Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
December-2014 Volume 34 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2014 Volume 34 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Effects of ornithine decarboxylase antizyme 1 on the proliferation and differentiation of human oral cancer cells

  • Authors:
    • Xing Wang
    • Li Jiang
  • View Affiliations / Copyright

    Affiliations: Guangdong General Hospital, Guangdong Academy of Medical Sciences, Guangzhou, Guangdong 510080, P.R. China
  • Pages: 1606-1612
    |
    Published online on: October 10, 2014
       https://doi.org/10.3892/ijmm.2014.1961
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Ornithine decarboxylase antizyme 1 (OAZ1) is an antizyme targeting ornithine decarboxylase for degradation, subsequently inhibiting polyamine production to prevent cell proliferation. OAZ1 is also involved in other major cellular events, including differentiation and apoptosis. Recent studies have shown that OAZ1 has tumor suppressor activities and its effects on cell proliferation and differentiation have been reported in several cancer cell lines. To explore the role of OAZ1 in human oral cancer, the effects of OAZ1 were studied on the proliferation and differentiation of human malignant oral cancer cell line, SCC15. MTT assay and flow cytometry analysis showed that stable OAZ1 expression in SCC15 significantly inhibited cell proliferation (P<0.001) and induced G0/G1 arrest with the G1‑phase cells increased from 55.83 to 65.26%. Morphological observation revealed the increased formation of epithelial islands. Further results from quantitative reverse transcription‑polymerase chain reaction and western blot analysis proved the upregulation of several terminal differentiation marker genes (K10, FLG and LOR) in OAZ1‑expressed SCC15 cells. To elucidate the possible mechanism of LOR upregulation by OAZ1, further experiments were performed and it was found that the OAZ1 expression inhibited Smad nuclear interacting protein 1 (SNIP1) at the protein level and RNA interference of SNIP1 in SCC15 cells, which increased the expression of LOR. These results show that OAZ1 simultaneously inhibits the proliferation and induces the differentiation of oral cancer cells in humans. The effects on cellular differentiation depend partly on the degradation of SNIP1.

Introduction

Ornithine decarboxylase antizyme 1 (OAZ1) is a member of the ornithine decarboxylase (ODC) antizyme family, which targets ODC for ubiquitin-independent proteasome degradation, thereby inhibiting the synthesis of polyamines and cell proliferation (1). OAZ1 can also inhibit cell growth through ODC-independent mechanisms, including the inhibition of cellular uptake of polyamines by inactivating the polyamine uptake transporter, promoting cyclin D1 degradation and preventing ubiquitin-independent msp1 degradation (2–5). Studies of cancer have also proved that OAZ1 has tumor suppressor activities and it can affect the apoptosis and proliferation of multiple tumor cell lines (6–8).

Several investigators have studied the involvement of OAZ1 in tongue squamous cell carcinoma (TSCC). In p53-knockout mice, overexpression of the OAZ1 protein inhibited the production of keratinocyte proliferation marker, keratin 6 (K6), whereas it upregulated the expression of keratinocyte differentiation marker, loricrin (LOR) (9). In hamster malignant oral keratinocytes, ectopic expression of OAZ1 induced epithelial differentiation with the overexpression of involucrin (IVL) (10). In several human oral cancer cell lines, the expression level of the OAZ1 gene was downregulated (11,12). A previous study has shown that OAZ1 induces the conversion of the human tongue squamous cancer cell line, UM1, to the less metastatic type, UM2, with the hypomethylation of genome DNA and histone H3 lysine 9 dimethylation (12). However, the overall effects of OAZ1 on cellular proliferation and differentiation in human oral cancer cells and the underlying mechanism remain to be studied.

In the present study, the lentiviral vector containing the OAZ1 gene was constructed and transfected into the human tongue cancer cell line, SCC15, to evaluate the effects of OAZ1 expression on proliferation and differentiation of the cells. The results showed that the stable expression of OAZ1 in SCC15 inhibited the cell proliferation rate and induced G0/G1 arrest. OAZ1 expression also induced the formation of epithelial islands with elevation of several differentiation marker genes (K10, FLG and LOR). OAZ1 was also found to inhibit Smad nuclear interacting protein 1 (SNIP1) and silencing of SNIP1 increased the expression of LOR in SCC15 cells. The results of the study proved that OAZ1 can simultaneously inhibit proliferation and induce differentiation of oral cancer cells in humans.

