, we aimed to determine the effects of icarrin on the expression of OPG, RANKL and RANK in SW1353 chondrosarcoma cells stimulated with IL-1β. We decided to use the SW1353 cell line in our experiments as SW1353 cells have a similar phenotype with human chondrocytes and they have been successfully used in previous scientific studies (3033). The expression of transcription factors possibly involved in the upregulation of OPG, RANKL and RANK during the development of OA, including phosphorylated p38 (p-p38) and extracellular signal-regulated kinase (ERK)1/2 was also analyzed.

Materials and methods

Cell culture and study design

SW1353 human chondrosarcoma cells (Institute of Biochemistry and Cell Biology, Shanghai, China) were cultivated in Dulbecco’s modified Eagle’s medium/nutrient (Gibco BRL, Rockville, MD, USA) containing 10% (v/v) fetal bovine serum (Gibco BRL) and 100 U/ml penicillin-streptomycin solution (Beyotime Institute of Biotechnology, Jiangsu, China) at 37°C in a humidified atmosphere under 5% CO2. The cells were seeded at a density of 106 cells in one tissue culture flask and pre-treated in the presence or absence of p38 inhibitor (SB203580; 10 μmol/l), ERK1/2 inhibitor (PD98059; 20 μmol/l) (both from Beyotime Institute of Biotechnology), or icariin (12 μg/ml) (Cayman Chemical Co., Ann Arbor, MI, USA) for 1 h, then stimulated with IL-1β (10 ng/ml) (Pepro Tech, Rocky Hill, NJ, USA) for 48 h.

MTT assay

The SW1353 cells were cultured in 96-well plates (1×104 cells/well; 3 plates) with icariin (0, 1.5, 3, 6, 12 and 24 μg/ml) and incubated for 24, 48 and 72 h. Subsequently, MTT solution was added to each well for another 4 h at the final concentration of 5 mg/ml. The supernatants were then removed, and dimethylsulphoxide was added to the wells to dissolve the formazan crystals. The A-values of each well were recorded at 570 nm using an enzyme-labeled meter (Thermo Fisher Scientific, Waltham, CA, USA) after the 96-well plates were shaken for 10 min.

Western blot analysis

Total proteins from the cells were extracted using a phosphorylated protein extraction kit (Keygen Biotech Co., Ltd., Nanjing, China). The protein concentration was determined using the bicinchoninic acid protein assay (Beyotime Institute of Biotechnology) and separated using sodium dodecyl sulfate polyacrylamide gel electrophoresis; subsequently, the proteins were transferred onto polyvinylidene difluoride (PVDF) membranes by electroblotting. The membranes were sealed at room temperature with 5% bull serum albumin (Sigma, San Antonio, TX, USA) for 2 h and then washed 3 times with Tris-buffered saline and Tween-20 (TBST) (Tris, 4.84 g; NaCl, 17.6 g; HCl, 2 ml; 0.1% Tween-20, 2 ml). The PVDF membranes were probed with primary antibodies against the p-p38 (1:1,000), p-ERK1/2 (1:2,000) (Cell Signaling Technology, Inc., Beverly, MA, USA) and glyceraldehyde 3-phosphate dehydrogenase (ImmunoWay, Biotechnology Co., Newark, DE, USA) at 4°C overnight. The membranes were then washed with TBST and incubated with peroxidase-conjugated second antibody (1:2,000) (Cell Signaling Technology) at 37°C for 2 h. These protein bands were subsequently analyzed using an enhanced chemiluminescence (ECL) Plus kit (Beyotime Institute of Biotechnology).

