Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
April-2016 Volume 37 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2016 Volume 37 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

miR-542-3p inhibits the growth and invasion of colorectal cancer cells through targeted regulation of cortactin

  • Authors:
    • Hao-Cheng Long
    • Xia Gao
    • Chang-Jiang Lei
    • Bin Zhu
    • Lei Li
    • Cheng Zeng
    • Jian-Bin Huang
    • Jia-Rui Feng
  • View Affiliations / Copyright

    Affiliations: Department of General Surgery, The Fifth Hospital of Wuhan, Wuhan, Hubei 430050, P.R. China, Department of Oncology, The Fifth Hospital of Wuhan, Wuhan, Hubei 430050, P.R. China
  • Pages: 1112-1118
    |
    Published online on: February 25, 2016
       https://doi.org/10.3892/ijmm.2016.2505
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Colorectal cancer is one of the most common malignancies. Previous studies have reported that cortactin (CTTN) is often overexpressed in tumors and is associated with metastasis and poor prognosis of patients. The abnormal expression of microRNAs (miRNAs or miRs) is closely related to the development and progression of various types of cancer, including colorectal cancer. However, little is known about the miRNAs targeting cortactin. In the present study, prediction using biological software revealed that cortactin has binding sites for miR-542-3p. Transfection with miR-542-3p mimic demonstrated that miR‑542-3p reduced the expression of cortactin in colorectal cancer cells. Dual luciferase reporter assays further demonstrated that miR-542-3p regulated cortactin in a targeted manner and that miR-542-3p expression was significantly downregulated in colorectal cancer cells. A cell proliferation assay and Transwell migration assay were undertaken: we noted that miR‑542-3p inhibited the proliferation and invasion of colorectal cancer cells while promoting their apoptosis. By contrast, cortactin acted antagonistically. When co-transfected with miR-542-3p mimic and CTTN overexpression vector, the inhibitory effect of miR-542-3p was blocked. This indicates that miR-542-3p regulates CTTN in a targeted manner to modulate the growth and invasion of colorectal cancer cells. The present study thus provides new targets for the prevention and treatment of colorectal cancer.

Introduction

Colorectal cancer is one of the most common malignancies, and its incidence has increased worldwide over the past two decades; it is the third most common cancer in the world (1). In China, it is the fourth most common cause of mortality (2). There is, therefore, an urgent need to study and understand the biological characteristics of colorectal cancer.

Cortactin is an actin-binding protein that is directly involved in the assembly of actin cytoskeleton. It was first identified as a substrate of oncogenic tyrosine kinase v-Src (3). Cortactin is encoded by the cortactin (CTTN) gene (formerly known as EMS1), which is located on chromosome 11q13; this region is amplified in various types of cancer, including head and neck, ovarian, breast, liver, and lung cancer (4). Current data has revealed that cortactin is overexpressed in many human tumors, including head and neck cancer, esophageal squamous cell carcinoma, colon cancer, gastric cancer, hepatocellular carcinoma, breast cancer and ovarian cancer (5–8). Previous studies have reported that gene amplification and increased mRNA expression of cortactin are associated with the metastasis and poor prognosis of tumors (8). A previous study compared the expression profiles of 39 metastasis-related genes, including CTTN, in highly and poorly metastatic liver cancer cells (9). The results showed that cortactin overexpression in poorly metastatic liver cancer cells increased the metastatic ability of cancer cmodulates cell motility, invasiveness, synaptogenesis, phagocytosis, tumorigenesis and metastasis (12). Moreover, it also functions as a key component of the signaling pathway involved in cytoskeleton remodeling.