Materials and methods

Cell culture and transfection

The human oral cancer cell line, SCC15, was obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA) and maintained in Dulbecco’s modified Eagles medium/F12 medium supplemented with 10% (v/v) fetal bovine serum at 37°C in 5% CO2. The lentiviral vector (pLVX-Neo-IRES-ZsGreen) containing the green fluorescent protein (GFP) gene, ZsGreen, was ligated to OAZ1 cDNA (loss of the frameshift site) to construct the stable expression vector of OAZ1 (13). The cells were transferred to 6-well plates and the OAZ1-containing vector or control vector was transfected. When GFP was expressed, G418 (1,000 μg/ml) and flow cytometry were used to screen the stably transfected clones. SCC15 cells transfected with the OAZ1-expressed vector or the negative-control vector are referred as SCC15/OAZ1 and SCC15/GFP.

Cell proliferation assay

Cells (1×104/well) were transferred in 3 replicates to 96-well plates and cultured on standard conditions. At the time-points of 24, 48 and 72 h, the viability of the cells was analyzed after the addition of 20 μl MTT (5 mg/ml) and dimethyl sulfoxide. Absorbance was determined using the Multiskan MK3 Microplate Reader (Thermo Scientific, Waltham, MA, USA) at a wavelength of 490 nm.

Cell cycle assay

Cells (2×105/well) were transferred in 3 replicates to 6-well plates. After 24 h of starvation, the cells were recovered for 36 h before analysis. The cells were treated according to the manufacturer’s instructions for the cell cycle detection kit (Nanjing KeyGen Biotech, Nanjing, China) and submitted to flow cytometric analysis.

Morphological observation

Cells (1×103/well) were plated in 100×20 mm plates and observed under an inverted microscope after 1 week.

RNA interference

SNIP1-specific small hairpin RNA (shRNA) (GeneChem Co., Ltd., Shanghai, China) including sh-400 (5′-ATGCTGCTTTGAACAAGAC-3′), sh-401 (5′-TCGATGTATGTACATGACT-3′), sh-402 (5′-TTAGAC GTTCTCCTTTGGT-3′) and the negative control, sh-NC (5′-TTCTCCGAACGTGTCACGT-3′), were synthesized. SCC15 cells were transferred to 6-well plates. When the cells reached 80% confluent, shRNA was transfected with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) in 250 μl Opti-MEM (Gibco, Carlsbad, CA, USA). Sh-NC was used as the negative control.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis

Total RNA was isolated using the RNAiso plus kit (Takara Bio, Inc., Shiga, Japan). Full-length cDNA was generated using the PrimeScript RT reagent kit (Takara, Dalian, China). cDNA was subjected to RT-qPCR analysis using SYBR-Green I (Takara) and results are reported as the ratio alteration among groups. The primers used are presented in Table I.

Table I

Primers used for RT-qPCR.

Table I

Primers used for RT-qPCR.

PrimerSequence (5′→3′)Product length (bp)
OAZ1 (NM_004152)F: TCTCCCTCCACTGCTGTAGTAACC
R: GTTGAGAATCCTCGTCTTGTCGTT
198
E-cadherin (NM_004360)F: CTACAATGCCGCCATCGCTTA
R: CACTGATGACTCCTGTGTTCCTGTT
98
K1 (NM_006121)F: CGGAACTGAAGAACATGCAG
R: CATATAAGCACCATCCACATCC
128
K6A (NM_005554)F: CAAGGCCCAATATGAGGAGA
R: GCAATCTCCTGCTTGGTGTT
135
K10 (NM_000421)F: AAACCATCGATGACCTTAAAAATC
R: GCGCAGAGCTACCTCATTCT
134
K19 (NM_002276)F: GCCACTACTACACGACCATCC
R: CAAACTTGGTTCGGAAGTCAT
126
FLG (NM_002016)F: TTTCGGCAAATCCTGAAGAATCC
R: ACTGTGCTTTCTGTGCTTGTG
195
IVL (NM_005547)F: CTGCCTCAGCCTTACTGTGA
R: TGGGTATTGACTGGAGGAGG
133
LOR (NM_000427)F: GCACCGATGGGCTTAGAG
R: AGAAACCAAAGAGGCTAAACAG
130
SNIP1 (NM_024700)F: AAGAAGCAAGTCTCCTCGCAG
R: GTTCTGATGGTTCCCTGTGCT
128
GAPDH (NM_002046)F: CGCTGAGTACGTCGTGGAGTC
R: GCTGATGATCTTGAGGCTGTTGTC
172
Immunoblotting