Quantitative reverse transcriptionpolymerase chain reaction (RT-qPCR)

Total RNA was extracted using TRIzol reagent (Invitrogen, Burlington, ON, Canada) according to the recommendations of the manufacturer. Reverse transcription was performed using the PrimeScript RT Reagent kit (Promega Madison, WI, USA) and first-strand cDNA was synthesized using the RNA PCR kit (Takara Bio, Inc., Shiga, Japan). The cDNA mixtures were diluted 1:10 in sterile distilled water (dH2O), and 5 μl aliquots were subjected to quantitatvie (real-time) PCR using 2X SYBR-Green I dye (Takara Bio) in 20 μl reactions containing dH2O 4 μl, 2X SYBR-Green I 10 μl and 0.5 μl primers (sense and antisense), as shown in Table I. The PCR primers were designed by Geneseed Biotech (Guangzhou, China). Quantitative (real-time) PCR was performed using an ABI Prism 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) with 40 cycles of 95°C for 5 min, 95°C for 15 sec and 60°C for 30 sec; measurements were made at the end of a 60°C annealing step. Data were analyzed using SmartCycler software (version 2.0). The 2−ΔΔCT method was used to calculate relative fold changes in mRNA expression. All real-time PCR experiments were performed in triplicate. The calculated values for gene expression were normalized against the levels of Homo sapiens RNA, 18S ribosomal 1 (RN18S1) ribosomal RNA.

Table I

Primers used for PCR analysis.

Table I

Primers used for PCR analysis.

TargetPrimer sequence (5′→3′)GenBank accession no.
RANKLF: GGATCACAGCACATCAGAGCAGAG
R: CCAGATGGGATGTCGGTGGCATT
NM_003701.3
RANKF: GGCACTGGATCAATGAGGCTTGT
R: CATGCTCCCTGCTGACCAAAGT
NM_003839.3
OPGF: CGGGAAAGAAAGTGGGAGCAG
R: CTTCAAGGTGTCTTGGTCGCCAT
U94332.1
18SrRNAF: CCTGGATACCGCAGCTAGGA
R: GCGGCGCAATACGAATGCCCC
NR_003286

[i] RANKL, receptor activator of nuclear factor kappa-B ligand; RANK, receptor activator of nuclear factor kappa-B; OPG, osteoprotegerin; 18SrRNA, 18S ribosomal RNA; F, forward; R, reverse.

ELISA

For the quantification of OPG and RANKL protein levels in the culture medium, the SW1353 cells were treated as described above. After 48 h, the supernatants were collected and stored at −80°C until analysis with ELISA. Human OPG and RANKL ELISA kits were purchased from Uscn Life Science Inc. (Wuhan, China). The experiments were performed in accordance with the manufacturer’s instructions.

Statistical analysis

Data are expressed as the means ± standard deviation. All data were analyzed with variance analysis. Statistical significance was assessed by one-way analysis of variance (ANOVA) or the Games-Howell test according to the homogeneity of variance, and a value of P<0.05 was considered to indicate a statistically significant difference.

Results

Effects of icariin on cell viability

As shown by MTT assay, treatment of the SW1353 cells with icariin (1.5, 3, 6 and 12 μg/ml) had a dose-dependent proliferative effect. However, the treatment of the SW1353 cells with 24 μg/ml icariin was associated with adverse effects. In a subsequent experiment, SW1353 cells cultured with icariin for 3 consecutive days revealed a time-dependent increase in proliferation. According to our results, the pro-mitogenic effect of 12 μg/ml of icariin at 48 h was superior to the effect of other doses at other time points and, therefore, this concentration and time period were used in subsequent experiments (Fig. 1).