MicroRNAs (miRNAs or miRs) are a class of small, non-coding RNA molecules consisting of 18–25 nucleotides. They regulate the expression of target genes at the post-transcriptional level and are involved in various biological processes, such as cell proliferation, differentiation, apoptosis, metabolism and tumorigenesis (13). Although the exact mechanism and functions of miRNAs have not yet been fully characterized, experimental (14,15) and clinical studies (16,17) have reported that abnormal miRNA expression is involved in the development and progression of various cancers, including colorectal cancer. Currently, the specific expression of more than 100 miRNAs has been studied in colon cancer tissues, cell lines and normal tissues (18). miRNAs play an important role not only in the development of colon cancer, but also in its progression and metastasis; according to a retrospective study by the University of Tokyo, high miR-21 expression is associated with vascular invasion, liver metastasis and tumor staging. In addition, miR-155 expression was found to positively correlate with lymph node metastasis in colorectal cancer, and overexpression of these two miRNAs in colorectal cancer patients was linked with reduced survival (19). However, the role of cortactin and related miRNAs in colorectal cancer had not previously received much scholarly attention. With this in mind, the present study was undertaken to examine their important role in colorectal cancer.

Materials and methods

Cell culture

The human colorectal cancer cell lines, LoVo, HCT116 and 293T cells were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA; www.ATCC.org) and cultured in high-glucose Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum (FBS) (both from Gibco-BRL, Gaithersburg, MD, USA). The cells were maintained at 37°C in an atmosphere of humidified air with 5% CO2 in a cell culture incubator.

Overexpression vector construction and transfection

RNA was extracted from LoVo cells using TRIzol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions, followed by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) to amplify the coding region of CTTN. The products were then digested with BamHI and EcoRI (Takara Biotechnology Co., Ltd., Dalian, China), cloned into pcDNA3.1 vectors, sequenced and verified. The primers used for CTTN amplification are shown in Table I. We used the biological algorithms, miRBase, miRanda, PITA and RegRNA, to predict candidate miRNAs in the 3′UTR region of the CTTN gene. Hsa-miR-542-3p mimic and mimic negative controls were synthesized by Shanghai GenePharma Co., Ltd. (Shanghai, China), and cortactin siRNA was purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA). The cells were seeded onto a 6-well plate at 1×105 cells/ml and incubated for 24 h. Transfection was performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions, when cell confluence reached approximately 70%. The concentrations of plasmid, miRNA and siRNA for transfection were 4 µg/ml, 100 nM/well and 100 nM/well, respectively.

Table I

Sequences of primers.

Table I

Sequences of primers.

NameSense (5′→3′)Antisense (5′→3′)Product sizes (bp)
Primer set for CTTNCGGGATCCGCCACCATGTCGGAATTCCTACTGCC
CDS amplification GGAAAGCTTCAGCAGGGCAGCTCCACAT
Primer set for RT-qPCR
GAPDH GGTATCGTGGAAGGACTC GTAGAGGCAGGGATGATG128
CTTN GCCGACCGAGTAGACAAG GTATTTGCCGCCGAAACC102
Primer set for CTTNCCGCTCGAGAGCTGCGCCCT ATAAGAATGCGGCCGCTCATA
3′UTR amplificationGGATCCTCA CCTATGAGGTGTGCTACAGG

[i] CDS, coding sequence; CTTN, cortactin. The underlining represents the restriction enzyme cutting site.

RT-qPCR

Total RNA was extracted from the cells using TRIzol (Invitrogen). One microgram of total RNA was used for the first-strand cDNA synthesis with a RevertAid™ First Strand cDNA Synthesis kit (Fermentas GmbH, St. Leon-Rot, Germany). RT-qPCR was performed using 10 µl 2X SYBR-Green PCR Master Mix (Toyobo, Tokyo, Japan), with 5 µl cDNA, 0.5 µl forward primer, 0.5 µl reverse primer, and 4 µl RNase-free ddH2O contained in 20 µl of reaction mixture. The primers used for CTTN amplification are shown in Table I. The reaction was performed as follows: one cycle of 95°C for 5 min and 40 cycles of 95°C for 30 sec, 58°C for 30 sec and 72°C for 30 sec. Three independent experiments were conducted for each sample. Data were compared using the 2−ΔΔCt method.

