Open Access

VEGF-C and TGF-β reciprocally regulate mesenchymal stem cell commitment to differentiation into lymphatic endothelial or osteoblastic phenotypes

  • Authors:
    • Yasuyuki Igarashi
    • Naoyuki Chosa
    • Shunsuke Sawada
    • Hisatomo Kondo
    • Takashi Yaegashi
    • Akira Ishisaki
  • View Affiliations

  • Published online on: February 25, 2016
  • Pages: 1005-1013
  • Copyright: © Igarashi et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


The direction of mesenchymal stem cell (MSC) differentiation is regulated by stimulation with various growth factors and cytokines. We recently established MSC lines, [transforming growth factor-β (TGF-β)-responsive SG‑2 cells, bone morphogenetic protein (BMP)-responsive SG‑3 cells, and TGF-β/BMP-non-responsive SG‑5 cells], derived from the bone marrow of green fluorescent protein-transgenic mice. In this study, to compare gene expression profiles in these MSC lines, we used DNA microarray analysis to characterize the specific gene expression profiles observed in the TGF-β-responsive SG‑2 cells. Among the genes that were highly expressed in the SG‑2 cells, we focused on vascular endothelial growth factor (VEGF) receptor 3 (VEGFR3), the gene product of FMS-like tyrosine kinase 4 (Flt4). We found that VEGF-C, a specific ligand of VEGFR3, significantly induced the cell proliferative activity, migratory ability (as shown by Transwell migration assay), as well as the phosphorylation of extracellular signal-regulated kinase (ERK)1/2 in the SG‑2 cells. Additionally, VEGF-C significantly increased the expression of prospero homeobox 1 (Prox1) and lymphatic vessel endothelial hyaluronan receptor 1 (Lyve1), which are lymphatic endothelial cell markers, and decreased the expression of osteogenic differentiation marker genes in these cells. By contrast, TGF-β significantly increased the expression of early-phase osteogenic differentiation marker genes in the SG‑2 cells and markedly decreased the expression of lymphatic endothelial cell markers. The findings of our study strongly suggest the following: i) that VEGF-C promotes the proliferative activity and migratory ability of MSCs; and ii) VEGF-C and TGF-β reciprocally regulate MSC commitment to differentiation into lymphatic endothelial or osteoblastic phenotypes, respectively. Our findings provide new insight into the molecular mechanisms underlying the regenerative ability of MSCs.


Mesenchymal stem cells (MSCs) were first derived from bone marrow and are characterized by their self-renewal ability and their capacity to develop into various mesenchymal tissue cells (13). Much of this differentiation process depends on the ability of the MSCs to proliferate and differentiate under the influence of various growth factors and cytokines (47). For example, the role of growth factors in bone repair is widely recognized, particularly with regard to bone morphogenetic protein (BMP), fibroblast growth factor (FGF), platelet-derived growth factor (PDGF), vascular endothelial growth factor (VEGF), insulin-like growth factor-I (IGF-I) and transforming growth factor-β (TGF-β) (8,9). In a recent study of ours, we demonstrated that PDGF-induced phosphoinositide 3-kinase (PI3K)-mediated signaling promoted the TGF-β-induced osteogenic differentiation of MSCs in a TGF-β-activated extracellular signal-regulated kinase (ERK) kinase-dependent manner (10). In a another recent study, we demonstrated that MSCs-secreted protein, scrapie responsive gene-1 (SCRG1), and its receptor bone marrow stromal cell antigen-1 (BST1), which played important roles in the maintenance of stemness and in the suppression of the osteogenic differentiation of MSCs (11).

VEGF, an important growth factor for bone repair, regulates numerous cellular events associated with angiogenesis and vasculogenesis, such as tissue remodeling during embryonic development and in adults (12). The mammalian VEGF signaling pathway consists of 5 glycoprotein ligands from the VEGF family (VEGF-A, -B, -C, -D and placental growth factor), 3 transmembrane receptors [VEGF receptor (VEGFR)1, VEGFR2 and VEGFR3] and 2 co-receptors (neuropilin-1 and -2) (1322). VEGF-A binding to VEGFR2 is believed to be the key signaling pathway mediating angiogenesis (14,23). VEGF-A enhances proliferation and survival, promotes cell migration, increases vascular permeability, and alters gene expression in endothelial cells (13,14). VEGF-B binding to VEGFR1 promotes the survival of endothelial cells, pericytes, and smooth muscle cells and upregulates the expression of prosurvival genes (24). VEGF-C and VEGF-D bind to the receptors, VEGFR2 and VEGFR3 (22). VEGF-C expression has been shown to be associated with advanced metastasis in colorectal cancer (25) and to play a role in lymphangiogenesis and/or metastasis to lymph nodes in multiple types of cancer, including colorectal (26) and breast cancer (27,28). VEGF-D is also involved in lymphangiogenesis and lymphatic metastasis (29,30). On the other hand, in contrast to the well-studied VEGF signaling in endothelial cells, the VEGF signaling pathways in cells involved in bone repair, such as MSCs and osteoblasts, remains less well known (31). Osteoblasts express VEGFR1, VEGFR2 and the co-receptor, neuropilin (32). The expression of VEGF and its receptors in differentiating osteoblasts has been detected in cultured cells (32,33), and an in vitro cell culture study suggested a role for VEGFR2 in both osteoblast differentiation and survival (34).

In a recent study of ours, we established 3 MSC lines (SG-2, SG-3, and SG-5) derived from the bone marrow of green fluorescent protein (GFP)-transgenic mice (35). These cell lines clearly expressed the mouse MSC markers, stem cells antigen-1 (Sca-1) and CD44, and the SG-2 and SG-5 cells retained their potential for osteogenic and adipogenic differentiation. In addition, we examined the reactions of the TGF-β superfamily in these MSC lines. The analysis of cytokine and cytokine receptor expression in these MSC lines revealed that BMP receptor 1B was most strongly expressed in the SG-3 cells, which underwent osteogenesis in response to BMP. TGF-β receptor II was more strongly expressed in the SG-3 and SG-5 cells. However, we unexpectedly noted that the phosphorylation of Smad2, a major transcription factor, was induced by TGF-β1 in the SG-2 cells, but not in the SG-3 or SG-5 cells. These findings demonstrated the establishment of TGF-β-responsive SG-2 MSCs, BMP-responsive SG-3 MSCs, and TGF-β/BMP-non-responsive SG-5 MSCs.