Effects of icariin treatment on p-p38 and p-ERK1/2 expression in IL-1β-stimulated SW1353 cells

To analyze the effects of icariin on the activation of p38 and ERK1/2, the SW1353 cells were incubated in the presence or absence of 12 μg/ml of icariin, in addition to a p38 inhibitor (SB203580, 10 μM) and a ERK1/2 inhibitor (PD98059, 20 μM). After 1 h, the cells were stimulated with 10 ng/ml IL-1β. After 48 h, p-p38 and p-ERK1/2 were extracted and analyzed by western blot analysis. The expression levels of these 2 proteins were significantly elevated when the SW1353 cells were only treated with IL-1β (Fig. 2). By contrast, the levels of p-p38 decreased (Fig. 2A), while the p-ERK1/2 levels increased following treatment with icariin (Fig. 2B). In addition, western blot analysis revealed that the levels of these 2 proteins were inhibited to a greater extent by treatment with the corresponding signaling pathway-specific inhibitors than with icariin (Fig. 2). Furthermore, the difference in the expression levels was statistically significant (P<0.05).

mRNA expression of OPG, RANKL and RANK following treatment with signaling pathway inhibitors and/or icariin in IL-1β-stimulated SW1353 cells

In order to investigate the effects of icariin on OPG, RANKL and RANK expression, the SW1353 cells were treated with or without 12 μg/ml icariin for 1 h and then stimulated with 10 ng/ml IL-1β. Total RNA and cell extracts were collected 48 h later and the mRNA expression levels of OPG, RANKL and RANK levels determined detected in the cell extracts by RT-qPCR. Treatment with icariin inhibited the increase in the mRNA expression of OPG, RANKL and RANK and the OPG/RANKL ratio which was induced in response to pre-treatment with IL-1β. To further investigate the possible regulatory mechanisms, inhibitors of MAPK signaling pathways were used. Treatment with icariin induced the most significant decrease in the mRNA expression of OPG, RANKL and RANK and in the OPG/RANKL ratio, followed by the p38 inhibitor (SB203580) and ERK1/2 inhibitor (PD98059). Treatment with icariin was associated with a more prominent inhibition of OPG, RANKL, RANK expression and the OPG/RANKL ratio than treatment with the p38 signaling pathway-specific inhibitor alone (Fig. 3).

Protein expression of OPG and RANKL following treatment with signaling pathway inhibitors and icariin in IL-1β-stimulated SW1353 cells

To investigate the effects of icariin on OPG and RANKL protein expression, the supernatants were collected and analyzed using the ELISA kit. Treatment with SB203580 (p38 inhibitor) markedly decreased OPG expression and the OPG/RANKL ratio and increased RANKL protein expression, whereas treatment with PD98059 (ERK inhibitor) had the opposite effect. Consistent with the aforementioned findings, it was demonstrated that treatment with icariin inhibited the increase in OPG and RANKL protein expression and the OPG/RANKL ratio which was induced in response to pre-treatment with IL-1β. In addition, icariin treatment was associated with a more prominent inhibition of OPG expression and the OPG/RANKL ratio than treatment with the p38 signaling pathway-specific inhibitor alone (Fig. 4).

Discussion

In the present study, the effects of treatment with icariin on OPG, RANKL and RANK expression in IL-1β-stimulated SW1353 chondrosarcoma cells were investigated. In addition, these effects were associated with those on the p38 and ERK1/2 signaling pathways induced by specific signaling pathway inhibitors. As a result, it was shown that the inhibition of the increase in the expression of OPG, RANKL and RANK and the OPG/RANKL ratio by icariin treatment was partly mediated by the downregulation in p38 and the upregulation of ERK1/2.

OA is a gradual and degenerative disease, characterized by inflammation and erosion of articular cartilage and subchondral bone remodeling. Moreover, available anti-osteoarthritic drug treatments seem to be limitedly effective in treating OA, apart from surgical therapie. One reason for this failure may be the multi-factorial and organic pathogenesis of this disease (34,35). It has been previously demonstrated that agents with multiple properties derived from natural resources (36) offer new treatment opportunities and are recommended for the treatment of OA (37).

