Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
May-2015 Volume 35 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2015 Volume 35 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Association of six genetic variants with myocardial infarction

  • Authors:
    • Reiko Matsuoka
    • Shintaro Abe
    • Fumitaka Tokoro
    • Masazumi Arai
    • Toshiyuki Noda
    • Sachiro Watanabe
    • Hideki Horibe
    • Tetsuo Fujimaki
    • Mitsutoshi Oguri
    • Kimihiko Kato
    • Shinya Minatoguchi
    • Yoshiji Yamada
  • View Affiliations / Copyright

    Affiliations: Department of Cardiology, Gifu Prefectural General Medical Center, Gifu 500-8717, Japan, Department of Cardiovascular Medicine, Gifu Prefectural Tajimi Hospital, Tajimi 507-8522, Japan, Department of Cardiovascular Medicine, Inabe General Hospital, Inabe 511-0428, Japan, Department of Cardiology, Japanese Red Cross Nagoya First Hospital, Nagoya 453-8511, Japan, Department of Internal Medicine, Meitoh Hospital, Nagoya 465-0025, Japan, Department of Cardiology, Gifu University Graduate School of Medicine, Gifu 501-1194, Japan, Department of Human Functional Genomics, Life Science Research Center, Mie University, Tsu 514-8507, Japan
  • Pages: 1451-1459
    |
    Published online on: February 27, 2015
       https://doi.org/10.3892/ijmm.2015.2115
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Although various genes that confer susceptibility to myocardial infarction (MI) have been identified for Caucasian populations in genome-wide association studies (GWAS), genetic variants related to this condition in Japanese individuals have not been identified definitively. The aim of the present study was to examine an association of MI in Japanese individuals with 29 polymorphisms identified as susceptibility loci for MI or coronary artery disease in Caucasian populations by meta-analyses of GWAS. The study subjects comprised 1,824 subjects with MI and 2,329 controls. Genotypes of the polymorphisms were determined by Luminex bead-based multiplex assay. To compensate for multiple comparisons, we adopted the criterion of a false discovery rate (FDR) of <0.05 for statistical significance for association. Comparisons of allele frequencies by the χ2 test revealed that rs9369640 of the phosphatase and actin regulator 1 gene (PHACTR1, FDR=0.0007), rs4977574 of the CDKN2B antisense RNA 1 gene (CDKN2B-AS1, FDR=0.0038), rs264 of the lipoprotein lipase gene (LPL, FDR=0.0061), rs599839 of the proline/serine-rich coiled-coil 1 gene (PSRC1, FDR=0.0118), rs9319428 of the fms-related tyrosine kinase 1 gene (FLT1, FDR=0.0118) and rs12413409 of the cyclin and CBS domain divalent metal cation transport mediator 2 gene (CNNM2, FDR=0.0300) were significantly associated with MI. Multivariate logistic regression analysis with adjustment for covariates revealed that rs9369640 (P=0.0005; odds ratio, 0.89), rs4977574 (P=0.0001; odds ratio, 1.50), rs264 (P=0.0405; odds ratio, 0.85), rs599839 (P=0.0003; odds ratio, 0.68), rs9319428 (P=0.0155; odds ratio, 1.20) and rs12413409 (P=0.0076; odds ratio, 0.66) were significantly (P<0.05) associated with MI. PHACTR1, CDKN2B-AS1, LPL, PSRC1, FLT1 and CNNM2 may thus be susceptibility loci for MI in Japanese individuals.

Introduction

Myocardial infarction (MI) is a life-threatening disease, the pathogenesis of which is complex and multifactorial. Epidemiological studies have identified several risk factors, including hypertension, diabetes mellitus, dyslipidemia, chronic kidney disease and smoking (1). In addition to these risk factors, recent studies have demonstrated the importance of genetic factors and interactions between multiple genes and environmental factors in the development of MI (2,3). In fact, twin and family studies have indicated that the heritability of coronary heart disease (CHD) is 40–50% (4).

Recent genome-wide association studies (GWAS) have become a powerful approach to identifying genetic variants that are related to common complex diseases (5,6). To date, meta-analyses of GWAS have identified 46 loci associated with CHD or MI at a genome-wide significance level (P<5×10−8) (5,6), and an additional 104 genetic variants have been found to be associated with CHD with a false discovery rate (FDR) of <0.05 among individuals of European and south Asian ancestry (5). Although various loci and genes that confer susceptibility to MI or CHD have been identified for Caucasian populations by GWAS (5,6), genetic variants related to these conditions in Japanese individuals have not been identified definitively.

Therefore, the aim of this study was to examine a possible association of MI in Japanese individuals with 29 single nucleotide polymorphisms (SNPs) identified as susceptibility loci for MI or CHD in Caucasian populations by meta-analyses of GWAS.

Materials and methods

Study population

The study population comprised 4,153 Japanese individuals, including 1,824 subjects with MI (1,468 males and 356 females) and 2,329 controls (1,029 males and 1,300 females), who either visited outpatient clinics or were admitted to the participating hospitals (Gifu Prefectural General Medical Center, Gifu; Gifu Prefectural Tajimi Hospital, Tajimi; Japanese Red Cross Nagoya First Hospital, Nagoya; Inabe General Hospital, Inabe; Hirosaki University Hospital and Hirosaki Stroke Center, Hirosaki, Japan) between 2002 and 2012, due to various symptoms or for an annual health checkup. The 1,824 subjects with MI all underwent coronary angiography and left ventriculography. The diagnosis of MI was based on typical electrocardiographic changes and on increases both in the serum activity of creatine kinase (MB isoform) and in the serum concentration of troponin T. The diagnosis was confirmed by the presence of stenosis in any of the major coronary arteries or in the left main trunk by coronary angiography. The 2,329 control individuals had no history of CHD or MI, aortic aneurysm or peripheral arterial occlusive disease, or of ischemic or hemorrhagic stroke or any other cerebrovascular diseases, or of any other atherosclerotic, thrombotic, embolic or hemorrhagic disorders. The study protocol complied with the Declaration of Helsinki and was approved by the ethics committees of each participating institution. Written informed consent was obtained from each participant.