Western blot analysis

Total cellular proteins were extracted by incubating the cells in lysis buffer [1X PBS, 1% NP-40, 0.1% sodium dodecyl sulfate (SDS), 5 mM ethylenediaminetetraacetic acid (EDTA), 0.5% sodium deoxycholate, and 1 mM sodium with protease inhibitors]. The protein concentrations in the cell lysates were determined by bicinchoninic acid assay (Pierce, Rockford, IL, USA). SDS-polyacrylamide gel electrophoresis (PAGE) was performed in 8% glycine gels (Bio-Rad, Berkeley, CA, USA) loading equal amounts of proteins per lane. Following electrophoresis, the separated proteins were transferred to nitrocellulose membranes (Pierce) and blocked with 5% non-fat milk in TBST buffer for 1 h. The membranes were then incubated with cortactin (polyclonal, rabbit, #3502) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH; monoclonal, rabbit, #3683) antibodies (Cell Signaling Technology, Inc., Danvers, MA, USA) at 1:1,000 dilutions in 5% non-fat milk overnight at 4°C, and then anti-rabbit IgG monoclonal antibody conjugated with horseradish peroxidase (#7074; Cell Signaling Technology, Inc.) at 1:2,000 dilution for 1 h at room temperature. Protein bands were detected using the West Femto system (Pierce).

Dual luciferase assay

The CTTN 3′UTR was amplified from cDNA (primers are shown in Table I) and cloned into a psiCHECK-2 vector (Promega Corp., Beijing, China). A QuikChange II Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA, USA) was used in order to generate mutant-type CTTN 3′UTR in which the seven mutated nucleotides were underlined within the seed region of the miR-542-3p binding site. A reporter vector psiCHECK-2 carrying the 3′UTR sequences of CTTN was assayed for luciferase expression using the Dual-Glo Luciferase assay system (Promega Corp.) according to the manufacturer's instructions. Three independent experiments were performed.

Cell proliferation

Cell proliferation was estimated in 96-well plates using a colorimetric immunoassay, based on the measurement of 5-bromo-2′-deoxyuridine (BrdU) incorporation during DNA synthesis (BrdU ELISA kit; Roche Diagnostics GmbH, Mannheim, Germany). Following miRNA and/or plasmid transfection for 48 h, the medium was removed and cells were labeled with BrdU (10 mM) for 3 h at 37°C. The cells were fixed and incubated with peroxidase-conjugated anti-BrdU antibody (sheep polyclonal, 11647229001) for 90 min at room temperature. The peroxidase substrate, 3,3′,5,5′-tetramethylbenzidine, was then added, and BrdU incorporation was quantified by differences in absorbance at a wavelength of 370 minus 492 nm. Cell proliferation was expressed as the mean percentage of the control values (set at 100%).

Cell cycle analysis

The cells were pelleted (400 × g for 5 min at 4°C), washed twice with cold PBS, resuspended in 500 µl cold PBS, and then fixed for 1 h at 4°C by adding 500 µl fixation solution (2% w/v paraformaldehyde in PBS, pH 7.2). The fixed cells were pelleted, washed with cold PBS, resuspended in 1 ml of 70% ethanol added dropwise to the pellet while vortexing and then incubated overnight at 4°C. On the following day the cells were pelleted and resuspended in 1 ml propidium iodide solution (40 µg/ml with 100 µg/ml RNase A) for 30 min at 37°C in the dark and analyzed using a FACScan flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA).

Transwell Matrigel invasion assay

Invasion was evaluated using a Transwell Matrigel invasion assay (BD Biosciences, Shanghai, China). Briefly, 200 µl of the LoVO cells following transfection (1×106 cells/ml) and 600 µl complete medium were added to the upper and lower compartments of the chamber, respectively. Following incubation for 48 h, the cells migrating to the lower side of the filter were fixed with 4% paraformaldehyde for 15 min at room temperature, washed with PBS, stained with crystal violet, and then observed under an inverted microscope (CKX41; Olympus Corp, Tokyo, Japan).

Statistical analysis

The experiments were performed at least in triplicate, and the results are expressed as the means ± SD. Statistical analysis was performed using the SPSS statistical program version 17 (SPSS Inc., Chicago, IL, USA). A P-value <0.01 was considered to indicate a statistically significant difference.