The cells were washed twice in phospate-buffered saline and lysed in radio-immunoprecipitation assay lysis buffer (with phenylmethanesulfonyl fluoride). Equal amounts of total protein were separated by 12% SDS-PAGE, transferred to a polyvinylidene fluoride membrane (Millipore, Bedford, MA, USA) and probed with OAZ1 (Abcam, Hong Kong, China); K1, K10, IVL, LOR, filaggrin (FLG) and SNIP1 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA); and GAPDH (Cell Signaling Technology, Shanghai, China) antibodies and subsequently with the horseradish peroxidase-conjugated secondary antibody. The blots were evaluated with the ECL detection system (Advansta, Menlo Park, CA, USA). The protein bands of interest were quantified using FluorChem 8900 image analysis software (Alpha Innotech, San Leandro, CA, USA), and the integrated signal densities were normalized to GAPDH first, and subsequently expressed in terms of the fractional abundance relative to the control cells. These experiments were replicated 3 times.

Statistical analysis

SPSS 16.0 (SPSS, Inc., Chicago, IL, USA) was used for statistical analysis. Data are presented as means ± standard deviation. One-way analysis of variance was used and P<0.05 was considered to indicate a statistically significant difference.

Results

Overexpression of OAZ1 induces morphological changes in SCC15 cells

The lentiviral vector expressing OAZ1 and GRF (ZsGreen), and the control vector expressing GFP were transfected into SCC15 cells separately and stable expression of GFP was observed in the two groups (Fig. 1A and B). Quantitative analysis showed that the mRNA level of OAZ1 was significantly elevated in the OAZ1-transfected group (Fig. 1C). The OAZ1 protein expression was verified by western blotting (Fig. 1D). The cells transfected with the control vector (Fig. 2C and D) demonstrated the typical appearance of SCC15 (Fig. 2A and B). However, the appearance of the OAZ1 transfectants exhibited evidence of epithelial island formation and increased cellular junctions indicating the terminal differentiation of the cells (Fig. 2E and F).

Figure 1

Expression of ornithine decarboxylase antizyme 1 (OAZ1) in SCC15 cells. (A and B) Green fluorescent protein (GFP) expression detected by florescence microscope (magnification, ×200) in SCC15 cells transfected with the (A) OAZ1-expressed vector or (B) control vector. (C–E) Confirmation of OAZ1 expression by (C) reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and (D and E) western blotting. *P<0.05 and **P<0.01 compared to the other groups.

Figure 2

(A and B) Effect of ornithine decarboxylase antizyme 1 (OAZ1) overexpression on cell morphology in SCC15 cells (magnification, ×100). SCC15 cells without treatment under a (A) regular or (B) fluorescence microscope. (C and D) SCC15 cells transfected with the control vector under a (C) regular or (D) florescence microscope. (E and F) SCC15 cells transfected with OAZ1-contained vector under a (E) regular or (F) florescence microscope.

OAZ1 affects the expression of marker genes in cell differentiation

OAZ1-transfected SCC15 cells showed morphological alterations indicating terminal differentiation. To further confirm the effects of OAZ1 on the differentiation of SCC15, the expression of several reported differentiation marker genes were examined. Elevation of early terminal differentiation genes, K1, K10 and IVL, was observed in OAZ1-expression cells. As for late terminal differentiation genes, the elevation of FLG and LOR was also observed, whereas the mRNA level of E-cadherin remained stable (Fig. 3A). When detected by western blot analysis, K10, LOR and FLG showed increased expression on protein level (Fig. 3C–E).

Figure 3

Effects of ornithine decarboxylase antizyme 1 (OAZ1) on differentiation and proliferation markers in SCC15 cells. (A and B) Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis of the (A) differentiation [keratin 1 (K1), K10, filaggrin (FLG), involucrin (IVL), loricrin (LOR) and E-cadherin] and (B) proliferation markers (K6A and K19) among the different groups. (C–E) Western blotting detection of (C) K1, IVL, (D) K10, LOR and (E) FLG among the different groups. *P<0.05 and **P<0.01 compared to the other groups.