Selection and genotyping of polymorphisms

We searched SNPs that were shown to be significantly associated with CHD or MI in Caucasian populations by meta-analyses of GWAS (5,6). We examined these SNPs using the SNP database (dbSNP; National Center for Biotechnology Information, Bethesda, MD, USA) to find SNPs with a minor allele frequency of ≥0.015 in a Japanese population. We finally selected 29 SNPs (Table I) and examined a possible association with MI. The wild-type (ancestral allele) and variant alleles of the SNPs were determined from the original sources.

Table I

The 29 single nucleotide polymorphisms (SNPs) examined in the present study.

Table I

The 29 single nucleotide polymorphisms (SNPs) examined in the present study.

Chromosomal locusGene symboldbSNP (NCBI)Nucleotide substitutionMinor allelea
15q24.2ADAMTS7rs3825807C→T (Pro214Ser)C
9p21CDKN2Brs3217992G→AG
9p21.3 CDKN2B-AS1rs4977574A→GA
10q24.32CNNM2rs12413409G→AA
13q34COL4A1rs4773144G→AG
13q12FLT1rs9319428G→AA
15q26.1FURINrs17514846A→CA
4q31.1-q31.2GUCY1A3rs7692387G→AA
14q32HHIPL1rs2895811T→CC
1q21IL6Rrs4845625C→TC
6p21KCNK5rs10947789T→CC
6q26LPArs3798220T→C (Ile1891Met)C
8p22LPLrs264G→AA
20p12.1MACROD2rs2208454G→TT
1q41MIA3rs17465637C→AA
3q22.3MRASrs9818870T→CT
6p24.1PHACTR1rs9369640A→CC
1p13.3PSRC1rs599839G→AG
6q25.3SLC22A3rs2048327A→GG
5q31.1SLC22A4rs273909T→CC
19p13.2SMARCA4rs1122608G→TT
17p13.3SMG6rs216172C→GG
6q23.2TCF21rs12190287C→GG
19q13TOMM40rs2075650G→AG
17q21.32UBE2Zrs46522C→TC
2p11.2VAMP5rs1561198A→GA
2q33.2WDR12rs6725887C→TC
7q32.2ZC3HC1rs11556924C→T (Arg363His)T
11q23.3ZPR1rs964184C→GG

a The minor allele in Japanese individuals was determined by the allele frequency of HapMap-JPT (dbSNP, NCBI).

Venous blood (7 ml) was collected into tubes containing 50 mmol/l ethylenediaminetetraacetic acid (disodium salt), the peripheral blood leukocytes were isolated and genomic DNA was extracted from these cells using a DNA extraction kit (Genomix; Talent Srl, Trieste, Italy). Genotypes of the 29 SNPs were determined at G&G Science Co., Ltd. (Fukushima, Japan) by a method that combines the polymerase chain reaction and sequence-specific oligonucleotide probes with suspension array technology (Luminex, Austin, TX, USA). Primers, probes and other conditions for the genotyping of the SNPs examined in this study are shown in Table II. The overall call rate of the genotypes of the 29 SNPs was 99%. Detailed genotyping methodology was as previously described (7).

Table II

Primers, probes and other PCR conditions for genotyping.

Table II

Primers, probes and other PCR conditions for genotyping.