Results

Prediction and validation of CTTN candidate miRNAs

In the present study, we used the biological algorithms miRBase, miRanda, PITA and RegRNA to predict candidate miRNAs in the 3′UTR region of the CTTN gene. In so doing, we identified hsa-miR-542-3p. Although previous studies have reported that miR-542-3p was downregulated in various types of tumor tissues and cells (20,21), few studies have evaluated its functions. The mimic of the above miRNA was synthesized and transfected into the LoVo and HCT116 cells. RT-qPCR and western blot analysis proved that hsa-miR-542-3p inhibits the expression of CTTN (Fig. 1 and 2). This indicates that miR-542-3p regulates CTTN expression by targeting this gene. However, this finding warrants further validation by dual-luciferase reporter assays.

Figure 1

CTTN expression in LoVo and HCT116 cells. (A) LoVo and (B) HCT116 cells were transfected with miR-542-3p mimic and/or CTTN overexpression vector and then measured using RT-qPCR. The experiments were carried out at least in triplicate and the results are expressed as the means ± SD (*P<0.01 vs. control). Control, untreated cells; NC, negative control.

Figure 2

Cortactin (CCTN) expression in colorectal cancer cells. Cortactin expression in LoVo and HCT116 cells following transfection with miRNA mimic and/or CTTN overexpression vector, as measured using western blot analysis. Each bar represents the means ± SD from three samples (*P<0.01). Control, untreated cells; NC, negative control.

CTTN is a target gene of miR-542-3p

The 3′UTR region of the CTTN gene was cloned into psiCHECK-2, a dual luciferase reporter vector, and the target sites of miR-542-3p were mutated (Fig. 3A, the underlined bases). The two plasmids were subsequently transfected, together with miR-542-3p mimic, into 293T cells, and the changes in luciferase expression were analyzed. Luciferase expression in the cells transfected with plasmids containing the 3′UTR of CTTN significantly declined by approximately 44% compared with the cells transfected with an empty reporter vector (Fig. 3B). By contrast, luciferase activity did not change significantly in the cells transfected with the plasmids containing the mutant 3′UTR of the CTTN gene. This indicates that miR-542-3p is strongly bound to the 3′UTR of the CTTN gene, suggesting that CTTN is a target gene of miR-542-3p.

Figure 3

CTTN is a target gene of miR-542-3p. (A) miR-542-3p target sites in the sequence of cortactin (CCTN) 3′UTR. (B) The luciferase expression level of 293T cells transfected with cloning CTTN 3′UTR vector or mutant CTTN 3′UTR vector and miR-542-3p mimic. The values are expressed as the means ± SD from three samples (*P<0.01 vs. control). Control, cells transfected with empty reporter vector.

miR-542-3p affects colorectal cancer cell proliferation and apoptosis by targeting CTTN

BrdU assays were performed to evaluate the effects of increased miR-542-3p expression on human colorectal cancer cell proliferation. The results showed that miR-542-3p significantly inhibited the proliferation of colorectal cancer cells, whereas CTTN overexpression increased the proliferation of colorectal cancer cells (Fig. 4). Co-transfection with miR-542-3p mimic and the vector causing the overexpression of CTTN abolished the anti-proliferative role of miR-542-3p. Flow cytometric analysis of the cell cycle and apoptosis demonstrated that the percentage of cells in the sub-G1 peak increased significantly when LoVo cells were transfected with miR-542-3p mimic (Fig. 5). Co-transfection with the miR-542-3p mimic and the CTTN overexpression vector overcame the pro-apoptotic effect of miR-542-3p. Tumor cells are resistant to apoptosis; however, the increased expression of miR-542-3p promoted apoptosis of tumor cells, indicating that miR-542-3p inhibits tumor growth.

Figure 4

Effects of miR-542-3p and cortactin (CCTN) on colorectal cancer cell proliferation. The cells were transfected with miR-542-3p mimic and/or CTTN overexpression vector, and cell proliferation was examined using a BrdU assay. Each bar represents the means ± SD from three samples (*P<0.01). Control, untreated cells; NC, negative control.