OAZ1 inhibits the proliferation of SCC15 cells

MTT assay was performed to detect the effects of OAZ1 expression on the proliferation of SCC15. Compared to the control, SCC15 cells stably expressing OAZ1 showed a significant reduction in the cell growth rate (P<0.001 compared to the other groups) (Fig. 4), indicating that OAZ1 expression inhibited the proliferation of SCC15.

Figure 4

Ornithine decarboxylase antizyme 1 (OAZ1) inhibits cell proliferation in SCC15 cells. The curves show the viability of SCC15 cells detected by MTT analysis in the different groups.

The cell cycle profiles of the OAZ1-transfected SCC15 cells and the control cells were further examined (Fig. 5). The flow cytometry analysis showed that the cells in the G1 phase were increased in OAZ1-expressed SCC15 cells (65.26%) compared to the control (55.83%). Whereas cells in the S phase were decreased to 30.07% compared to the control (42.47%) (Table II). These results indicate that OAZ1 may inhibit the cell proliferation through induction of G0/G1 arrest.

Figure 5

Ornithine decarboxylase antizyme 1 (OAZ1) affects the cell cycle in SCC15 cells. Flow cytometry analysis of (A) untreated SCC15 cells, (B) cells transfected with the control vector and (C) cells transfected with the OAZ1-contained vector.

Table II

Effect of OAZ1 on cell cycle in SCC15 cells.

Table II

Effect of OAZ1 on cell cycle in SCC15 cells.

GroupsG1, %S, (%)G2, %
SCC1555.83±5.9542.47±4.491.73±1.57
SCC15/GFP54.83±4.4344.17±3.691.36±1.52
SCC15/OAZ165.26±3.32a30.07±4.42b4.64± 2.58

a P<0.05 and

b P<0.01 compared to the other groups.

{ label (or @symbol) needed for fn[@id='tfn3-ijmm-34-06-1606'] } OAZ1, ornithine decarboxylase antizyme 1.

The expression of two genes reported to be elevated during epithelial cell proliferation, K6A and K19, were also investigated. RT-qPCR results showed that K19 expression was significantly elevated (P<0.05), and the level of K6A remained stable (Fig. 3B).

OAZ1 inhibits LOR by promoting SNIP1 degradation

OAZ1 can induce the degradation of SNIP1, leading to the release of CREB-binding protein (CBP), a key factor in the regulation of LOR transcription (14,15). To further explore the mechanism of LOR upregulation by OAZ1, the expression of SNIP1 in OAZ1-transfected cells was examined. The SNIP1 protein level was downregulated (Fig. 6B) in OAZ1 transfectants. The RNA interference experiment showed that inhibition of SNIP1 in the SCC15 cells induces the expression of LOR (Fig. 6A, C and D). These results indicate that OAZ1 may increase LOR expression through the degradation of SNIP1.

Figure 6

Ornithine decarboxylase antizyme 1 (OAZ1) induced LOR expression through degradation of Smad nuclear interacting protein 1 (SNIP1). Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis of (A) SNIP1 and (C) Loricrin (LOR) expression in the different siRNA silencing groups (sh-400, sh-401 and sh-402) of SNIP1 and the control (sh-NC). (B) Western blot analysis of SNIP1 in the OAZ1-transfected group and control. (D) Western blot analysis of SNIP1 and LOR in the SNIP1-silencing group and the control. *P<0.05 and **P<0.01 compared to the control group.

Discussion

OAZ1 is an important regulator of cellular differentiation and proliferation. Studies have focused on its unique frameshift regulation mechanism, function in regulating polyamine metabolism and ability of inducing ubiquitin-independent degradation of numerous large molecules. Previously, it has been reported that OAZ1 has tumor suppressor activities and it can affect the apoptosis and proliferation of multiple tumor cell lines (6–8,16). There is also evidence that overexpression of OAZ1 can induce the differentiation of certain cancer cells (10,11,17). The mechanism underlying the tumor suppressor activity of OAZ1 remains unclear and further exploration may help with the understanding.