In the present study, we focused on membrane proteins that are expressed specifically in SG-2 cells in order to facilitate the sorting and identification of the MSCs. VEGFR3, the gene product of FMS-like tyrosine kinase 4 (Flt4), was strongly expressed only in the SG-2 cells, but not in the SG-3 and SG-5 cells. Our findings demonstrate the role of VEGF-C, a specific ligand of VEGFR3, in the regenerative ability of the mouse MSC line, TGF-β-responsive SG-2 cells.

Materials and methods

Mouse MSC lines

In a recent study of ours, we described the establishment process and culture method for all MSC lines derived from the bone marrow of GFP-transgenic mice: TGF-β-responsive SG-2, BMP-responsive SG-3 and TGF-β/BMP-non-responsive SG-5 cells (35). These cell lines were cultured in Dulbecco's modified Eagle's medium (DMEM; Sigma-Aldrich, St. Louis, MO, USA) supplemented with 10% fetal bovine serum (FBS; HyClone, GE Healthcare Life Sciences, Logan, UT, USA, Logan, UT, USA) at 37°C under hypoxic conditions (5% O2, 5% CO2 and 90% N2).

DNA microarray analysis

Whole genome expression was analyzed for the bone-marrow derived SG-2, SG-3 and SG-5 MSC lines. Total RNA was extracted using ISOGEN reagent (Nippon Gene Co., Ltd., Tokyo, Japan). Filgen, Inc. (Nagoya, Japan) performed the DNA microarray analyses, including reverse transcription labeling, microarray hybridization, scanning and raw data analyses. For hybridization, 3 GeneChip Mouse Gene 2.0 ST arrays (Affymetrix, Santa Clara, CA, USA) were used. These analyses were conducted by the Research Institute of Bio-System Informatics (Tohoku Chemical Co., Ltd., Morioka, Japan).

Flow cytometry

Almost confluent SG-2, SG-3 and SG-5 cells (1.0×105) were suspended in ice-cold phosphate-buffered saline (PBS) containing 0.5% FBS and 2 mM EDTA. The cells were incubated with phycoerythrin (PE)-conjugated anti-mouse VEGFR3 (CD310) antibody (1:10, clone AFL4, #130-102-216; Miltenyi Biotec, Bergisch Gladbach, Germany) for 1 h at 4°C in the dark. Acquisition was performed with an EPICS XL ADC system (Beckman Coulter, Inc., Brea, CA, USA).

Western blot analysis

The SG-2, SG-3 and SG-5 cells were serum-starved overnight and stimulated with 10 ng/ml VEGF-C (R&D Systems, Inc., Minneapolis, MN, USA) for 1 h at 37°C under hypoxic conditions. The cells were washed twice with ice-cold PBS and then lysed in RIPA buffer (50 mM Tris-HCl, pH 7.2, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate and 0.1% SDS) containing protease and phosphatase inhibitor cocktails (Sigma-Aldrich). Protein content was measured using BCA reagent (Pierce/Thermo Fisher Scientific, Waltham, MA, USA). Samples containing equal amounts of protein were separated using 12.5% SDS-polyacrylamide gel electrophoresis and transferred to a polyvinylidene difluoride membrane (Merck Millipore, Darmstadt, Germany). After blocking with 5% non-fat dry milk in T-TBS (50 mM Tris-HCl, pH 7.2, 150 mM NaCl and 0.1% Tween-20), the membrane was incubated with primary anti-Akt (#9272), anti-phospho-Akt (Ser473) [phosphorylated (p-)Akt; #9271], anti-p44/42 mitogen-activated protein kinase (MAPK; ERK1/2; #9102), anti-phospho-p44/42 MAPK (Thr202/Tyr204) (p-ERK1/2; #9101), anti-p38 MAPK (p38; #9212), anti-phospho-p38 MAPK (T180/Y182) (p-p38; #9211), anti-stress-activated protein kinase/c-Jun N-terminal kinase (SAPK/JNK) (JNK; #9252) and anti-phospho-SAPK/JNK (Thr183/Tyr185) (p-JNK; #9251) antibodies (all from Cell Signaling Technology, Danvers, MA, USA), and anti-β-actin (clone C4; Santa Cruz Biotechnology, Dallas, TX, USA) antibody as a loading control for normalization. The blots were incubated with an alkaline phosphatase-conjugated secondary antibody and developed using the BCIP/NBT membrane phosphatase substrate system (Kirkegaard & Perry Laboratories, Gaithersburg, MD, USA).

Cell proliferation assay

Cell proliferation was analyzed using a colorimetric assay for cleavage of the tetrazolium salt WST-1 (Roche Diagnostics, Basel, Switzerland) by mitochondrial dehydrogenases in viable cells. The measured absorbance of the dye directly correlates with the number of metabolically active cells in the culture. The cells were cultured in 96-well plates (Nunc; Thermo Fisher Scientific) in growth medium with/without 10 ng/ml VEGF-C under hypoxic conditions. After 5 days, the cells were incubated for a further 1 h at 37°C with 100 µl medium containing 10 µl WST-1 reagent. The samples were shaken for 1 min, and absorbance was measured at 450 nm using an MPR-A4i microplate reader (Tosoh Corp., Tokyo, Japan).