Epimedium pubescens is commonly used in traditional Chinese medicine for the nourishment of bone and the stimulation of gonadal functions. Icariin, as the main active compound, has been associated with anti-inflammatory, anti-apoptotic (22,26,27), anti-arthritic (in chondrocytes) (38) and anti-bone resorption (28,29) properties. It is widely accepted that icariin has estrogen-like and anti-osteoporotic activity and can be potentially used for the treatment of osteoporosis during the onset of primary OA (39). In a previous study, it was demonstrated that icariin protected chondrocytes from damage by reducing the activity of nuclear factor (NF)-κB and increasing the expression of nuclear factor of κ light polypeptide gene enhancer in B-cells inhibitor, α (IκBα) (38). However, although it has been demonstrated that icariin suppresses the loss of bone mass and elevates the OPG/RANKL ratio (40), the regulation of OPG, RANKL and RANK expression by icariin in chondrocytes is not yet fully understood.

IL-1β, known as a pro-inflammatory cytokine and critical catabolic factor, induces the expression of other cytokines, such as IL-8 and prostaglandin E2, and plays an important role in OA (41). The pathological microenvironment of OA chondrocytes is usually mimicked in vitro with IL-1β (42). In previous studies, IL-1β was applied in order to create a cellular model of OA using SW1353 cells, and it was found to significantly increase the expression of OPG, RANKL and RANK and the OPG/RANKL ratio (15,43). By contrast, treatment with icariin was proved effective in conserving the chondrocytes in vitro by inhibiting the excessive increase in the expression of OPG, RANKL and RANK and the OPG/RANKL ratio.

It is well known that the OPG-RANKL-RANK system plays important roles in OA, with each factor appropriately expressed. The role of these these 3 factors in OA largely involves their ability to regulate bone metabolism. Their expression has have been found in chondrocytes (11). In particular, the overexpression of OPG induces an increase in MMP-13 and PAR-2 expression (11) rather than cell pro-proliferation under appropriate levels and induces OA with chondrocalcinosis (44). Additionally, RANKL stimulates osteoclastogenesis in growth plates (45). Of these factors, the OPG-RANKL-RANK system has been the most commonly studied, but OPG- and RANKL-specific inhibitors have not gained attention as regards cartilage and chondrocytes. Therefore, therapeutic strategies focusing on prophylactic agents applied for the regulation of the OPG-RANKL-RANK system in chondrocytes are required. The present study suggests that icariin treatment inhibits the expression of OPG, RANKL and RANK and the OPG/RANKL ratio induced by IL-1β in chondrocytes. Furthermore, this suppressive effect demonstrates the therapeutic potential of icariin for use in the treatment of OA.

The mechanisms through which icariin downregulates the expression of OPG, RANKL and RANK and the OPG/RANKL ratio remains unclear. However, an increasing number of studies has demonstrated that MAPK signaling pathways and the Wnt/β-catenin signaling pathway are involved in the IL-1β-induced expression of OPG, RANKL, and RANK and the OPG/RANKL ratio (7,46). Therefore, in the present study, the molecular mechanisms mediated by icariin that result in the inhibition of OPG, RANKL and RANK expression and the OPG/RANKL ratio were investigated. It was confirmed that MAPK signaling pathways are involved in chondrocytes stimulated with IL-1β and treated with icariin.

Consequently, the inhibition of cartilage degeneration and subchondral bone remodeling is a priority for the effective treatment of OA. Additionally, maintaining the OPG/RANKL ratio within the normal range is a main issue. In the present study, the p38 inhibitor, SB203580, was found to have a suppressive effect on elevated OPG levels and the OPG/RANKL ratio, but it increased RANK and RANK levels in IL-1β-stimulated SW1353 cells, while the ERK1/2 inhibitor, PD98059, had the opposite effect. However, while the inhibition of each pathway alone partly affected the expression of OPG, RANKL and RANK and the OPG/RANKL ratio, other pathways also participate in this process. Although treatment with icariin resulted in the marked activation of the ERK1/2 pathway and the inactivation of the p38 pathway, it also had a suppressive effect on the increased RANKL and RANK levels in IL-1β-stimulated SW1353 cells cultured with icariin. Therefore, apart from the p38 and ERK1/2 pathways, other pathways, such as the c-Jun N-terminal kinase (JNK) and Wnt/β-catenin signaling pathways, are involved in this process. The ability of icariin to modulate multiple pathways suggests that icarrin has synergistic effects, thus rendering it effective as an anti-arthritic herb extract compared to other specific inhibitors of signaling pathways. Furthermore, icariin has become an effective agent for pharmacological intervention against the progression of OA.