GenedbSNPSense primerAntisense primerProbe 1Probe 2Tmp (°C)Cycle (times)
ADAMTS7rs3825807 CTGTCCACTGGCAGCTAAC CCGACCGCTGGTGTAGA TCGAGACTCCAGCTCTGG CTCCCGTCGAGGCTCCAG6050
CDKN2Brs3217992 CAAACCTCAAACATTATTGGGT GAAACAGCTAAACCTGTCTGCC ACTATTTCAATACAACCAGG ACTATTTTAATACAACCAGGT6050
CDKN2B-AS1rs4977574 CTTGTAACCACATGTCAGTAGCAT GGTGTTCCAAACAGGACATCTT TGCATTCTATAGCACAGGATG TGGAACATCCTGCGCTATAGA6050
CNNM2rs12413409 CCCATATAACTACACGTGAAAAGTG ATAGACCAGATACAGACTGCAGC TACAAGCACAACACCATTTACT GTAGAAGAGTAAATGATGTTGTG6050
COL4A1rs4773144 GTTCCCAGCGTCAATCC CACTTTCCTGGCCTCTACG TTTTAAGTTCCCAGTTCCCGTGA TTTTAAGTTCCCAGCTCCCGTG6050
FLT1rs9319428 TGACTTGATTTTCCCTTGCC GGACAGCATTTATCTGCATCTATG GCAACCGAGAACAAGAAC CAACCAAGAACAAGAACTG6050
FURINrs17514846 GTTGTTGGATAGAGGGAGGC GATGGAGCCGCAGCTG CAGGCGTCAGGCGCAA GCAGGCTTCAGGCGCA6050
GUCY1A3rs7692387 AGAAATCAAAATCACCTACTTAAGGC TGGTCAGTTTACAAAGCAAGTA AGGTCTTTCTTTTTCAAATGTCTC TCTTTCTTTTTTAAATGTCTCT6050
HHIPL1rs2895811 CACAGCTGCTGGAGATCAC TGTCTCTCTGCTGACAACAAGC AGGAGCAGAGTACATGGCTG ACTCCCAGCCACGTACTCTG6050
IL6Rrs4845625 AGAAGTCTGTCCAAGGTGACAT GATACACTGAAGCAGCTGTTGTC ATGCAGGTACTACCATGACTG AGCATTCCAGTCACGGTAGTA6050
KCNK5rs10947789 TCTTTCAGGAGGGGACATTC GGCTCAGCAGTTCACCC GTGAAACCTGATTGAAGTAAGAG CAGCTCACTCTTACCTCAATCA6050
LPArs3798220 CCAAGAAGTGAACCTCGAATCT TGCTTAGCTTTAGCAAGGCA ATGTTCAGGAAATAGAAGTGTC GACACTTCCATTTCCTGAA6050
LPLrs264 TTCCCTGTGAACTTGCAAC AGAATCACCCAAGGATATAGTCC AGGTGIGTGIGCCGCTACCAC AGGTGIGTGIGCCACTACCAC6050
MACROD2rs2208454 GGCCTGTAGCAATCTCAGTG ACTCTCCAAAATAAACCAGCAAC TGATTTTATGTTGGCCTAACT TGATTTTATTTTGGCCTAACT6050
MIA3rs17465637 TTGATGGAGACACAGAACCA TGTATCAGCAGCAAAGACATGT CACTATGACAAAAAATAACTTCTC TGAGAAGTTCTTTTTTGTCATA6050
MRASrs9818870 TCAGATCTGTCTCTTGCTGC GAGTTTTCTGGATGGTGTCCAC AGTGTATTCGTATCAGAGAG AGTGTATTCATATCAGAGAG6050
PHACTR1rs9369640 TCAGGAAGTGAGGCAAACC TGGTACCGGTGTGTAGATACTG TCTGCTTCTAACAGTGATTTT CAAAATCACTGTTATAAGCAGA6050
PSRC1rs599839 CAGTTTGTGATAAGCTTACTCTATGAGTC CCTGGGTGACAGAGCAAGAT GTATATCTGGAAGTCGATCCT TGGAAGTTGATCCTGCTC6050
SLC22A3rs2048327 GCTCTCTAGGAGGTCATTGC GCTAGATGCCTTTCTGAGCAG TTTGTTGAGCATGAGCAGC GCTGCTCACGCTCAACAA6050
SLC22A4rs273909 ATGTAGATGCCCTATTGCCTC GTAAGGAAGTATCTTTGGCTATGATG TGCAACTCTCACTTCACCT TGCAACTCCCACTTCACCT6050
SMARCA4rs1122608 TGGGTGGTGCCATGTATAAC CAGGTGTGGCTCCTGTCTC GCGAGGCGIGGACTGGCCT GTGTAAAAGGCCATTCCICA6050
SMG6rs216172 GAATTCCAACTGCTGGGC AGATCTTTCTCCCTGCAGTCC TTCTGAGGCAAGGATCAGT TTCTGAGGGAAGGATCAGT6050
TCF21rs12190287 AGCAATAGTGACCTCATTACCAAG CCTGACATCTTGAAAAGTCCTC TGAAGTCACCGAAGTTCTC ATGAACTCACCGAAGTTCTC6050
TOMM40rs2075650 GTTCTGCTGTGGGTCTCTG CTTGACACCCTCCATCTGA GTCACACTCCACTCCAACC GGGTTGGGGTGGAGTGT6050
UBE2Zrs46522 GGTCACCCTATCCATTGTACTACC CAGTCAAGCTTGCCCTATTC TAACGGGATGGGGGAAGA TAACGAGATGGGGGAAGAG6050
VAMP5rs1561198 CAGAATTGGAAACAACCTGTTG AATTTCAGAGCATGATTCTTCC GGTTTGGGACCAGATTGGC CTGACTTGCCAATCTAGTCCC6050
WDR12rs6725887 TTGGCAGATGCTTTATAGAAAGTG GGACCAACGTTGTTTCACTACTATAC ATTTGGTTGAGACATAATATGCT GTTGAGACACAATATGCTGTT6050
ZC3HC1rs11556924 CCTGGTCCCATTGTCTCTC GGTGTCTCCTGTTCCCATG CTCAGGACGGTCAACAGG GTCCTGTTGACCATCCTGAT6050
ZPR1rs964184 ATCTCTTTCATGGAACTTGAAGTCTAG CCTGCTTTACATTCCTCCATG AACAGATCAGGAAAACAGTAC AACAGATGAGGAAAACAGTAC6050
Statistical analysis

The χ2 test was used to compare categorical variables. Quantitative data were compared between 2 groups using the Mann-Whitney U test or among 3 groups using the Kruskal-Wallis test, given that data were not normally distributed [P<0.01 by the Lilliefors (Kolmogorov-Smirnov) test]. The allele frequencies of each SNP were compared between the subjects with MI and the controls using the χ2 test. To compensate for multiple comparisons of genotypes, a FDR was calculated from the distribution of P-values for the 29 SNPs, and a FDR of <0.05 was considered as statistically significant for association. The statistical power of each SNP was calculated with an Online Sample Size Estimator (http://osse.bii.a-star.edu.sg/calculation2.php). Multivariable logistic regression analysis was performed with MI as a dependent variable and independent variables, including age, gender (0, female; 1, male), body mass index (BMI), smoking status (0, non-smoker; 1, current or former smoker), the prevalence of hypertension, diabetes mellitus and dyslipidemia (0, no history of these conditions; 1, positive history) and the genotype of each SNP; the P-value, odds ratio and 95% confidence interval were calculated. A genotype was assessed according to a dominant (a combined group of heterozygotes and variant homozygotes vs. wild-type homozygotes), recessive (variant homozygotes vs. a combined group of wild-type homozygotes and heterozygotes) and additive model. Additive models included the additive 1 (heterozygotes vs. wild-type homozygotes) and additive 2 (variant homozygotes vs. wild-type homozygotes) models, which were analyzed simultaneously with a single statistical model. Statistical tests were performed using JMP version 11 and JMP Genomics version 6.0 software (SAS Institute Inc., Cary, NC, USA).

Results

Clinical characteristics of the study subjects

The clinical characteristics of the study subjects are presented in Table III. Age, the frequency of the male gender, BMI, the prevalence of smoking, hypertension, diabetes mellitus and dyslipidemia, the fasting plasma glucose levels, the serum concentrations of triglycerides, low-density lipoprotein (LDL)-cholesterol levels and creatinine levels were all higher, whereas diastolic blood pressure, the serum concentrations of high-density lipoprotein (HDL)-cholesterol and the estimated glomerular filtration rate were all lower in the subjects with MI compared to the controls.

Table III

Characteristics of the study subjects.

Table III

Characteristics of the study subjects.