Transwell migration assay

The migration assay was performed as reported previously using Transwell cell culture inserts (BD Biosciences, Franklin Lakes, NJ, USA) that were 6.5 mm in diameter with 8-µm pore filters (11). The cells (5.0×104) were suspended in 350 µl serum-free DMEM containing 0.1% BSA (Sigma-Aldrich) and seeded into the upper well; 600 µl normal growth medium with/without 10 ng/ml VEGF-C was placed in the lower well of the Transwell plate. Following incubation for 15 h under hypoxic conditions, the cells that had not migrated from the upper side of the filter were scraped off with a cotton swab, and the filters were stained with the three-step stain set (Diff-Quik; Sysmex, Kobe, Japan). The number of cells that had migrated to the lower side of the filter was counted under a light microscope in 5 high-power fields (×400 magnification; Olympus IX70; Olympus Corp., Tokyo, Japan). The experiment was performed in triplicate.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

The SG-2, SG-3 and SG-5 cells were stimulated with 10 ng/ml VEGF-C (R&D Systems) or 5.0 ng/ml TGF-β (Calbiochem, Merck Millipore). After 48 h, total RNA from each cell was isolated using ISOGEN reagent (Nippon Gene Co., Ltd.) according to the manufacturer's instructions. First-strand cDNA was synthesized from total RNA using the PrimeScript RT Reagent kit (Takara Bio, Otsu, Japan). RT-qPCR was performed on a Thermal Cycler Dice Real-Time system with SYBR Premix Ex Taq II (both from Takara Bio) and specific oligonucleotide primers (Table I) using a two-step cycle procedure (denaturation at 95°C for 5 sec, annealing and extension at 60°C for 30 sec) for 40 cycles. For each test run, cDNA derived from 50 ng total RNA as a template and 0.4 µM primer pair was used. mRNA expression was normalized to glyceraldehyde 3-phosphate dehydrogenase (Gapdh), and the relative amounts of each mRNA in each sample were calculated using the ΔΔCq method. The relative mRNA expression levels are expressed as fold increase or decrease relative to the control.

Table I

Primer sequences.

Table I

Primer sequences.

Gene nameSymbolPrimer sequence (5′→3′)
Prospero homeobox 1Prox1Forward: CGCTTAGCATTGCTGTTGCTG
Lymphatic vessel endothelial hyaluronan receptor 1Lyve1Forward: GAGCCATTCAAAGTACCAGGTCCTAA
Runt-related transcription factor 2Runx2Forward: GACGTGCCCAGGCGTATTTC
Alkaline phosphatase, liver/bone/kidneyAlplForward: ACACCTTGACTGTGGTTACTGCTGA
Integrin-binding sialoproteinIbspForward: AGAACAATCCGTGCCACTCACTC
Bone gamma-carboxyglutamate (gla) proteinBglapForward: CGGCCCTGAGTCTGACAAA
Glyceraldehyde 3-phosphate dehydrogenaseGapdhForward: TGTGTCCGTCGTGGATCTGA
Statistical analysis

All experiments were repeated at least 3 times. Representative images or data are shown. The numerical data are presented as the means ± standard deviation (SD). Differences between averages and percentages between control and tests were statistically analyzed using paired two-tailed Student's t-tests. A P-value <0.05 was considered to indicate a statistically significant difference.


Higher expression of VEGFR3 in SG-2 cells

To identify the genes that modulate the regenerative ability of MSCs, we used DNA microarrays to characterize the specific gene expression profiles observed in the TGF-β-responsive SG-2 cells. We identified 105 genes that were ≥10-fold more strongly expressed in the SG-2 cells compared to the SG-3 and SG-5 cells (Table II). Among these genes, we focused on VEGFR3, the Flt4 gene product, since, as a cell surface antigen, it is useful for identifying and sorting MSCs from various tissues. The gene expression level of Flt4 in the SG-2 cells was more than 16.5- and 32.0-fold higher than that in the SG-3 and SG-5 cells, respectively. These results were further confirmed by flow cytometry (Fig. 1) and indicated that the SG-2 cells expressed higher levels of VEGFR3 on the cell surface than the SG-3 and SG-5 cells.

Table II

Genes expressed ≥10-fold stronger in the SG-2 cells compared to the SG-3 and SG-5 cells.

Table II

Genes expressed ≥10-fold stronger in the SG-2 cells compared to the SG-3 and SG-5 cells.