Figure 5

Effects of miR-542-3p and cortactin (CCTN) on the cell cycle distribution of LoVo cells as examined by flow cytometric analysis. The images are representative of three independent experiments with similar results. Control, untreated cells; NC, negative control.

miR-542-3p inhibits the invasion of colorectal cancer cells by targeting CTTN

Tumor cells are known to be generally invasive and metastatic (22). To determine whether miR-542-3p inhibits the invasive ability of colorectal cancer cells, we performed Transwell migration assays. We found that an increase in miR-542-3p expression significantly inhibited the invasive ability of LoVo cells, while CTTN overexpression increased the invasion rate (Fig. 6). Co-transfection with miR-542-3p mimic and CTTN overexpression vector overcame the anti-invasive effect of miR-542-3p. This shows that miR-542-3p inhibits the invasion of colorectal cancer cells by targeting the CTTN gene.

Figure 6

Effects of miR-542-3p and cortactin (CCTN) on the invasive ability of LoVo cells. (A) The cells were transfected with miR-542-3p mimic and/or CTTN-overexpressing vector, and the invasion of cells was evaluated using a Transwell Matrigel invasion assay. (B) Quantitative analysis of the anti-invasive effects of miR-542-3p and cortactin. Each bar represents the means ± SD from 3 samples (*P<0.01, vs. control). Control, untreated cells; NC, negative control.

Discussion

Colorectal cancer is known to be one of the most common malignancies; it is the third most common cancer and the second most deadly cancer. Its incidence and mortality are on the rise in China (1,2). Invasion and metastasis are major causes of resultant mortality in patients with colorectal cancer (18). No effective solution is currently available for controlling colorectal metastases, and the prevention and treatment of colorectal cancer metastases has long been a challenging issue facing the medical community.

Previous research has reported that the invasion and the metastasis of malignant tumors, such as colorectal cancer, is a complex, multistep process. This complex process is possible as cancer cells are motile (23). Motility is an essential, common feature of various stages in the invasion and metastasis of cancer cells (24). Previous research has reported that during the movement of cancer cells, actin polymerization (assembly) is the power source of cancer cell motility (25). It has previously been shown that actin polymerization depends on the catalysis of the Arp 2/3 complex, and the activation of the Arp 2/3 complex requires the CTTN-encoded product, cortactin (26). Cortactin is expressed in colon cancer cells and plays an important role in the motility of cancer cells (27). Lee et al (5) have reported that the high expression of CTTN positively correlates with the depth of invasion and distant metastases of colorectal cancer.

Several studies have reported that the abnormal expression of miRNAs is closely related to the development, progression, and prognosis of colorectal cancer (28,29). Notable progress has been made in the understanding of the biogenesis and mechanisms of action of miRNAs and their role in the diagnosis, treatment, and prognosis of colorectal cancer. However, few studies have been performed on miRNAs targeting CTTN. Only Zhang et al (30) found that miRNA-182 inhibits the proliferation and invasion of human lung adenocarcinoma cells through its effect on human cortical actin-associated protein. Hong et al (31) showed that VEGF-C increased CTTN expression by downregulating Dicer-mediated maturation of miR326, thereby relieving the suppressive effect of miR326 on CTTN expression. Given the important role of CTTN and miRNAs in colorectal cancer, we performed this study to gain greater insight into this issue. We found that miR-542-3p has target sites on CTTN. Moreover, the upregulation of miR-542-3p inhibited the expression of CTTN. Dual-luciferase reporter assays further confirmed that CTTN is a target gene of miR-542-3p.