The results of this study indicate that icariin decreases the expression of OPG, RANKL and RANK and the OPG/RANKL ratio in IL-1β-stimulated chondrocytes. This is partly achieved by inhibiting the activation of the p38 and enhancing the activation of the ERK1/2 pathways. These findings provide valuable insight into the mechanistic details of OA, which may facilitate the development of original therapeutic strategies for this disease.

Acknowledgements

The authors would like to thank Professor Weixue Tang, (Pathophysiology, Chongqing Medical University, Chongqing, China) for providing technical assistance.

References

1 

Jiao K, Niu LN, Wang MQ, et al: Subchondral bone loss following orthodontically induced cartilage degradation in the mandibular condyles of rats. Bone. 48:362–371. 2011. View Article : Google Scholar : PubMed/NCBI

2 

Prasadam I, van Gennip S, Friis T, Shi W, Crawford R and Xiao Y: ERK-1/2 and p38 in the regulation of hypertrophic changes of normal articular cartilage chondrocytes induced by osteoarthritic subchondral osteoblasts. Arthritis Rheum. 62:1349–1360. 2010. View Article : Google Scholar : PubMed/NCBI

3 

Wenham CY and Conaghan PG: New horizons in osteoarthritis. Age Ageing. 42:272–278. 2013. View Article : Google Scholar

4 

Shimizu M, Tsuji H, Matsui H, Katoh Y and Sano A: Morphometric analysis of subchondral bone of the tibial condyle in osteoarthrosis. Clin Orthop Relat Res. 229–239. 1993.PubMed/NCBI

5 

Bailey AJ, Mansell JP, Sims TJ and Banse X: Biochemical and mechanical properties of subchondral bone in osteoarthritis. Biorheology. 41:349–358. 2004.PubMed/NCBI

6 

Kearns AE, Khosla S and Kostenuik PJ: Receptor activator of nuclear factor kappaB ligand and osteoprotegerin regulation of bone remodeling in health and disease. Endocr Rev. 29:155–192. 2008. View Article : Google Scholar : PubMed/NCBI

7 

Silva I and Branco JC: Rank/Rankl/opg: literature review. Acta Reumatol Port. 36:209–218. 2011.PubMed/NCBI

8 

Komuro H, Olee T, Kuhn K, et al: The osteoprotegerin/receptor activator of nuclear factor kappaB/receptor activator of nuclear factor kappaB ligand system in cartilage. Arthritis Rheum. 44:2768–2776. 2001. View Article : Google Scholar : PubMed/NCBI

9 

Upton AR, Holding CA, Dharmapatni AA and Haynes DR: The expression of RANKL and OPG in the various grades of osteoarthritic cartilage. Rheumatol Int. 32:535–540. 2012. View Article : Google Scholar : PubMed/NCBI

10 

Kwan Tat S, Pelletier JP, Lajeunesse D, Fahmi H, Lavigne M and Martel-Pelletier J: The differential expression of osteoprotegerin (OPG) and receptor activator of nuclear factor kappaB ligand (RANKL) in human osteoarthritic subchondral bone osteoblasts is an indicator of the metabolic state of these disease cells. Clin Exp Rheumatol. 26:295–304. 2008.