SymbolGene nameFold change in SG-2
vs. SG-3vs. SG-5
ThrbThyroid hormone receptor beta75.758.4
Grhl2Grainyhead-like 2 (Drosophila)72.956.5
Olfr1497Olfactory receptor 149769.653.1
Arhgap15Rho GTPase activating protein 1566.551.4
Hoxd11Homeobox D1157.544.1
Cfc1Cripto, FRL-1, cryptic family 156.243.8
Kcnq5Potassium voltage-gated channel, subfamily Q, member 553.541.5
Scgb2b7Secretoglobin, family 2B, member 750.639.0
Fn3krpFructosamine 3 kinase related protein55.436.2
Tcp10aT-complex protein 10a43.541.6
Serpina6Serine (or cysteine) peptidase inhibitor, clade A, member 646.035.0
Ppp1r3fosProtein phosphatase 1, regulatory subunit 3F, opposite strand39.230.6
Syn3Synapsin III69.722.7
Lypd6LY6/PLAUR domain containing 638.330.4
Olfr772Olfactory receptor 77238.629.7
Olfr2Olfactory receptor 238.429.4
Zfp92Zinc finger protein 9226.543.1
Fam81bFamily with sequence similarity 81, member B38.128.8
Ssxb1Synovial sarcoma, X member B, breakpoint 137.428.6
Vmn2r25Vomeronasal 2, receptor 2536.728.7
Olfr368Olfactory receptor 36835.928.2
Arhgef4Rho guanine nucleotide exchange factor (GEF) 431.830.9
Il21Interleukin 2135.727.8
Fpr-rs3Formyl peptide receptor, related sequence 334.827.1
Cldn13Claudin 1334.427.0
Trim43cTripartite motif-containing 43C35.126.6
Caskin1CASK interacting protein 134.426.3
Commd7COMM domain containing 734.125.3
Prom2Prominin 233.525.4
St6galnac3ST6 (α-N-acetyl-neuraminyl-2,3-β-galactosyl-1,3)-N-acetyl-galactosaminide α-2,6-sialyltransferase 332.625.8
Slco6c1Solute carrier organic anion transporter family, member 6c130.423.6
Nhlrc4NHL repeat containing 429.823.7
Olfr117Olfactory receptor 11731.022.5
Igkv4-53Immunoglobulin κ variable 4-5326.325.3
Ctag2Cancer/testis antigen 228.822.9
F2rl3Coagulation factor II (thrombin) receptor-like 328.922.6
KynuKynureninase (L-kynurenine hydrolase)28.421.2
Spata22Spermatogenesis associated 2227.221.2
Vmn1r191Vomeronasal 1 receptor 19127.121.2
Ctnnd1Catenin (cadherin associated protein), delta 126.020.5
Vmn1r234Vomeronasal 1 receptor 23426.219.8
Zfp174Zinc finger protein 17426.419.5
Dgat2l6Diacylglycerol O-acyltransferase 2-like 625.719.7
Nudt12osNudix (nucleoside diphosphate linked moiety X)-type motif 12, opposite strand25.319.6
Zap70Zeta-chain (TCR) associated protein kinase25.319.1
Flt4FMS-like tyrosine kinase 416.532.0
Hes3Hairy and enhancer of split 3 (Drosophila)24.819.3
Sema6dSema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D15.833.9
Slc17a4Solute carrier family 17 (sodium phosphate), member 416.929.5
Tbx2T-box 224.018.1
Wdr95WD40 repeat domain 9522.717.6
Fer1l5Fer-1-like 5 (C. elegans)22.417.8
Gbx2Gastrulation brain homeobox 215.029.1
Cd33CD33 antigen22.417.6
Tdrd5Tudor domain containing 522.817.0
Lix1Limb expression 1 homolog (chicken)21.416.7
Lgals4Lectin, galactose binding, soluble 421.516.2
Pip5k1b Phosphatidylinositol-4-phosphate 5-kinase, type 1β21.415.9
Gsdma2Gasdermin A221.315.9
Ifi27l2bInterferon, α-inducible protein 27 like 2 beta16.019.8
Zcchc18Zinc finger, CCHC domain containing 1817.217.8
Olfr384Olfactory receptor 38419.515.5
Olfr1123Olfactory receptor 112311.433.8
Myo18bMyosin XVIIIb11.829.6
Ss18Synovial sarcoma translocation, Chromosome 1823.413.0
Plxna4os1Plexin A4, opposite strand 119.514.4
Fam115eFamily with sequence similarity 115, member E19.114.5
Fbxl5F-box and leucine-rich repeat protein 513.720.1
Megf10Multiple EGF-like-domains 1018.514.3
Robo3Roundabout homolog 3 (Drosophila)18.314.3
Igkv4-91Immunoglobulin kappa chain variable 4-9118.314.2
Elavl3ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)15.716.1
Slc17a8Solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 811.724.4
Gpr39G protein-coupled receptor 3915.715.8
Catsper1Cation channel, sperm associated 118.313.6
Zscan4aZinc finger and SCAN domain containing 4A17.413.8
Ceacam14Carcinoembryonic antigen-related cell adhesion molecule 1417.813.3
Acnat1Acyl-coenzyme A amino acid N-acyltransferase 112.417.8
Arhgap26Rho GTPase activating protein 2617.412.6
Olfr1270Olfactory receptor 127016.613.0
Lrrc25Leucine rich repeat containing 2511.419.1
Capsl Calcyphosine-like16.512.5
Gnl2Guanine nucleotide binding protein-like 2 (nucleolar)16.112.8
Ctnna3Catenin (cadherin associated protein), alpha 316.412.6
Itm2aIntegral membrane protein 2A16.412.4
Sema5bSema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B20.510.6
Il17cInterleukin 17C15.712.2
Chrna9Cholinergic receptor, nicotinic, alpha polypeptide 915.412.1
Acap1ArfGAP with coiled-coil, ankyrin repeat and PH domains 110.817.0
Spint5Serine protease inhibitor, Kunitz type 515.111.4
Rab5bRAB5B, member RAS oncogene family12.513.3
Olfr1122Olfactory receptor 112210.516.4
Grm8Glutamate receptor, metabotropic 817.610.1
Igh-VJ558Immunoglobulin heavy chain (J558 family)14.411.2
Ptprz1Protein tyrosine phosphatase, receptor type Z, polypeptide 114.411.1
Cd300lhCD300 antigen-like family member H15.210.4
Mcoln1Mucolipin 111.712.8
Olfr649Olfactory receptor 64913.910.9
Tlr8Toll-like receptor 813.910.7
Mb21d1Mab-21 domain containing 110.813.2
Itgb1bp2Integrin beta 1 binding protein 213.310.5
Defb28Defensin beta 2813.310.4
Cypt2Cysteine-rich perinuclear theca 213.410.3
Promotion of the migratory ability and proliferative activity of SG-2 cells by VEGF-C

Subsequently, we examined the effects of VEGF-C, a specific ligand of VEGFR3, on the MSC lines (SG-2, SG-3 and SG-5). Indeed, VEGF-C significantly stimulated SG-2 cell proliferation (Fig. 2A) and cell migration (Fig. 2B), but had no effect on the SG-3 or SG-5 cells. These results strongly suggest that VEGF-C specifically promotes the proliferative activity and migratory ability of the SG-2 cells through VEGFR3.

Phosphorylation of ERK1/2 in SG-2 cells by stimulation with VEGF-C

To clarify the signaling pathways activated by VEGF-C in SG-2 cells, we evaluated the phosphorylation status of molecules in the PI3K/Akt- and MAPK-mediated pathways. ERK1/2 phosphorylation was markedly upregulated in the SG-2 cells upon VEGF-C stimulation, whereas that in the SG-3 and SG-5 cells was unaffected (Fig. 3). These results suggest that VEGF-C enhances the proliferative activity and migratory ability of the MSCs through the ERK1/2 pathway in Flt4-positive SG-2 cells.