TSCC is one of the most common malignant oral tumors. Previous studies of the oral cancer cell line UM1 have proved that TSCC is an appropriate model to investigate the detailed molecular mechanisms of differentiation and proliferation regulation in oral cancer development (11,12). In the present study, the human TSCC cell line SCC15 was studied and a lentivirial vector was constructed that stably expresses the frame shift form of OAZ1 to continuously trigger the degradation of ODC. The expression of OAZ1 in SCC15 was verified by western blot analysis. Morphological study showed that the cells overexpressing OAZ1 exhibit the formation of more epithelial islands, which is a marker of terminal differentiation of epithelial cells. This is also consistent with the study on the hamster oral cancer cell line, HCPC-1 (10).

To elucidate the mechanism of OAZ1-induced cell differentiation in SCC15 cells, the expression of several terminal differentiation-associated genes was examined, including K1, K10, FLG, IVL and LOR. All these genes are marker genes in epithelial differentiation that have decreased expression in epithelial cancer cells, which is resumed during differentiation (18–25). In hamster oral cancer cells, OAZ1 has been proved to promote the expression of LOR and IVL (9,10). In the present study, OAZ1-expressed SCC15 cells showed significantly increased expression of the majority of the marker genes assessed, confirming the positive role of OAZ1 in epithelial differentiation. The gene involved in cellular junction, E-cadherin, was also examined as closer conjunction of cells expressing OAZ1 was observed and E-cadherin is reduced in squamous carcinoma (26). However, the mRNA level of E-cadherin showed no significant difference between the OAZ1-transfected SCC15 and control cells, which is consistent with a previous study (11). This suggests that factors other than E-cadherin may be involved in the induction of closer cellular junctions for this condition.

The mechanism underlying the induction of LOR expression in OAZ1-expressed SCC15 cells was further explored. LOR is the component of the cell membrane in terminal differentiated keratinocytes and p300/CBP can function as a bridge during its transcription-activator complex formation (15). SNIPI has been reported to competitively inhibit the binding of CBP in the promotor region, leading to the inhibition of transcription (14,27). The present study showed that OAZ1 overexpression promoted the degradation of SNIP1 and the silencing of SNIP1 by RNA interference resumed the level of LOR in SCC15 cells. These results indicate that OAZ1 may induce LOR expression partly through SNIP1 degradation.

For the study of cell proliferation in OAZ1-expressing SCC15 cells, the results showed that overexpression of the antizyme significantly inhibited cell proliferation with G0/G1 arrest. Two genes, K6A and K19, were further examined that are elevated during epithelial proliferation (9,26). However, the results of RT-qPCR showed that K19 expression was elevated instead of reduced and the level of K6A remained stable. OAZ1 is assumed to inhibit the proliferation of SCC15 cells without the involvement of regulating K6A and K19 expression.

In conclusion, the study showed that OAZ1 induced the formation of epithelial islands with significant upregulation of epithelial terminal differentiation marker genes in SCC15. OAZ1 expression also inhibited cell proliferation and induced G0/G1 arrest. OAZ1 simultaneously inhibited proliferation and induced differentiation of oral cancer cells in humans. This may be a novel perspective to consider in the induction of tumor cell differentiation, particularly in human oral cancer.

Acknowledgements

The present study was supported by the National Natural Science Foundation of China (grant no. 30901757), the Natural Science Foundation of Guangdong Province (grant no. 10151008004000028) and the Leading Talent Project of Guangdong Province.

References

1 

Kahana C: Antizyme and antizyme inhibitor, a regulatory tango. Cell Mol Life Sci. 66:2479–2488. 2009. View Article : Google Scholar : PubMed/NCBI

2 

Newman RM, Mobascher A, Mangold U, et al: Antizyme targets cyclin D1 for degradation. A novel mechanism for cell growth repression. J Biol Chem. 279:41504–41511. 2004. View Article : Google Scholar : PubMed/NCBI

3 

Kasbek C, Yang CH, Yusof AM, Chapman HM, Winey M and Fisk HA: Preventing the degradation of mps1 at centrosomes is sufficient to cause centrosome reduplication in human cells. Mol Biol Cell. 18:4457–4469. 2007. View Article : Google Scholar : PubMed/NCBI

4 

Kasbek C, Yang CH and Fisk HA: Mps1 as a link between centrosomes and genomic instability. Environ Mol Mutagen. 50:654–665. 2009. View Article : Google Scholar : PubMed/NCBI

5 

Kasbek C, Yang CH and Fisk HA: Antizyme restrains centrosome amplification by regulating the accumulation of Mps1 at centrosomes. Mol Biol Cell. 21:3878–3889. 2010. View Article : Google Scholar : PubMed/NCBI