CharacteristicsMyocardial infarctionControlsP-value
Number of subjects1,8242,329
Age64.6±10.362.3±11.8<0.0001
Gender (male/female, %)80.5/19.544.2/55.8<0.0001
Body mass index (kg/m2)24.0±3.423.7±3.20.0215
Current or former smoker (%)36.217.5<0.0001
Hypertension (%)71.943.9<0.0001
Systolic blood pressure (mmHg)141±27141±240.6801
Diastolic blood pressure (mmHg)76±1679±14<0.0001
Diabetes mellitus (%)49.020.0<0.0001
Fasting plasma glucose (mmol/l)7.56±3.376.29±3.34<0.0001
Dyslipidemia (%)57.829.7<0.0001
Serum triglycerides (mmol/l)1.64±1.121.46±1.07<0.0001
Serum HDL-cholesterol (mmol/l)1.19±0.361.47±0.41<0.0001
Serum LDL-cholesterol (mmol/l)3.17±0.953.03±0.850.0004
Serum creatinine (μmol/l)95.5±104.483.1±97.3<0.0001
eGFR (ml/min/1.73 m2)67.2±26.170.6±23.2<0.0001

[i] Quantitative data are shown as the means ± standard deviations. Hypertension was determined by a systolic blood pressure of ≥140 mmHg, a diastolic blood pressure of ≥90 mmHg, or the taking of any antihypertensive medications; diabetes mellitus was determined by fasting plasma glucose levels of ≥6.93 mmol/l or the taking of any antidiabetic medications; dyslipidemia was determined by a serum triglyceride concentration of ≥1.65 mmol/l, a serum high-density lipoprotein (HDL)-cholesterol concentration of <1.04 mmol/l, a serum low-density lipoprotein (LDL)-cholesterol concentration of ≥3.63 mmol/l, or the taking of any antidyslipidemic medications. eGFR, estimated glomerular filtration rate (ml min−1 1.73 m−2) = 194 × [age (years)]−0.287 × [serum creatinine (mg/dl)]−1.094 × [0.739 if female].

Association of SNPs with MI

The allele frequencies of each SNP were compared between the subjects with MI and the controls using the χ2 test, and the SNPs significantly (FDR <0.05) associated with MI are presented in Table IV. Of the 29 SNPs examined in the present study, rs12413409 of the cyclin and CBS domain divalent metal cation transport mediator 2 gene (CNNM2), rs9319428 of the fms-like tyrosine kinase-1 gene (FLT1), rs264 of the lipoprotein lipase gene (LPL), rs599839 of the proline/serine rich coiled coil 1 gene (PSRC1), rs4977574 of the CDKN2B antisense RNA 1 gene (CDKN2B-AS1) and rs9369640 of the phosphatase and actin regulator 1 gene (PHACTR1) were significantly associated with MI. The statistical power of each SNP was calculated with the number of samples and minor allele frequencies of the cases and the controls, and the significance level (α=0.05) was 49.0–85.5%. The genotype distributions of the 6 SNPs were in Hardy-Weinberg equilibrium (P>0.05) among the control individuals.

Table IV

The 6 single nucleotide polymorphisms (SNPs) significantly (allele frequency FDR of <0.05) associated with myocardial infarction (MI).

Table IV

The 6 single nucleotide polymorphisms (SNPs) significantly (allele frequency FDR of <0.05) associated with myocardial infarction (MI).

GenedbSNPGenotypeMIaControlsaP-value (allele)FDR (allele)Statistical power (%)
CNNM2rs124134090.00620.030049.0
GG1059 (58.1)1244 (54.5)
GA664 (36.4)879 (38.5)
AA99 (5.4)161 (7.1)
MAF0.23660.2629
Hardy-Weinberg P0.70150.7363
FLT1rs93194280.00200.011858.5
GG660 (36.3)926 (40.8)
GA861 (47.3)1021 (45.0)
AA299 (16.4)324 (14.3)
MAF0.40080.3675
Hardy-Weinberg P0.51950.1172
LPLrs264 6.3×10−40.006167.8
GG1195 (65.7)1376 (60.6)
GA557 (30.6)782 (34.5)
AA68 (3.7)111 (4.9)
MAF0.19040.2212
Hardy-Weinberg P0.75730.9938
PSRC1rs5998390.00180.011860.6
AA1583 (87.0)1875 (83.0)
AG222 (12.2)372 (16.5)
GG15 (0.8)13 (0.6)
MAF0.06920.0881
Hardy-Weinberg P0.02240.2361
CDKN2BAS1rs4977574 2.6×10−40.003873.2
AA448 (24.6)651 (28.5)
AG898 (49.3)1132 (49.6)
GG476 (26.1)501 (21.9)
MAF0.50770.4672
Hardy-Weinberg P0.54910.8311
PHACTR1rs9369640 2.3×10−5 6.6×10−485.5
AA1571 (86.2)1856 (81.6)
AC242 (13.3)395 (17.4)
CC9 (0.5)25 (1.1)
MAF0.07140.0978
Hardy-Weinberg P0.92240.4401

a Numbers in parentheses are percentages. FDR, false discovery rate; MAF, minor allele frequency.

Multivariable logistic regression analysis with adjustment for age, gender, BMI, smoking status and the prevalence of hypertension, diabetes mellitus and dyslipidemia revealed that rs12413409 of CNNM2 (dominant, recessive and additive 1 and 2 models), rs264 of LPL (dominant model), rs599839 of PSRC1 (dominant and additive 1 models) and rs9369640 of PHACTR1 (dominant, recessive and additive 1 and 2 models) were significantly associated with MI, with the minor A, A, G and C alleles, respectively, being protective against this condition (Table V). Similar analysis revealed that rs9319428 of FLT1 (dominant and additive 2 models) and rs4977574 of CDKN2B-AS1 (dominant, recessive and additive 2 models) were also significantly associated with MI, with the A and G alleles, respectively, representing risk factors for this condition (Table V).

Table V

Multivariable logistic regression analysis of the 6 single nucleotide polymorphisms (SNPs) associated with myocardial infarction.

Table V

Multivariable logistic regression analysis of the 6 single nucleotide polymorphisms (SNPs) associated with myocardial infarction.