Increase in the expression of lymphatic endothelial differentiation marker genes following stimulation of SG-2 cells with VEGF-C

The VEGF-C gene encodes a ligand for VEGFR3 that is expressed mainly in lymphatic endothelia (18). Furthermore, the VEGF-C/VEGFR3 pathway was the first critical pathway described for the development of the lymphatic vascular tree (36). As the SG-2 cells respond to both TGF-β and VEGF-C, we examined the effects of TGF-β or VEGF-C stimulation on their multi-differentiation potential. VEGF-C clearly and significantly increased the mRNA expression levels of the lymphatic endothelial cell markers, prospero homeobox 1 (Prox1) and lymphatic vessel endothelial hyaluronan receptor 1 (Lyve1) (p<0.01), in the SG-2 cells, whereas the levels were clearly and significantly decreased following stimulation of the cells with TGF-β (p<0.05; Fig. 4A and B). We previously reported that TGF-β promotes the osteogenic differentiation of bone marrow-derived MSCs (10). Therefore, in this study, we further investigated the mRNA expression of osteogenic differentiation markers in the SG-2 cells following TGF-β or VEGF-C stimulation. TGF-β clearly and significantly increased the expression of the early-stage osteogenic differentiation marker genes, Runt-related transcription factor 2 (Runx2) and alkaline phosphatase, liver/bone/kidney (Alpl) (p<0.01), in the SG-2 cells; by contrast, VEGF-C clearly and significantly decreased the expression of these early-stage osteogenic differentiation markers (p<0.05; Fig. 4C and D). Of note, TGF-β unexpectedly decreased the expression of the late-stage osteogenic differentiation markers, integrin-binding sialoprotein (Ibsp) and bone gamma-carboxyglutamate (Gla) protein (Bglap) (p<0.05; Fig. 4E and F). On the other hand, as expected, VEGF-C suppressed the expression of these late-stage differentiation markers (p<0.01; Fig. 4E and F). These results suggest that VEGF-C and TGF-β reciprocally regulate the commitment of MSCs to differentiate into lymphatic endothelial or osteoblastic phenotypes, respectively. On the other hand, both TGF-β and VEGF-C appear to suppress the final maturation of osteoblastic MSC differentiation during late-stage osteogenesis.


As demonstrated in our previous study, the TGF-β-responsive, Flt4-positive SG-2 MSC line retained both osteogenic and adipogenic differentiation potentials (35). Herein, we focused on SG-2-specific membrane protein expression and identified high expression levels of VEGFR3, the Flt4 gene product (Table II and Fig. 1). Furthermore, we found that the VEGFR3-specific ligand, VEGF-C, significantly increased the proliferative activity and migratory ability of the SG-2 cells (Fig. 2). VEGF potently promotes angiogenesis and is indispensable for vascular development (37,38), and the tyrosine kinase receptor, VEGFR2, is the primary transmitter of VEGF signals in endothelial cells (39,40). The binding of VEGF-A to VEGFR2 activates downstream signaling, including the MAPK pathways (41,42). Other VEGF family members and other signaling mediators affect and overlap with the function of VEGF-A (22,43,44). VEGFR3 is activated by the VEGF homologues, VEGF-C and VEGF-D, which, when fully proteolytically processed, also stimulate VEGFR2 and induce the formation and activation of VEGFR2-VEGFR3 heterodimers (36,45,46). Since in this study VEGF-C stimulation induced ERK1/2 phosphorylation in the SG-2 cells, the promotion of the migratory ability and proliferative activity of Flt4-positive MSCs appears to depend on the activation of the MAPK cascade (Fig. 3).

The VEGF-C/VEGFR3 pathway was the first critical pathway described for the development of the lymphatic vascular tree (36). It has been demonstrated that VEGFR3 expression starts during mouse embryonic day 8.5 in developing blood vessels, and VEGFR3-deficient embryos die at midgestation from defects in the remodeling of primary vascular networks (47). In adult tissues, VEGFR3 expression occurs mainly in lymphatic endothelial cells (4750), and VEGFR3-positive lymphatic vessels appear concurrently with blood vessels during wound healing, but regress rapidly (51). However, VEGFR3-expressing endothelial cells may also be found in the fenestrated capillaries of several adult organs, including the bone marrow, splenic and hepatic sinusoids, kidney glomeruli and endocrine glands (50). Notably, in human cancer, VEGFR3-expressing vascular endothelial cells are detected in angiogenic capillaries (52,53), and the inactivation of VEGFR3 signaling with blocking antibodies in nude mice has been shown to suppress tumor growth by inhibiting angiogenesis (54).

MSCs have been reported to home towards hypoxic micro-environments in vivo, and hypoxic tumor cells specifically recruit MSCs by activating survival pathways that facilitate tumor progression (55). Based on these findings, the results of our study suggest that Flt4-positive MSCs play an important role in tumor angiogenesis and lymphatic vessel formation. Previous studies have demonstrated the VEGF-mediated differentiation of lymphatic endothelial cells from bone marrow-derived MSCs (56,57).

In this study, our results indicated that stimulation with VEGF-C increased the expression of lymphatic endothelial cell marker genes in Flt4-positive SG-2 cells (Fig. 4A and B). More interestingly, VEGF-C suppressed the expression of osteogenic differentiation marker genes (Fig. 4C and D). On the other hand, TGF-β suppressed the lymphatic endothelial commitment of SC-2 cells (Fig. 4A and B). Thus, we concluded that VEGF-C and TGF-β reciprocally regulate MSC commitment to differentiation into lymphatic endothelial or osteoblastic phenotypes, respectively. However, TGF-β and VEGF-C both seem to suppress the maturation of osteoblastic MSC differentiation at the late stage of the osteogenic process, suggesting that additional cellular signals must be necessary for the progression of osteoblastic differentiation of some types of MSCs. In addition, VEGF-C positively regulated the migration and proliferation of the Flt4-positive SG-2 cells (Fig. 2). The migratory ability and the proliferative activity are necessary conditions of MSCs, suggesting the novel possibility that VEGF-C plays an important role in determining MSC characteristics.

Our findings provide new insight into the molecular mechanisms underlying the regenerative activity of MSCs. In future studies, we aim to determine whether these results are reproducible in vivo by transplanting GFP-expressing SG-2 cells into suitable animal experimental models to facilitate their discrimination from the surrounding donor cells.


The present study was supported in part by JSPS KAKENHI grant nos. 25463053 to N.C., 25893221 and 15K20633 to S.S., 26462932 to H.K. and 26670852 to A.I.; a Grant-in-Aid for Strategic Medical Science Research Centre from the Ministry of Education, Culture, Sports, Science and Technology of Japan, 2010–2014; and a grant from the Keiryokai Research Foundation grant no. 120 to N.C. and S.S., 2013.