6 

Dulloo I, Gopalan G, Melino G, et al: The antiapoptotic DeltaNp73 is degraded in a c-Jun-dependent manner upon genotoxic stress through the antizyme-mediated pathway. Proc Natl Acad Sci USA. 107:4902–4907. 2010. View Article : Google Scholar : PubMed/NCBI

7 

Feith DJ, Origanti S, Shoop PL, Sass-Kuhn S and Shantz LM: Tumor suppressor activity of ODC antizyme in MEK-driven skin tumorigenesis. Carcinogenesis. 27:1090–1098. 2006. View Article : Google Scholar : PubMed/NCBI

8 

Tsuji T, Todd R, Meyer C, et al: Reduction of ornithine decarboxylase antizyme (ODC-Az) level in the 7,12-dimethylbenz(a)anthracene-induced hamster buccal pouch carcinogenesis model. Oncogene. 16:3379–3385. 1998. View Article : Google Scholar

9 

Feith DJ, Pegg AE and Fong LY: Targeted expression of ornithine decarboxylase antizyme prevents upper aerodigestive tract carcinogenesis in p53-deficient mice. Carcinogenesis. 34:570–576. 2013. View Article : Google Scholar : PubMed/NCBI

10 

Tsuji T, Usui S, Aida T, et al: Induction of epithelial differentiation and DNA demethylation in hamster malignant oral keratinocyte by ornithine decarboxylase antizyme. Oncogene. 20:24–33. 2001. View Article : Google Scholar : PubMed/NCBI

11 

Tsuji T, Katsurano M, Ibaragi S, Shima K, Sasaki A and Hu GF: Ornithine decarboxylase antizyme upregulates DNA-dependent protein kinase and enhances the nonhomologous end-joining repair of DNA double-strand breaks in human oral cancer cells. Biochemistry. 46:8920–8932. 2007. View Article : Google Scholar

12 

Yamamoto D, Shima K, Matsuo K, et al: Ornithine decarboxylase antizyme induces hypomethylation of genome DNA and histone H3 lysine 9 dimethylation (H3K9me2) in human oral cancer cell line. PLoS One. 5:e125542010. View Article : Google Scholar : PubMed/NCBI

13 

Wu BP, Wang X, Ma WL, Zhang SY, Zheng WL and Jiang L: Effect of ornithine decarboxylase antizyme 1 on the erythroid differentiation in human leukemia cell line K562. Chin J Biochem Mol Biol. 29:361–367. 2013.

14 

Lin Y, Martin J, Gruendler C, et al: A novel link between the proteasome pathway and the signal transduction pathway of the bone morphogenetic proteins (BMPs). BMC Cell Biol. 3:152002. View Article : Google Scholar : PubMed/NCBI

15 

Jang SI and Steinert PM: Loricrin expression in cultured human keratinocytes is controlled by a complex interplay between transcription factors of the Sp1, CREB, AP1, and AP2 families. J Biol Chem. 277:42268–42279. 2002. View Article : Google Scholar : PubMed/NCBI

16 

Liu GY, Liao YF, Hsu PC, et al: Antizyme, a natural ornithine decarboxylase inhibitor, induces apoptosis of haematopoietic cells through mitochondrial membrane depolarization and caspases’ cascade. Apoptosis. 11:1773–1788. 2006.PubMed/NCBI

17 

Suzuki J, Murakami Y, Samejima K, Ohtani KK and Oka T: Antizyme is necessary for conversion of pancreatic tumor cells into glucagon-producing differentiated cells. Endocr Relat Cancer. 16:649–659. 2009. View Article : Google Scholar : PubMed/NCBI

18 

Wu N, Sulpice E, Obeid P, Benzina S, Kermarrec F, Combe S and Gidrol X: The miR-17 family links p63 protein to MAPK signaling to promote the onset of human keratinocyte differentiation. PLoS One. 7:e457612012. View Article : Google Scholar : PubMed/NCBI

19 

Woelfle U, Laszczyk MN, Kraus M, et al: Triterpenes promote keratinocyte differentiation in vitro, ex vivo and in vivo: a role for the transient receptor potential canonical (subtype) 6. J Invest Dermatol. 130:113–123. 2010. View Article : Google Scholar : PubMed/NCBI