A study by Wang et al (32) demonstrated that the circulating miRNAs, miR-646, miR-141 and miR-542-3p, potentially serve as non-invasive biomarkers for cervical squamous cell carcinoma. Althoff et al (20) concluded that miR-542-3p exerts its tumor suppressive function in neuroblastoma, at least in part, by targeting survivin and the expression of miR-542-3p, and thus targeting these is a promising therapeutic strategy for treating aggressive neuroblastoma. Thus, miR-542-3p has been demonstrated to function as a tumor suppressor gene, and to be involved in the development and progression of cancer. However, its specific mechanism of action remains unclear. In the present study, we proved that miR-542-3p inhibits the proliferation and invasion of colorectal cancer cells, and promotes their apoptosis by targeting the CTTN gene. The results of a study by Yoon et al (21) suggested that survivin is a direct target of miR-542-3p and growth inhibition by miR-542-3p has potential application as an anti-cancer therapy. Wang et al (33) have found that overexpression of miR-542-3p in cancer cells elevated p53 expression, stimulated the expression of p53 targets, and inhibited cell proliferation. It has been demonstrated by He et al (34) that miRNA-542-3p inhibits tumor angiogenesis by targeting angiopoietin-2. Moreover, Shen et al (35) have previously suggested that miRNA-542-3p suppresses the cell growth of gastric cancer cells by targeting oncogene astrocyte-elevated gene-1. Thus, miR-542-3p functions as a tumor suppressor gene by inhibiting the proliferation and invasion of tumor cells.

In conclusion, miR-542-3p inhibits CTTN expression by targeting this gene in colorectal cancer cells and hence suppresses the proliferation and invasion, as well as promoting the apoptosis, of colorectal cancer cells.

Acknowledgments

This study was supported by the Wuhan City Health Bureau of Medical Research project (no. WX12C27), the Wuhan Municipal Science and Technology Bureau of Applied Basic research project (no. 2015061701011630), the Education Department of Hubei Province Science and Technology research project (no. B2015230), and the fourth batch of 'Hanyang Concert Talent Plan'.

References

1 

Siegel R, Ma J, Zou Z and Jemal A: Cancer statistics, 2014. CA Cancer J Clin. 64:9–29. 2014. View Article : Google Scholar : PubMed/NCBI

2 

Li M and Gu J: Changing patterns of colorectal cancer in China over a period of 20 years. World J Gastroenterol. 11:4685–4688. 2005. View Article : Google Scholar : PubMed/NCBI

3 

Rothschild BL, Shim AH, Ammer AG, Kelley LC, Irby KB, Head JA, Chen L, Varella-Garcia M, Sacks PG, Frederick B, et al: Cortactin overexpression regulates actin-related protein 2/3 complex activity, motility, and invasion in carcinomas with chromosome 11q13 amplification. Cancer Res. 66:8017–8025. 2006. View Article : Google Scholar : PubMed/NCBI

4 

Schuuring E: The involvement of the chromosome 11q13 region in human malignancies: cyclin D1 and EMS1 are two new candidate oncogenes - a review. Gene. 159:83–96. 1995. View Article : Google Scholar : PubMed/NCBI

5 

Lee YY, Yu CP, Lin CK, Nieh S, Hsu KF, Chiang H and Jin JS: Expression of survivin and cortactin in colorectal adenocarcinoma: association with clinicopathological parameters. Dis Markers. 26:9–18. 2009. View Article : Google Scholar : PubMed/NCBI

6 

Luo ML, Shen XM, Zhang Y, Wei F, Xu X, Cai Y, Zhang X, Sun YT, Zhan QM, Wu M and Wang MR: Amplification and overexpression of CTTN (EMS1) contribute to the metastasis of esophageal squamous cell carcinoma by promoting cell migration and anoikis resistance. Cancer Res. 66:11690–11699. 2006. View Article : Google Scholar : PubMed/NCBI

7 

Timpson P, Wilson AS, Lehrbach GM, Sutherland RL, Musgrove EA and Daly RJ: Aberrant expression of cortactin in head and neck squamous cell carcinoma cells is associated with enhanced cell proliferation and resistance to the epidermal growth factor receptor inhibitor gefitinib. Cancer Res. 67:9304–9314. 2007. View Article : Google Scholar : PubMed/NCBI

8 

Buday L and Downward J: Roles of cortactin in tumor pathogenesis. Biochim Biophys Acta. 1775:263–273. 2007.PubMed/NCBI

9 

Chuma M, Sakamoto M, Yasuda J, Fujii G, Nakanishi K, Tsuchiya A, Ohta T, Asaka M and Hirohashi S: Overexpression of cortactin is involved in motility and metastasis of hepatocellular carcinoma. J Hepatol. 41:629–636. 2004. View Article : Google Scholar : PubMed/NCBI