Prockop DJ: Marrow stromal cells as stem cells for nonhematopoietic tissues. Science. 276:71–74. 1997. View Article : Google Scholar : PubMed/NCBI


Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, Moorman MA, Simonetti DW, Craig S and Marshak DR: Multilineage potential of adult human mesenchymal stem cells. Science. 284:143–147. 1999. View Article : Google Scholar : PubMed/NCBI


Docheva D, Popov C, Mutschler W and Schieker M: Human mesenchymal stem cells in contact with their environment: surface characteristics and the integrin system. J Cell Mol Med. 11:21–38. 2007. View Article : Google Scholar : PubMed/NCBI


Vidane AS, Zomer HD, Oliveira BM, Guimarães CF, Fernandes CB, Perecin F, Silva LA, Miglino MA, Meirelles FV and Ambrósio CE: Reproductive stem cell differentiation: extracellular matrix, tissue microenvironment, and growth factors direct the mesenchymal stem cell lineage commitment. Reprod Sci. 20:1137–1143. 2013. View Article : Google Scholar : PubMed/NCBI


Chen BY, Wang X, Chen LW and Luo ZJ: Molecular targeting regulation of proliferation and differentiation of the bone marrow-derived mesenchymal stem cells or mesenchymal stromal cells. Curr Drug Targets. 13:561–571. 2012. View Article : Google Scholar : PubMed/NCBI


Soleymaninejadian E, Pramanik K and Samadian E: Immunomodulatory properties of mesenchymal stem cells: cytokines and factors. Am J Reprod Immunol. 67:1–8. 2012. View Article : Google Scholar


Chau JF, Leong WF and Li B: Signaling pathways governing osteoblast proliferation, differentiation and function. Histol Histopathol. 24:1593–1606. 2009.PubMed/NCBI


Pountos I, Georgouli T, Henshaw K, Bird H, Jones E and Giannoudis PV: The effect of bone morphogenetic protein-2, bone morphogenetic protein-7, parathyroid hormone, and platelet-derived growth factor on the proliferation and osteogenic differentiation of mesenchymal stem cells derived from osteoporotic bone. J Orthop Trauma. 24:552–556. 2010. View Article : Google Scholar : PubMed/NCBI


Hughes FJ, Turner W, Belibasakis G and Martuscelli G: Effects of growth factors and cytokines on osteoblast differentiation. Periodontol. 2000 41:48–72. 2006. View Article : Google Scholar


Yokota J, Chosa N, Sawada S, Okubo N, Takahashi N, Hasegawa T, Kondo H and Ishisaki A: PDGF-induced PI3K-mediated signaling enhances the TGF-β-induced osteogenic differentiation of human mesenchymal stem cells in a TGF-β-activated MEK-dependent manner. Int J Mol Med. 33:534–542. 2014.PubMed/NCBI


Aomatsu E, Takahashi N, Sawada S, Okubo N, Hasegawa T, Taira M, Miura H, Ishisaki A and Chosa N: Novel SCRG1/BST1 axis regulates self-renewal, migration, and osteogenic differentiation potential in mesenchymal stem cells. Sci Rep. 4(3652)2014. View Article : Google Scholar : PubMed/NCBI


Ferrara N: Vascular endothelial growth factor: basic science and clinical progress. Endocr Rev. 25:581–611. 2004. View Article : Google Scholar : PubMed/NCBI


Ellis LM and Hicklin DJ: VEGF-targeted therapy: mechanisms of anti-tumour activity. Nat Rev Cancer. 8:579–591. 2008. View Article : Google Scholar : PubMed/NCBI


Dvorak HF: Vascular permeability factor/vascular endothelial growth factor: a critical cytokine in tumor angiogenesis and a potential target for diagnosis and therapy. J Clin Oncol. 20:4368–4380. 2002. View Article : Google Scholar : PubMed/NCBI


Orlandini M, Marconcini L, Ferruzzi R and Oliviero S: Identification of a c-fos-induced gene that is related to the platelet-derived growth factor/vascular endothelial growth factor family. Proc Natl Acad Sci USA. 93:11675–11680. 1996. View Article : Google Scholar : PubMed/NCBI


Roche PA and Cresswell P: Proteolysis of the class II-associated invariant chain generates a peptide binding site in intracellular HLA-DR molecules. Proc Natl Acad Sci USA. 88:3150–3154. 1991. View Article : Google Scholar : PubMed/NCBI


Olofsson B, Pajusola K, Kaipainen A, von Euler G, Joukov V, Saksela O, Orpana A, Pettersson RF, Alitalo K and Eriksson U: Vascular endothelial growth factor B, a novel growth factor for endothelial cells. Proc Natl Acad Sci USA. 93:2576–2581. 1996. View Article : Google Scholar : PubMed/NCBI


Joukov V, Pajusola K, Kaipainen A, Chilov D, Lahtinen I, Kukk E, Saksela O, Kalkkinen N and Alitalo K: A novel vascular endothelial growth factor, VEGF-C, is a ligand for the Flt4 (VEGFR-3) and KDR (VEGFR-2) receptor tyrosine kinases. EMBO J. 15(1751)1996.PubMed/NCBI


Soker S, Takashima S, Miao HQ, Neufeld G and Klagsbrun M: Neuropilin-1 is expressed by endothelial and tumor cells as an isoform-specific receptor for vascular endothelial growth factor. Cell. 92:735–745. 1998. View Article : Google Scholar : PubMed/NCBI


Migdal M, Huppertz B, Tessler S, Comforti A, Shibuya M, Reich R, Baumann H and Neufeld G: Neuropilin-1 is a placenta growth factor-2 receptor. J Biol Chem. 273:22272–22278. 1998. View Article : Google Scholar : PubMed/NCBI


Neufeld G, Kessler O and Herzog Y: The interaction of Neuropilin-1 and Neuropilin-2 with tyrosine-kinase receptors for VEGF. Adv Exp Med Biol. 515:81–90. 2002. View Article : Google Scholar


Cao Y: Positive and negative modulation of angiogenesis by VEGFR1 ligands. Sci Signal. 2:re12009. View Article : Google Scholar : PubMed/NCBI