11 

Kwan Tat S, Amiable N, Pelletier JP, et al: Modulation of OPG, RANK and RANKL by human chondrocytes and their implication during osteoarthritis. Rheumatology (Oxford). 48:1482–1490. 2009.PubMed/NCBI

12 

Feng ZY, He ZN, Zhang B and Chen Z: Osteoprotegerin promotes the proliferation of chondrocytes and affects the expression of ADAMTS-5 and TIMP-4 through MEK/ERK signaling. Mol Med Rep. 8:1669–1679. 2013.PubMed/NCBI

13 

Sagar DR, Ashraf S, Xu L, et al: Osteoprotegerin reduces the development of pain behaviour and joint pathology in a model of osteoarthritis. Ann Rheum Dis. 73:1558–1565. 2014. View Article : Google Scholar : PubMed/NCBI

14 

Kim N, Odgren PR, Kim DK, Marks SC Jr and Choi Y: Diverse roles of the tumor necrosis factor family member TRANCE in skeletal physiology revealed by TRANCE deficiency and partial rescue by a lymphocyte-expressed TRANCE transgene. Proc Natl Acad Sci USA. 97:10905–10910. 2000. View Article : Google Scholar

15 

Watanabe Y, Namba A, Aida Y, et al: IL-1beta suppresses the formation of osteoclasts by increasing OPG production via an autocrine mechanism involving celecoxib-related prostaglandins in chondrocytes. Mediators Inflamm. 2009:3085962009. View Article : Google Scholar : PubMed/NCBI

16 

Mandelin J, Li TF, Hukkanen M, et al: Interface tissue fibroblasts from loose total hip replacement prosthesis produce receptor activator of nuclear factor-kappaB ligand, osteoprotegerin, and cathepsin K. J Rheumatol. 32:713–720. 2005.

17 

Palmqvist P, Persson E, Conaway HH and Lerner UH: IL-6, leukemia inhibitory factor, and oncostatin M stimulate bone resorption and regulate the expression of receptor activator of NF-kappa B ligand, osteoprotegerin, and receptor activator of NF-kappa B in mouse calvariae. J Immunol. 169:3353–3362. 2002. View Article : Google Scholar : PubMed/NCBI

18 

Kusumi A, Sakaki H, Kusumi T, et al: Regulation of synthesis of osteoprotegerin and soluble receptor activator of nuclear factor-kappaB ligand in normal human osteoblasts via the p38 mitogen-activated protein kinase pathway by the application of cyclic tensile strain. J Bone Miner Metab. 23:373–381. 2005. View Article : Google Scholar

19 

Wang YD, Tao MF, Wang L, Cheng WW and Wan XP: Selective regulation of osteoblastic OPG and RANKL by dehydroepiandrosterone through activation of the estrogen receptor β-mediated MAPK signaling pathway. Horm Metab Res. 44:494–500. 2012.PubMed/NCBI

20 

Moreno-Rubio J, Herrero-Beaumont G, Tardio L, Alvarez-Soria MA and Largo R: Nonsteroidal antiinflammatory drugs and prostaglandin E(2) modulate the synthesis of osteoprotegerin and RANKL in the cartilage of patients with severe knee osteoarthritis. Arthritis Rheum. 62:478–488. 2010. View Article : Google Scholar : PubMed/NCBI

21 

Ying X, Chen X, Cheng S, Shen Y, Peng L and Xu HZ: Piperine inhibits IL-β induced expression of inflammatory mediators in human osteoarthritis chondrocyte. Int Immunopharmacol. 17:293–299. 2013.

22 

Zeng L, Wang W, Rong XF, et al: Chondroprotective effects and multi-target mechanisms of Icariin in IL-1 beta-induced human SW 1353 chondrosarcoma cells and a rat osteoarthritis model. Int Immunopharmacol. 18:175–181. 2014. View Article : Google Scholar : PubMed/NCBI

23 

Schluesener JK and Schluesener H: Plant polyphenols in the treatment of age-associated diseases: revealing the pleiotropic effects of icariin by network analysis. Mol Nutr Food Res. 58:49–60. 2014. View Article : Google Scholar : PubMed/NCBI