10 

Weaver AM: Cortactin in tumor invasiveness. Cancer Lett. 265:157–166. 2008. View Article : Google Scholar : PubMed/NCBI

11 

van Rossum AG, Moolenaar WH and Schuuring E: Cortactin affects cell migration by regulating intercellular adhesion and cell spreading. Exp Cell Res. 312:1658–1670. 2006. View Article : Google Scholar : PubMed/NCBI

12 

Ayala I, Baldassarre M, Giacchetti G, Caldieri G, Tetè S, Luini A and Buccione R: Multiple regulatory inputs converge on cortactin to control invadopodia biogenesis and extracellular matrix degradation. J Cell Sci. 121:369–378. 2008. View Article : Google Scholar : PubMed/NCBI

13 

Esquela-Kerscher A and Slack FJ: Oncomirs - microRNAs with a role in cancer. Nat Rev Cancer. 6:259–269. 2006. View Article : Google Scholar : PubMed/NCBI

14 

Hashimoto Y, Akiyama Y and Yuasa Y: Multiple-to-multiple relationships between microRNAs and target genes in gastric cancer. PLoS One. 8:e625892013. View Article : Google Scholar : PubMed/NCBI

15 

Iwaya T, Yokobori T, Nishida N, Kogo R, Sudo T, Tanaka F, Shibata K, Sawada G, Takahashi Y, Ishibashi M, et al: Down-regulation of miR-144 is associated with colorectal cancer progression via activation of mTOR signaling pathway. Carcinogenesis. 33:2391–2397. 2012. View Article : Google Scholar : PubMed/NCBI

16 

Zhang GJ, Xiao HX, Tian HP, Liu ZL, Xia SS and Zhou T: Upregulation of microRNA-155 promotes the migration and invasion of colorectal cancer cells through the regulation of claudin-1 expression. Int J Mol Med. 31:1375–1380. 2013.PubMed/NCBI

17 

Chiang Y, Song Y, Wang Z, Liu Z, Gao P, Liang J, Zhu J, Xing C and Xu H: microRNA-192, -194 and -215 are frequently down-regulated in colorectal cancer. Exp Ther Med. 3:560–566. 2012.PubMed/NCBI

18 

Goel A and Boland CR: Recent insights into the pathogenesis of colorectal cancer. Curr Opin Gastroenterol. 26:47–52. 2010. View Article : Google Scholar :

19 

Shibuya H, Iinuma H, Shimada R, Horiuchi A and Watanabe T: Clinicopathological and prognostic value of microRNA-21 and microRNA-155 in colorectal cancer. Oncology. 79:313–320. 2010. View Article : Google Scholar

20 

Althoff K, Lindner S, Odersky A, Mestdagh P, Beckers A, Karczewski S, Molenaar JJ, Bohrer A, Knauer S, Speleman F, et al: miR-542-3p exerts tumor suppressive functions in neuroblastoma by downregulating Survivin. Int J Cancer. 136:1308–1320. 2015. View Article : Google Scholar

21 

Yoon S, Choi YC, Lee S, Jeong Y, Yoon J and Baek K: Induction of growth arrest by miR-542-3p that targets survivin. FEBS Lett. 584:4048–4052. 2010. View Article : Google Scholar : PubMed/NCBI

22 

Condeelis J and Segall JE: Intravital imaging of cell movement in tumours. Nat Rev Cancer. 3:921–930. 2003. View Article : Google Scholar

23 

Kedrin D, Wyckoff J, Sahai E, Condeelis J and Segall JE: Imaging tumor cell movement in vivo. Curr Protoc Cell Biol. Chapter 19: Unit 19.7. 2007. View Article : Google Scholar

24 

Kedrin D, van Rheenen J, Hernandez L, Condeelis J and Segall JE: Cell motility and cytoskeletal regulation in invasion and metastasis. J Mammary Gland Biol Neoplasia. 12:143–152. 2007. View Article : Google Scholar : PubMed/NCBI