GeneSNPDominant
Recessive
Additive 1
Additive 2
P-valueOR (95% CI)P-valueOR (95% CI)P-valueOR (95% CI)P-valueOR (95% CI)
CNNM2rs12413409 (G→A)0.00890.82 (0.71–0.95)0.02180.70 (0.52–0.94)0.04180.85 (0.73–0.99)0.00760.66 (0.65–0.85)
FLT1rs9319428 (G→A)0.01551.20 (1.03–1.41)0.08530.05080.01861.30 (1.04–1.62)
LPLrs264 (G→A)0.04050.85 (0.73–0.99)0.16380.08360.1030
PSRC1rs599839 (A→G)0.00070.70 (0.57–0.88)0.36050.00030.68 (0.56–0.83)0.4281
CDKN2BAS1rs4977574 (A→G)0.00631.27 (1.06–1.49)0.00041.37 (1.15–1.61)0.10470.00011.50 (1.22–1.85)
PHACTR1rs9369640 (A→C)0.00050.89 (0.57–0.85)0.01320.33 (0.13–0.80)0.00210.73 (0.59–0.89)0.00960.31 (0.12–0.76)

[i] Multivariable logistic regression analysis was performed with adjustment for age, gender, body mass index, smoking status, and the prevalence of hypertension, diabetes mellitus and dyslipidemia. OR, odds ratio; CI, confidence interval. P-values <0.05 are shown in bold.

Association of the 6 SNPs to conventional risk factors for CHD

We examined the association of the 6 SNPs associated with MI to conventional risk factors for CHD among genotypes or between 2 groups (dominant or recessive model) (Table VI). Due to the multiple comparisons of genotypes, a P-value of <0.001 (0.05/48) was considered statistically significant. rs599839 of PSRC1 was significantly associated with the serum concentrations of HDL-cholesterol with the minor G allele being related to increased serum HDL-cholesterol. This SNP was also associated (borderline significance) with the serum concentrations of LDL-cholesterol with the G allele being related to decreased serum LDL-cholesterol. The rs264 of LPL was associated (borderline significance) with the serum concentrations of HDL-cholesterol with the minor A allele being associated with increased serum HDL-cholesterol.

Table VI

Comparisons of coronary risk factors among genotypes or between 2 groups (dominant or recessive model) of the SNPs.

Table VI

Comparisons of coronary risk factors among genotypes or between 2 groups (dominant or recessive model) of the SNPs.

Genotype
P-value
AAABBBGenotypesaDominantbRecessiveb
CNNM2 (rs12413409)
 Body mass index (kg/m2)23.8±3.323.9±3.323.7±3.00.65060.36520.9460
 Systolic blood pressure (mmHg)144±27143±27140±240.04650.02190.1243
 Diastolic blood pressure (mmHg)78±1578±1677±160.65070.35870.8981
 Serum triglycerides (mmol/l)1.60±1.141.60±1.151.45±0.870.09660.66250.0323
 Serum HDL-cholesterol (mmol/l)1.32±0.401.33±0.391.33±0.400.10150.03440.7764
 Serum LDL-cholesterol (mmol/l)3.11±0.923.13±0.923.22±0.910.11300.09770.0926
 Fasting plasma glucose (mmol/l)7.00±3.407.02±3.436.64±2.790.39870.47570.1913
 Blood glycosylated hemoglobin (%)6.86±1.786.86±1.856.61±1.410.35760.44000.1694
FLT1 (rs9319428)
 Body mass index (kg/m2)23.8±3.223.8±3.323.8±3.30.57740.30070.6131
 Systolic blood pressure (mmHg)144±26143±27143±280.17600.06940.3121
 Diastolic blood pressure (mmHg)78±1577±1577±160.01320.00440.0985
 Serum triglycerides (mmol/l)1.56±1.091.60±1.151.60±1.140.72220.42040.8155
 Serum HDL-cholesterol (mmol/l)1.33±0.411.32±0.401.30±0.380.38800.24710.2752
 Serum LDL-cholesterol (mmol/l)3.11±0.913.15±0.923.09±0.940.12230.40080.1402
 Fasting plasma glucose (mmol/l)6.98±3.537.06±3.536.81±2.970.57060.49600.5928
 Blood glycosylated hemoglobin (%)6.80±1.746.92±1.846.79±1.750.30540.30680.4747
LPL (rs264)
 Body mass index (kg/m2)23.8±3.223.8±3.224.0±3.80.89210.76000.6612
 Systolic blood pressure (mmHg)144±27144±26142±260.89240.92720.6714
 Diastolic blood pressure (mmHg)78±1678±1576±160.11580.74690.0601
 Serum triglycerides (mmol/l)1.61±1.141.56±1.131.46±0.950.01660.02300.0209
 Serum HDL-cholesterol (mmol/l)1.31±0.401.35±0.411.37±0.390.00280.00120.0473
 Serum LDL-cholesterol (mmol/l)3.12±0.913.13±0.943.17±0.900.82300.83550.6126
 Fasting plasma glucose (mmol/l)7.08±3.446.80±3.307.14±3.060.01240.01790.2940
 Blood glycosylated hemoglobin (%)6.88±1.796.75±1.747.19±2.090.03650.17170.0854
PSRC1 (rs599839)
 Body mass index (kg/m2)23.8±3.223.8±3.423.3±3.10.64090.36310.6698
 Systolic blood pressure (mmHg)143±26144±28147±240.61690.41970.7066
 Diastolic blood pressure (mmHg)78±1578±1676±110.82030.53100.8471
 Serum triglycerides (mmol/l)1.59±1.131.61±1.121.55±1.020.96410.79880.8838
 Serum HDL-cholesterol (mmol/l)1.31±0.401.38±0.421.43±0.48 3.9×10−40.2138 8.0×10−5
 Serum LDL-cholesterol (mmol/l)3.15±0.933.02±0.872.93±0.860.00420.34050.0010
 Fasting plasma glucose (mmol/l)6.98±3.377.11±3.486.22±2.540.32850.22020.5633
 Blood glycosylated hemoglobin (%)6.84±1.786.95±1.856.17±1.310.14580.08500.5744
CDKN2BAS1 (rs4977574)
 Body mass index (kg/m2)23.8±3.123.8±3.323.8± 3.30.47870.58230.4071
 Systolic blood pressure (mmHg)144±26144± 27142±270.37070.31500.2043
 Diastolic blood pressure (mmHg)78±1678±1677±150.03870.80990.0135
 Serum triglycerides (mmol/l)1.58±1.031.60±1.121.57±1.230.41100.56860.1844
 Serum HDL-cholesterol (mmol/l)1.34±0.421.32±0.391.32±0.390.76240.48790.6937
 Serum LDL-cholesterol (mmol/l)3.15±0.933.10±0.913.14±0.950.16390.14940.4950
 Fasting plasma glucose (mmol/l)7.07±3.576.92±3.287.05±3.350.41140.93650.2006
 Blood glycosylated hemoglobin (%)6.88±1.806.85±1.816.82±1.730.74650.68530.6347
PHACTR1 (rs9369640)
 Body mass index (kg/m2)23.8±3.323.9±3.323.6±2.50.48870.28820.7502
 Systolic blood pressure (mmHg)143±27144±26144±300.82510.68730.7002
 Diastolic blood pressure (mmHg)78±1677±1476±120.51410.27260.5745
 Serum triglycerides (mmol/l)1.59±1.111.53±0.982.14±3.210.33160.15900.8641
 Serum HDL-cholesterol (mmol/l)1.32±0.401.36±0.411.35±0.370.03130.00850.6184
 Serum LDL-cholesterol (mmol/l)3.14±0.923.07±0.923.07±0.770.18110.06540.8264
 Fasting plasma glucose (mmol/l)7.03±3.426.77±3.127.09±3.360.04310.01560.8902
 Blood glycosylated hemoglobin (%)6.86±1.806.80±1.756.92±1.240.39060.57510.2740