24 

Ma HR, Wang J, Chen YF, Chen H, Wang WS and Aisa HA: Icariin and icaritin stimulate the proliferation of SKBr3 cells through the GPER1-mediated modulation of the EGFR-MAPK signaling pathway. Int J Mol Med. 33:1627–1634. 2014.PubMed/NCBI

25 

Zhang X, Liu T, Huang Y, Wismeijer D and Liu Y: Icariin: does it have an osteoinductive potential for bone tissue engineering? Phytother Res. 28:498–509. 2014. View Article : Google Scholar : PubMed/NCBI

26 

Liu MH, Sun JS, Tsai SW, Sheu SY and Chen MH: Icariin protects murine chondrocytes from lipopolysaccharide-induced inflammatory responses and extracellular matrix degradation. Nutr Res. 30:57–65. 2010. View Article : Google Scholar : PubMed/NCBI

27 

Zhang L, Zhang X, Li KF, et al: Icariin promotes extracellular matrix synthesis and gene expression of chondrocytes in vitro. Phytother Res. 26:1385–1392. 2012. View Article : Google Scholar : PubMed/NCBI

28 

Li GW, Xu Z, Chang SX, Nian H, Wang XY and Qin LD: Icariin prevents ovariectomy-induced bone loss and lowers marrow adipogenesis. Menopause. 21:1007–1016. 2014. View Article : Google Scholar : PubMed/NCBI

29 

Pei Z, Zhang F, Niu Z and Shi S: Effect of icariin on cell proliferation and the expression of bone resorption/formation-related markers in human periodontal ligament cells. Mol Med Rep. 8:1499–1504. 2013.PubMed/NCBI

30 

Wang JJ, Huan SK, Hsieh KH, et al: Inhibitory effect of midazolam on MMP-9, MMP-1 and MMP-13 expression in PMA-stimulated human chondrocytes via recovery of NF-κB signaling. Arch Med Sci. 9:332–339. 2013.PubMed/NCBI

31 

Choi YS, Park JK, Kang EH, et al: Cytokine signaling-1 suppressor is inducible by IL-1beta and inhibits the catabolic effects of IL-1beta in chondrocytes: its implication in the paradoxical joint-protective role of IL-1beta. Arthritis Res Ther. 15:R1912013. View Article : Google Scholar : PubMed/NCBI

32 

Furumatsu T, Matsumoto E, Kanazawa T, et al: Tensile strain increases expression of CCN2 and COL2A1 by activating TGF-β-Smad2/3 pathway in chondrocytic cells. J Biomech. 46:1508–1515. 2013.PubMed/NCBI

33 

Jia P, Chen G, Zhou G, Zhong Y and Li R: Fuyuan Decoction inhibits nitric oxide production via inactivation of nuclear factor-κB in SW1353 chondrosarcoma cells. J Ethnopharmacol. 146:853–858. 2013.PubMed/NCBI

34 

van der Kraan PM: Understanding developmental mechanisms in the context of osteoarthritis. Curr Rheumatol Rep. 15:3332013.PubMed/NCBI

35 

Naumov AV: Current possibilities of correcting subchondral bone resorption as a major pathogenetic factor for progressive osteoarthrosis. Ter Arkh. 86:60–65. 2014.(In Russian).

36 

Saller R and Rostock M: Multimorbidity and multi-target-therapy with herbal drugs. Praxis (Bern 1994). 101:1637–1642. 2012.(In German).

37 

Zheng CS, Xu XJ, Ye HZ, et al: Network pharmacology-based prediction of the multi-target capabilities of the compounds in Taohong Siwu decoction, and their application in osteoarthritis. Exp Ther Med. 6:125–132. 2013.PubMed/NCBI

38 

Zhang W, Li R, Wang S, Zhou X and Zhong Y: Study of molecular mechanisms of fuyuan capsule, icariin and arasaponin R1 in treatment of osteoarthritis. Zhongguo Zhong Yao Za Zhi. 36:2113–2117. 2011.(In Chinese).