Kerbel RS: Tumor angiogenesis. N Engl J Med. 358:2039–2049. 2008. View Article : Google Scholar : PubMed/NCBI


Zhang F, Tang Z, Hou X, Lennartsson J, Li Y, Koch AW, Scotney P, Lee C, Arjunan P, Dong L, et al: VEGF-B is dispensable for blood vessel growth but critical for their survival, and VEGF-B targeting inhibits pathological angiogenesis. Proc Natl Acad Sci USA. 106:6152–6157. 2009. View Article : Google Scholar : PubMed/NCBI


Hanrahan V, Currie MJ, Gunningham SP, Morrin HR, Scott PA, Robinson BA and Fox SB: The angiogenic switch for vascular endothelial growth factor (VEGF)-A, VEGF-B, VEGF-C, and VEGF-D in the adenoma-carcinoma sequence during colorectal cancer progression. J Pathol. 200:183–194. 2003. View Article : Google Scholar : PubMed/NCBI


Wang TB, Chen ZG, Wei XQ, Wei B and Dong WG: Serum vascular endothelial growth factor-C and lymphoangiogenesis are associated with the lymph node metastasis and prognosis of patients with colorectal cancer. ANZ J Surg. 81:694–699. 2011. View Article : Google Scholar


Skobe M, Hawighorst T, Jackson DG, Prevo R, Janes L, Velasco P, Riccardi L, Alitalo K, Claffey K and Detmar M: Induction of tumor lymphangiogenesis by VEGF-C promotes breast cancer metastasis. Nat Med. 7:192–198. 2001. View Article : Google Scholar : PubMed/NCBI


Wu QW, She HQ, Liang J, Huang YF, Yang QM, Yang QL and Zhang ZM: Expression and clinical significance of extracellular matrix protein 1 and vascular endothelial growth factor-C in lymphatic metastasis of human breast cancer. BMC Cancer. 12(47)2012. View Article : Google Scholar


Karnezis T, Shayan R, Caesar C, Roufail S, Harris NC, Ardipradja K, Zhang YF, Williams SP, Farnsworth RH, Chai MG, et al: VEGF-D promotes tumor metastasis by regulating prostaglandins produced by the collecting lymphatic endothelium. Cancer Cell. 21:181–195. 2012. View Article : Google Scholar : PubMed/NCBI


Stacker SA, Caesar C, Baldwin ME, Thornton GE, Williams RA, Prevo R, Jackson DG, Nishikawa S, Kubo H and Achen MG: VEGF-D promotes the metastatic spread of tumor cells via the lymphatics. Nat Med. 7:186–191. 2001. View Article : Google Scholar : PubMed/NCBI


Liu Y and Olsen BR: Distinct VEGF functions during bone development and homeostasis. Arch Immunol Ther Exp (Warsz). 62:363–368. 2014. View Article : Google Scholar


Deckers MM, Karperien M, van der Bent C, Yamashita T, Papapoulos SE and Löwik CW: Expression of vascular endothelial growth factors and their receptors during osteoblast differentiation. Endocrinology. 141:1667–1674. 2000. View Article : Google Scholar : PubMed/NCBI


Zelzer E, McLean W, Ng YS, Fukai N, Reginato AM, Lovejoy S, D'Amore PA and Olsen BR: Skeletal defects in VEGF(120/120) mice reveal multiple roles for VEGF in skeletogenesis. Development. 129:1893–1904. 2002.PubMed/NCBI


Alonso V, de Gortázar AR, Ardura JA, Andrade-Zapata I, Alvarez-Arroyo MV and Esbrit P: Parathyroid hormone-related protein (107-139) increases human osteoblastic cell survival by activation of vascular endothelial growth factor receptor-2. J Cell Physiol. 217:717–727. 2008. View Article : Google Scholar : PubMed/NCBI


Sawada S, Chosa N, Takizawa N, Yokota J, Igarashi Y, Tomoda K, Kondo H, Yaegashi T and Ishisaki A: Establishment of mesenchymal stem cell lines derived from the bone marrow of GFP-transgenic mice exhibiting diversity in intracellular TGF-β and BMP signaling. Mol Med Rep. 13:2023–2031. 2016.


Tammela T and Alitalo K: Lymphangiogenesis: molecular mechanisms and future promise. Cell. 140:460–476. 2010. View Article : Google Scholar : PubMed/NCBI


Ferrara N, Carver-Moore K, Chen H, Dowd M, Lu L, O'Shea KS, Powell-Braxton L, Hillan KJ and Moore MW: Heterozygous embryonic lethality induced by targeted inactivation of the VEGF gene. Nature. 380:439–442. 1996. View Article : Google Scholar : PubMed/NCBI


Carmeliet P, Mackman N, Moons L, Luther T, Gressens P, Van Vlaenderen I, Demunck H, Kasper M, Breier G, Evrard P, et al: Role of tissue factor in embryonic blood vessel development. Nature. 383:73–75. 1996. View Article : Google Scholar : PubMed/NCBI


Shalaby F, Rossant J, Yamaguchi TP, Gertsenstein M, Wu XF, Breitman ML and Schuh AC: Failure of blood-island formation and vasculogenesis in Flk-1-deficient mice. Nature. 376:62–66. 1995. View Article : Google Scholar : PubMed/NCBI


Gille H, Kowalski J, Li B, LeCouter J, Moffat B, Zioncheck TF, Pelletier N and Ferrara N: Analysis of biological effects and signaling properties of Flt-1 (VEGFR-1) and KDR (VEGFR-2). A reassessment using novel receptor-specific vascular endothelial growth factor mutants. J Biol Chem. 276:3222–3230. 2001. View Article : Google Scholar


Takahashi T, Ueno H and Shibuya M: VEGF activates protein kinase C-dependent, but Ras-independent Raf-MEK-MAP kinase pathway for DNA synthesis in primary endothelial cells. Oncogene. 18:2221–2230. 1999. View Article : Google Scholar : PubMed/NCBI


Meadows KN, Bryant P and Pumiglia K: Vascular endothelial growth factor induction of the angiogenic phenotype requires Ras activation. J Biol Chem. 276:49289–49298. 2001. View Article : Google Scholar : PubMed/NCBI