a Data for each parameter were compared among genotypes using the Kruskal-Wallis test or

b were compared between 2 groups [dominant (AB + BB vs. AA) or recessive (BB vs. AA + AB) model] using the Mann-Whitney U test. AA, wild-type homozygote; AB, heterozygote; BB, variant homozygote. P-values <0.05 are shown in bold.

Discussion

In the present study, we examined the association of MI in Japanese individuals with 29 SNPs identified as susceptibility loci for CHD or MI in Caucasian populations by meta-analyses of GWAS and observed that 6 SNPs in the CNNM2, FLT1, LPL, PSRC1, CDKN2B-AS1 and PHACTR1 genes were significantly associated with MI. The association of the SNPs with MI remained significant following adjustment for covariates, suggesting that these genetic variants were independent risk factors for MI.

PHACTR1 is highly expressed in the heart and brain and regulates protein phosphatase 1, an ubiquitous enzyme regulating essential cellular processes (8). The suppression of PHACTR1 in cultured endothelial cells has been shown to result in attenuated tube formation and cell survival (9), as well as in the impaired synthesis of nitric oxide, an important mediator of cardiovascular function (10). In addition, protein phosphatase 1 is considered to be a critical regulator of Ca2+ cycling and contractility in smooth muscle cells, and thus, is closely related to arterial elasticity and wave reflection which is recognized as an important factor for cardiovascular disease (11). In the present study, rs9369640 of PHACTR1 showed the most significant association with MI with the minor C allele being protective against this condition, although the role of PHACTR1 in the pathogenesis of MI remains unclear.

CDKN2B-AS1 is located within the CDKN2B-CDKN2A gene cluster at chromosome 9p21. The 9p21.3 locus was first discovered by GWAS to be a risk factor for CHD or MI (12–15). This locus was then shown to be associated with ischemic stroke (16,17) and with intracranial and aortic aneurysms (18). The 9p21.3 locus has also been associated with platelet reactivity and the increased platelet reactivity may explain the association with MI and ischemic stroke (19). The 9p21.3 locus includes CDKN2B-AS1, which encodes a functional RNA molecule that interacts with polycomb repressive complex-1 and -2, leading to epigenetic silencing of other genes in this cluster (NCBI Gene) and to the alteration of the expression of several genes related to cellular proliferation (20). Recent studies have also indicated that polymorphisms at 9p21 influence inflammatory signaling (21) and vascular cell proliferation (22). In this study, we demonstrated that rs4977574 of CDKN2B-AS1 was significantly associated with MI in Japanese individuals with the G allele representing a risk factor for this condition. These previous data and the data from the present study indicate that CDKN2B-AS1 at 9p21.3 may be a susceptibility locus for MI, although the underlying molecular mechanisms have not been determined definitively.

The lipoprotein lipase encoded by LPL hydrolyzes triglycerides in circulating lipoprotein into 2 free fatty acids and 1 monoacylglycerol molecules. It also binds simultaneously to both lipoproteins and cell surface receptors and promotes the cellular uptake of lipoproteins and free fatty acids. Genetic variants causing decreased activity of LPL have been shown to result in disorders of lipoprotein metabolism, such as hypertriglyceridemia and hypo-HDL-cholesterolemia (23). In addition, genetic variants of LPL have been implicated in insulin resistance and type 2 diabetes mellitus (24). In the present study, rs264 of LPL was found to be associated with the serum concentrations of HDL-cholesterol with the A allele being related to increased HDL-cholesterol levels. We observed that rs264 was significantly associated with MI with the A allele being protective against MI. This association may be attributable, at least in part, to the effect of rs264 on the metabolism of HDL-cholesterol.

The rs599839 of PSRC1 is located in the cadherin, EGF LAG seven-pass G-type receptor 2 (CELSR2)-PSRC1-sortilin 1 (SORT1) gene cluster on chromosome 1p13.3. The SORT1 protein, the higher expression of which is associated with the minor G allele of rs599839, is a multiligand transmembrane receptor protein that binds to a variety of ligands, including the LDL-receptor associated protein (25), lipoprotein lipase (26) and apolipoprotein A-V (27), and enhances the endocytosis and intracellular degradation of LDL-cholesterol. In the present study, the minor G allele of rs599839 was found to be associated with an increase in serum HDL-cholesterol levels and a decrease in serum LDL-cholesterol levels. We demonstrated that rs599839 of PSRC1 was associated with MI in Japanese individuals with the G allele being protective against MI. The effects of rs599839 on the metabolism of HDL- and LDL-cholesterol may account for its association with MI.

rs12413409 is located in CNNM2 at 10q24.32. CNNM2 was identified as a gene that plays an important role in magnesium homeostasis by mediating the epithelial transport and renal reabsorption of Mg2+ (28,29). We observed the association of rs12413409 of CNNM2 with MI in a Japanese population with the minor A allele being protective, although the role of CNNM2 in the pathogenesis of CHD or MI remains unclear.