20 

Robertson ED, Weir L, Romanowska M, Leigh IM and Panteleyev AA: ARNT controls the expression of epidermal differentiation genes through HDAC- and EGFR-dependent pathways. J Cell Sci. 125:3320–3332. 2012. View Article : Google Scholar : PubMed/NCBI

21 

Chan KS, Sano S, Kataoka K, et al: Forced expression of a constitutively active form of Stat3 in mouse epidermis enhances malignant progression of skin tumors induced by two-stage carcinogenesis. Oncogene. 27:1087–1094. 2008. View Article : Google Scholar

22 

Kawachi Y, Fujisawa Y, Furuta J, Nakamura Y, Ishii Y and Otsuka F: Superficial epithelioma with sebaceous differentiation: immunohistochemical study of keratinocyte differentiation markers. Eur J Dermatol. 21:1016–1017. 2011.

23 

Tu CL, Chang W and Bikle DD: The calcium-sensing receptor-dependent regulation of cell-cell adhesion and keratinocyte differentiation requires Rho and filamin A. J Invest Dermatol. 131:1119–1128. 2011. View Article : Google Scholar : PubMed/NCBI

24 

Cohen I, Birnbaum RY, Leibson K, Taube R, Sivan S and Birk OS: ZNF750 is expressed in differentiated keratinocytes and regulates epidermal late differentiation genes. PLoS One. 7:e426282012. View Article : Google Scholar : PubMed/NCBI

25 

Blander G, Bhimavarapu A, Mammone T, et al: SIRT1 promotes differentiation of normal human keratinocytes. J Invest Dermatol. 129:41–49. 2009. View Article : Google Scholar : PubMed/NCBI

26 

Gasparoni A, Fonzi L, Schneider GB, Wertz PW, Johnson GK and Squier CA: Comparison of differentiation markers between normal and two squamous cell carcinoma cell lines in culture. Arch Oral Biol. 49:653–664. 2004. View Article : Google Scholar : PubMed/NCBI

27 

Kim RH, Flanders KC, Birkey Reffey S, Anderson LA, Duckett CS, Perkins ND and Roberts AB: SNIP1 inhibits NF-kappa B signaling by competing for its binding to the C/H1 domain of CBP/p300 transcriptional co-activators. J Biol Chem. 276:46297–46304. 2001. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang X and Jiang L: Effects of ornithine decarboxylase antizyme 1 on the proliferation and differentiation of human oral cancer cells. Int J Mol Med 34: 1606-1612, 2014.
APA
Wang, X., & Jiang, L. (2014). Effects of ornithine decarboxylase antizyme 1 on the proliferation and differentiation of human oral cancer cells. International Journal of Molecular Medicine, 34, 1606-1612. https://doi.org/10.3892/ijmm.2014.1961
MLA
Wang, X., Jiang, L."Effects of ornithine decarboxylase antizyme 1 on the proliferation and differentiation of human oral cancer cells". International Journal of Molecular Medicine 34.6 (2014): 1606-1612.
Chicago
Wang, X., Jiang, L."Effects of ornithine decarboxylase antizyme 1 on the proliferation and differentiation of human oral cancer cells". International Journal of Molecular Medicine 34, no. 6 (2014): 1606-1612. https://doi.org/10.3892/ijmm.2014.1961
Copy and paste a formatted citation
x
Spandidos Publications style
Wang X and Jiang L: Effects of ornithine decarboxylase antizyme 1 on the proliferation and differentiation of human oral cancer cells. Int J Mol Med 34: 1606-1612, 2014.
APA
Wang, X., & Jiang, L. (2014). Effects of ornithine decarboxylase antizyme 1 on the proliferation and differentiation of human oral cancer cells. International Journal of Molecular Medicine, 34, 1606-1612. https://doi.org/10.3892/ijmm.2014.1961
MLA
Wang, X., Jiang, L."Effects of ornithine decarboxylase antizyme 1 on the proliferation and differentiation of human oral cancer cells". International Journal of Molecular Medicine 34.6 (2014): 1606-1612.
Chicago
Wang, X., Jiang, L."Effects of ornithine decarboxylase antizyme 1 on the proliferation and differentiation of human oral cancer cells". International Journal of Molecular Medicine 34, no. 6 (2014): 1606-1612. https://doi.org/10.3892/ijmm.2014.1961
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team