Huang H, Bhat A, Woodnutt G and Lappe R: Targeting the ANGPT-TIE2 pathway in malignancy. Nat Rev Cancer. 10:575–585. 2010. View Article : Google Scholar : PubMed/NCBI


Weis SM and Cheresh DA: αV integrins in angiogenesis and cancer. Cold Spring Harb Perspect Med. 1:a0064782011. View Article : Google Scholar


Dixelius J, Makinen T, Wirzenius M, Karkkainen MJ, Wernstedt C, Alitalo K and Claesson-Welsh L: Ligand-induced vascular endothelial growth factor receptor-3 (VEGFR-3) hetero-dimerization with VEGFR-2 in primary lymphatic endothelial cells regulates tyrosine phosphorylation sites. J Biol Chem. 278:40973–40979. 2003. View Article : Google Scholar : PubMed/NCBI


Nilsson I, Bahram F, Li X, Gualandi L, Koch S, Jarvius M, Söderberg O, Anisimov A, Kholová I, Pytowski B, et al: VEGF receptor 2/-3 heterodimers detected in situ by proximity ligation on angiogenic sprouts. EMBO J. 29:1377–1388. 2010. View Article : Google Scholar : PubMed/NCBI


Dumont DJ, Jussila L, Taipale J, Lymboussaki A, Mustonen T, Pajusola K, Breitman M and Alitalo K: Cardiovascular failure in mouse embryos deficient in VEGF receptor-3. Science. 282:946–949. 1998. View Article : Google Scholar : PubMed/NCBI


Kaipainen A, Korhonen J, Mustonen T, van Hinsbergh VW, Fang GH, Dumont D, Breitman M and Alitalo K: Expression of the fms-like tyrosine kinase 4 gene becomes restricted to lymphatic endothelium during development. Proc Natl Acad Sci USA. 92:3566–3570. 1995. View Article : Google Scholar : PubMed/NCBI


Jussila L, Valtola R, Partanen TA, Salven P, Heikkilä P, Matikainen MT, Renkonen R, Kaipainen A, Detmar M, Tschachler E, et al: Lymphatic endothelium and Kaposi's sarcoma spindle cells detected by antibodies against the vascular endothelial growth factor receptor-3. Cancer Res. 58:1599–1604. 1998.PubMed/NCBI


Partanen TA, Arola J, Saaristo A, Jussila L, Ora A, Miettinen M, Stacker SA, Achen MG and Alitalo K: VEGF-C and VEGF-D expression in neuroendocrine cells and their receptor, VEGFR-3, in fenestrated blood vessels in human tissues. FASEB J. 14:2087–2096. 2000. View Article : Google Scholar : PubMed/NCBI


Paavonen K, Puolakkainen P, Jussila L, Jahkola T and Alitalo K: Vascular endothelial growth factor receptor-3 in lymphangio-genesis in wound healing. Am J Pathol. 156:1499–1504. 2000. View Article : Google Scholar : PubMed/NCBI


Valtola R, Salven P, Heikkilä P, Taipale J, Joensuu H, Rehn M, Pihlajaniemi T, Weich H, deWaal R and Alitalo K: VEGFR-3 and its ligand VEGF-C are associated with angiogenesis in breast cancer. Am J Pathol. 154:1381–1390. 1999. View Article : Google Scholar : PubMed/NCBI


Partanen TA, Alitalo K and Miettinen M: Lack of lymphatic vascular specificity of vascular endothelial growth factor receptor 3 in 185 vascular tumors. Cancer. 86:2406–2412. 1999. View Article : Google Scholar : PubMed/NCBI


Kubo H, Fujiwara T, Jussila L, Hashi H, Ogawa M, Shimizu K, Awane M, Sakai Y, Takabayashi A, Alitalo K, et al: Involvement of vascular endothelial growth factor receptor-3 in maintenance of integrity of endothelial cell lining during tumor angiogenesis. Blood. 96:546–553. 2000.PubMed/NCBI


Rattigan Y, Hsu JM, Mishra PJ, Glod J and Banerjee D: Interleukin 6 mediated recruitment of mesenchymal stem cells to the hypoxic tumor milieu. Exp Cell Res. 316:3417–3424. 2010. View Article : Google Scholar : PubMed/NCBI


Wei L, Liu Y, Chen G, Fang Y, Song X, Dong P, Gao J, Liu R, Ding Z, Bi Y and Liu Z: Differentiation of lymphatic endothelial cells from bone marrow mesenchymal stem cells with VEGFs. Lymphology. 45:177–187. 2012.


Zhan J, Li Y, Yu J, Zhao Y, Cao W, Ma J, Sun X, Sun L, Qian H, Zhu W and Xu W: Culture medium of bone marrow-derived human mesenchymal stem cells effects lymphatic endothelial cells and tumor lymph vessel formation. Oncol Lett. 9:1221–1226. 2015.PubMed/NCBI

Related Articles

Journal Cover

April 2016
Volume 37 Issue 4

Print ISSN: 1107-3756
Online ISSN:1791-244X

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
Igarashi, Y., Chosa, N., Sawada, S., Kondo, H., Yaegashi, T., & Ishisaki, A. (2016). VEGF-C and TGF-β reciprocally regulate mesenchymal stem cell commitment to differentiation into lymphatic endothelial or osteoblastic phenotypes. International Journal of Molecular Medicine, 37, 1005-1013.
Igarashi, Y., Chosa, N., Sawada, S., Kondo, H., Yaegashi, T., Ishisaki, A."VEGF-C and TGF-β reciprocally regulate mesenchymal stem cell commitment to differentiation into lymphatic endothelial or osteoblastic phenotypes". International Journal of Molecular Medicine 37.4 (2016): 1005-1013.
Igarashi, Y., Chosa, N., Sawada, S., Kondo, H., Yaegashi, T., Ishisaki, A."VEGF-C and TGF-β reciprocally regulate mesenchymal stem cell commitment to differentiation into lymphatic endothelial or osteoblastic phenotypes". International Journal of Molecular Medicine 37, no. 4 (2016): 1005-1013.