FLT1 encodes vascular endothelial growth factor (VEGF) receptor 1 in humans and plays an important role in the pathological mechanisms of atherosclerosis. In addition to VEGF, placental growth factor selectively binds to VEGF receptor 1 and accelerates atherosclerotic processes through the enhancement of intramural angiogenesis and monocyte recruitment (30–32). Recruited monocytes, differentiating into macrophages, produce pro-inflammatory cytokines, such as monocyte chemoattractant protein-1 which cause the augmentation of the inflammatory response and plaque vulnerability (33). In this study, we demonstrated that rs9319428 of FLT1 was significantly associated with MI with the A allele representing a risk factor for MI. The effects of rs9319428 on the development of atherosclerosis may account for its association with MI.

In conclusion, the results from the present study suggest that rs12413409 of CNNM2, rs264 of LPL, rs9369640 of PHACTR1, rs9319428 of FLT1, rs599839 of PSRC1 and rs4977574 of CDKN2B-AS1 are susceptibility loci for MI in Japanese individuals. The determination of genotypes for these SNPs may prove informative for the assessment of the genetic risk for MI. Given that multiple variants, each having a small effect, will ultimately be found to be responsible for a large fraction of the genetic component of MI, further identification of MI susceptibility genes will allow for a more accurate assessment of the genetic component of this condition.

Acknowledgments

The present study was supported by a Collaborative Research Grant from the Gifu Prefectural General Medical Center (H24-26 to Y.Y.) and a Grant-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology of Japan (no. 24590746 to Y.Y.).

References

1 

Yusuf S, Hawken S, Ounpuu S, et al: Effect of potentially modifiable risk factors associated with myocardial infarction In 52 countries (the INTERHEART study): case-control study. Lancet. 364:937–952. 2004. View Article : Google Scholar : PubMed/NCBI

2 

Topol EJ, Smith J, Plow EF and Wang QK: Genetic susceptibility to myocardial infarction and coronary artery disease. Hum Mol Genet. 15:R117–R123. 2006. View Article : Google Scholar : PubMed/NCBI

3 

Wang Q: Molecular genetics of coronary artery disease. Curr Opin Cardiol. 20:182–188. 2005. View Article : Google Scholar : PubMed/NCBI

4 

Peden JF and Farrall M: Thirty-five common variants for coronary artery disease: the fruits of much collaborative labour. Hum Mol Genet. 20:R198–R205. 2011. View Article : Google Scholar : PubMed/NCBI

5 

CARDIoGRAMplusC4D Consortium: Large-scale association analysis identifies new risk loci for coronary artery disease. Nat Genet. 45:25–33. 2013.

6 

Schunkert H, König IR, Kathiresan S, et al: Large-scale association analysis identifies 13 new susceptibility loci for coronary artery disease. Nat Genet. 43:333–338. 2011. View Article : Google Scholar : PubMed/NCBI

7 

Itoh Y, Mizuki N, Shimada T, et al: High-throughput DNA typing of HLA-A, -B, -C, and -DRB1 loci by a PCR-SSOP-Luminex method in the Japanese population. Immunogenetics. 57:717–729. 2005. View Article : Google Scholar : PubMed/NCBI

8 

Peli W, Nairn AC and Page R: Structural basis for protein phosphatase 1 regulation and specificity. FEBS J. 280:596–611. 2013. View Article : Google Scholar

9 

Jarray R, Allain B, Borriello L, et al: Depletion of the novel protein PHACTR-1 from human endothelial cells abolishes tube formation and induces cell death receptor apoptosis. Biochimie. 93:1668–1675. 2011. View Article : Google Scholar : PubMed/NCBI

10 

Mount PF, Kemp BE and Power DA: Regulation of endothelial and myocardial NO synthesis by multi-site eNOS phosphorylation. J Mol Cell Cardiol. 42:271–279. 2007. View Article : Google Scholar

11 

Patel RS, Morris AA, Ahmed Y, et al: A genetic risk variant for myocardial infarction on chromosome 6p24 is associated with impaired central hemodynamic indexes. Am J Hypertens. 25:797–803. 2012. View Article : Google Scholar : PubMed/NCBI

12 

Helgadottir A, Thorleifsson G, Manolescu A, et al: A common variant on chromosome 9p21 affects the risk of myocardial infarction. Science. 316:1491–1493. 2007. View Article : Google Scholar : PubMed/NCBI

13 

McPherson R, Pertsemlidis A, Kavaslar N, et al: A common allele on chromosome 9 associated with coronary heart disease. Science. 316:1488–1491. 2007. View Article : Google Scholar : PubMed/NCBI

14 

Samani NJ, Erdmann J, Hall AS, et al: Genomewide association analysis of coronary artery disease. N Engl J Med. 357:443–453. 2007. View Article : Google Scholar : PubMed/NCBI

15 

Wellcome Trust Case Control Consortium: Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls. Nature. 447:661–678. 2007. View Article : Google Scholar : PubMed/NCBI

16 

Matarin M, Brown WM, Singleton A and Hardy JA: Whole genome analyses suggest ischemic stroke and heart disease share an association with polymorphisms on chromosome 9p21. Stroke. 39:1586–1589. 2008. View Article : Google Scholar : PubMed/NCBI

17 

Gschwendtner A, Bevan S, Cole JW, et al: Sequence variants on chromosome 9p21.3 confer risk for atherosclerotic stroke. Ann Neurol. 65:531–539. 2009. View Article : Google Scholar : PubMed/NCBI

18 

Helgadottir A, Thorleifsson G, Magnusson KP, et al: The same sequence variant on 9p21 associates with myocardial infarction, abdominal aortic aneurysm and intracranial aneurysm. Nat Genet. 40:217–224. 2008. View Article : Google Scholar : PubMed/NCBI

19 

Musunuru K, Post WS, Herzog W, et al: Association of single nucleotide polymorphisms on chromosome 9p21.3 with platelet reactivity: a potential mechanism for increased vascular disease. Circ Cardiovasc Genet. 3:445–453. 2010. View Article : Google Scholar : PubMed/NCBI

20 

Jarinova O, Stewart AF, Roberts R, et al: Functional analysis of the chromosome 9p21.3 coronary artery disease risk locus. Arterioscler Thromb Vasc Biol. 29:1671–1677. 2009. View Article : Google Scholar : PubMed/NCBI