39 

Yang L, Yu Z, Qu H and Li M: Comparative effects of hispidulin, genistein, and icariin with estrogen on bone tissue in ovariectomized rats. Cell Biochem Biophys. 70:485–490. 2014. View Article : Google Scholar : PubMed/NCBI

40 

Mok SK, Chen WF, Lai WP, et al: Icariin protects against bone loss induced by oestrogen deficiency and activates oestrogen receptor-dependent osteoblastic functions in UMR 106 cells. Br J Pharmacol. 159:939–949. 2010. View Article : Google Scholar : PubMed/NCBI

41 

Daheshia M and Yao JQ: The interleukin 1beta pathway in the pathogenesis of osteoarthritis. J Rheumatol. 35:2306–2312. 2008. View Article : Google Scholar : PubMed/NCBI

42 

Roman-Blas JA, Contreras-Blasco MA, Largo R, Alvarez-Soria MA, Castaneda S and Herrero-Beaumont G: Differential effects of the antioxidant n-acetylcysteine on the production of catabolic mediators in IL-1beta-stimulated human osteoarthritic synoviocytes and chondrocytes. Eur J Pharmacol. 623:125–131. 2009. View Article : Google Scholar : PubMed/NCBI

43 

Haynes DR, Barg E, Crotti TN, et al: Osteoprotegerin expression in synovial tissue from patients with rheumatoid arthritis, spondyloarthropathies and osteoarthritis and normal controls. Rheumatology (Oxford). 42:123–134. 2003. View Article : Google Scholar : PubMed/NCBI

44 

Ramos YF, Bos SD, van der Breggen R, et al: A gain of function mutation in TNFRSF11B encoding osteoprotegerin causes osteoarthritis with chondrocalcinosis. Ann Rheum Dis. Apr 17–2014.(Epub ahead of print).

45 

Usui M, Xing L, Drissi H, et al: Murine and chicken chondrocytes regulate osteoclastogenesis by producing RANKL in response to BMP2. J Bone Miner Res. 23:314–325. 2008. View Article : Google Scholar : PubMed/NCBI

46 

Kusumi A, Kusumi T, Miura J and Tateishi T: Passage-affected competitive regulation of osteoprotegerin synthesis and the receptor activator of nuclear factor-kappaB ligand mRNA expression in normal human osteoblasts stimulated by the application of cyclic tensile strain. J Bone Miner Metab. 27:653–662. 2009. View Article : Google Scholar

Related Articles

Journal Cover

December 2014
Volume 34 Issue 6

Print ISSN: 1107-3756
Online ISSN:1791-244X

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
APA
Wang, Z., Ding, L., Zhang, S., Jiang, T., Yang, Y., & Li, R. (2014). Effects of icariin on the regulation of the OPG‑RANKL‑RANK system are mediated through the MAPK pathways in IL‑1β‑stimulated human SW1353 chondrosarcoma cells. International Journal of Molecular Medicine, 34, 1720-1726. https://doi.org/10.3892/ijmm.2014.1952
MLA
Wang, Z., Ding, L., Zhang, S., Jiang, T., Yang, Y., Li, R."Effects of icariin on the regulation of the OPG‑RANKL‑RANK system are mediated through the MAPK pathways in IL‑1β‑stimulated human SW1353 chondrosarcoma cells". International Journal of Molecular Medicine 34.6 (2014): 1720-1726.
Chicago
Wang, Z., Ding, L., Zhang, S., Jiang, T., Yang, Y., Li, R."Effects of icariin on the regulation of the OPG‑RANKL‑RANK system are mediated through the MAPK pathways in IL‑1β‑stimulated human SW1353 chondrosarcoma cells". International Journal of Molecular Medicine 34, no. 6 (2014): 1720-1726. https://doi.org/10.3892/ijmm.2014.1952