21 

Harismendy O, Notani D, Song X, et al: 9p21 DNA variants associated with coronary artery disease impair interferon-γ signalling response. Nature. 470:264–268. 2011. View Article : Google Scholar : PubMed/NCBI

22 

Visel A, Zhu Y, May D, et al: Targeted deletion of the 9p21 non-coding coronary artery disease risk interval in mice. Nature. 464:409–412. 2010. View Article : Google Scholar : PubMed/NCBI

23 

Fisher RM, Humphries SE and Talmud PJ: Common variation in the lipoprotein lipase gene: effect on plasma lipids and risk of atherosclerosis. Atherosclerosis. 135:145–159. 1997. View Article : Google Scholar

24 

Eriksson JW, Buren J, Svensson M, Olivecrona T and Olivecrona G: Postprandial regulation of blood lipids and adipose tissue lipoprotein lipase in type 2 diabetes patients and healthy control subjects. Atherosclerosis. 166:359–367. 2003. View Article : Google Scholar : PubMed/NCBI

25 

Jansen P, Giehl K, Nyengaard JR, et al: Roles for the proneurotrophin receptor sortilin in neuronal development, aging and brain injury. Nat Neurosci. 10:1449–1457. 2007. View Article : Google Scholar : PubMed/NCBI

26 

Nielsen MS, Jacobsen C, Olivecrona G, Gliemann J and Petersen CM: Sortilin/neurotensin receptor-3 binds and mediates degradation of lipoprotein lipase. J Biol Chem. 274:8832–8836. 1999. View Article : Google Scholar : PubMed/NCBI

27 

Nilsson SK, Christensen S, Raarup MK, Ryan RO, Nielsen MS and Olivecrona G: Endocytosis of apolipoprotein A-V by members of the low density lipoprotein receptor and the VPS10p domain receptor families. J Biol Chem. 283:25920–25927. 2008. View Article : Google Scholar : PubMed/NCBI

28 

Stuiver M, Lainez S, Will C, et al: CNNM2, encoding a baso-lateral protein required for renal Mg2+ handling, is mutated in dominant hypomagnesemia. Am J Hum Genet. 88:333–343. 2011. View Article : Google Scholar : PubMed/NCBI

29 

De Baaij JHF, Stuiver M, Meij IC, et al: Membrane topology and intracellular processing of cyclin M2 (CNNM2). J Biol Chem. 287:13644–13655. 2012. View Article : Google Scholar : PubMed/NCBI

30 

Khurana R, Moons L, Shafi S, et al: Placental growth factor promotes atherosclerotic intimal thickening and macrophage accumulation. Circulation. 111:2828–2836. 2005. View Article : Google Scholar : PubMed/NCBI

31 

Pilarczyk K, Sattler KJ, Galili O, et al: Placenta growth factor expression in human atherosclerotic carotid plaques is related to plaque destabilization. Atherosclerosis. 196:333–340. 2008. View Article : Google Scholar

32 

Roncal C, Buysschaert I, Gerdes N, et al: Short-term delivery of anti-PlGF antibody delays progression of atherosclerotic plaques to vulnerable lesions. Cardiovasc Res. 86:29–36. 2010. View Article : Google Scholar

33 

Carmeliet P, Moons L, Luttun A, et al: Synergism between vascular endothelial growth factor and placental growth factor contributes to angiogenesis and plasma extravasation in pathological conditions. Nat Med. 7:575–583. 2001. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Matsuoka R, Abe S, Tokoro F, Arai M, Noda T, Watanabe S, Horibe H, Fujimaki T, Oguri M, Kato K, Kato K, et al: Association of six genetic variants with myocardial infarction. Int J Mol Med 35: 1451-1459, 2015.
APA
Matsuoka, R., Abe, S., Tokoro, F., Arai, M., Noda, T., Watanabe, S. ... Yamada, Y. (2015). Association of six genetic variants with myocardial infarction. International Journal of Molecular Medicine, 35, 1451-1459. https://doi.org/10.3892/ijmm.2015.2115
MLA
Matsuoka, R., Abe, S., Tokoro, F., Arai, M., Noda, T., Watanabe, S., Horibe, H., Fujimaki, T., Oguri, M., Kato, K., Minatoguchi, S., Yamada, Y."Association of six genetic variants with myocardial infarction". International Journal of Molecular Medicine 35.5 (2015): 1451-1459.
Chicago
Matsuoka, R., Abe, S., Tokoro, F., Arai, M., Noda, T., Watanabe, S., Horibe, H., Fujimaki, T., Oguri, M., Kato, K., Minatoguchi, S., Yamada, Y."Association of six genetic variants with myocardial infarction". International Journal of Molecular Medicine 35, no. 5 (2015): 1451-1459. https://doi.org/10.3892/ijmm.2015.2115
Copy and paste a formatted citation
x
Spandidos Publications style
Matsuoka R, Abe S, Tokoro F, Arai M, Noda T, Watanabe S, Horibe H, Fujimaki T, Oguri M, Kato K, Kato K, et al: Association of six genetic variants with myocardial infarction. Int J Mol Med 35: 1451-1459, 2015.
APA
Matsuoka, R., Abe, S., Tokoro, F., Arai, M., Noda, T., Watanabe, S. ... Yamada, Y. (2015). Association of six genetic variants with myocardial infarction. International Journal of Molecular Medicine, 35, 1451-1459. https://doi.org/10.3892/ijmm.2015.2115
MLA
Matsuoka, R., Abe, S., Tokoro, F., Arai, M., Noda, T., Watanabe, S., Horibe, H., Fujimaki, T., Oguri, M., Kato, K., Minatoguchi, S., Yamada, Y."Association of six genetic variants with myocardial infarction". International Journal of Molecular Medicine 35.5 (2015): 1451-1459.
Chicago
Matsuoka, R., Abe, S., Tokoro, F., Arai, M., Noda, T., Watanabe, S., Horibe, H., Fujimaki, T., Oguri, M., Kato, K., Minatoguchi, S., Yamada, Y."Association of six genetic variants with myocardial infarction". International Journal of Molecular Medicine 35, no. 5 (2015): 1451-1459. https://doi.org/10.3892/ijmm.2015.2115
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team