25 

Pollard TD, Blanchoin L and Mullins RD: Molecular mechanisms controlling actin filament dynamics in nonmuscle cells. Annu Rev Biophys Biomol Struct. 29:545–576. 2000. View Article : Google Scholar : PubMed/NCBI

26 

Uruno T, Liu J, Zhang P, Fan YX, Egile C, Li R, Mueller SC and Zhan X: Activation of Arp2/3 complex-mediated actin polymerization by cortactin. Nat Cell Biol. 3:259–266. 2001. View Article : Google Scholar : PubMed/NCBI

27 

Hirakawa H, Shibata K and Nakayama T: Localization of cortactin is associated with colorectal cancer development. Int J Oncol. 35:1271–1276. 2009. View Article : Google Scholar : PubMed/NCBI

28 

Schepeler T, Reinert JT, Ostenfeld MS, Christensen LL, Silahtaroglu, Dyrskjøt L, Wiuf C, Sørensen FJ, Kruhøffer M, Laurberg S, et al: Diagnostic and prognostic microRNAs in stage II colon cancer. Cancer Res. 68:6416–6424. 2008. View Article : Google Scholar : PubMed/NCBI

29 

Slaby O, Svoboda M, Fabian P, Smerdova T, Knoflickova D, Bednarikova M, Nenutil R and Vyzula R: Altered expression of miR-21, miR-31, miR-143 and miR-145 is related to clinico-pathologic features of colorectal cancer. Oncology. 72:397–402. 2007. View Article : Google Scholar

30 

Zhang L, Liu T, Huang Y and Liu J: microRNA-182 inhibits the proliferation and invasion of human lung adenocarcinoma cells through its effect on human cortical actin-associated protein. Int J Mol Med. 28:381–388. 2011.PubMed/NCBI

31 

Hong CC, Chen PS, Chiou J, Chiu CF, Yang CY, Hsiao M, Chang YW, Yu YH, Hung MC, Hsu NW, et al: miR326 maturation is crucial for VEGF-C-driven cortactin expression and esophageal cancer progression. Cancer Res. 74:6280–6290. 2014. View Article : Google Scholar : PubMed/NCBI

32 

Wang WT, Zhao YN, Yan JX, Weng MY, Wang Y, Chen YQ and Hong SJ: Differentially expressed microRNAs in the serum of cervical squamous cell carcinoma patients before and after surgery. J Hematol Oncol. 7:62014. View Article : Google Scholar : PubMed/NCBI

33 

Wang Y, Huang JW, Castella M, Huntsman DG and Taniguchi T: p53 is positively regulated by miR-542-3p. Cancer Res. 74:3218–3227. 2014. View Article : Google Scholar : PubMed/NCBI

34 

He T, Qi F, Jia L, Wang S, Song N, Guo L, Fu Y and Luo Y: MicroRNA-542-3p inhibits tumour angiogenesis by targeting angiopoietin-2. J Pathol. 232:499–508. 2014. View Article : Google Scholar : PubMed/NCBI

35 

Shen X, Si Y, Yang Z, Wang Q, Yuan J and Zhang X: MicroRNA-542-3p suppresses cell growth of gastric cancer cells via targeting oncogene astrocyte-elevated gene-1. Med Oncol. 32:3612015. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Long H, Gao X, Lei C, Zhu B, Li L, Zeng C, Huang J and Feng J: miR-542-3p inhibits the growth and invasion of colorectal cancer cells through targeted regulation of cortactin. Int J Mol Med 37: 1112-1118, 2016.
APA
Long, H., Gao, X., Lei, C., Zhu, B., Li, L., Zeng, C. ... Feng, J. (2016). miR-542-3p inhibits the growth and invasion of colorectal cancer cells through targeted regulation of cortactin. International Journal of Molecular Medicine, 37, 1112-1118. https://doi.org/10.3892/ijmm.2016.2505
MLA
Long, H., Gao, X., Lei, C., Zhu, B., Li, L., Zeng, C., Huang, J., Feng, J."miR-542-3p inhibits the growth and invasion of colorectal cancer cells through targeted regulation of cortactin". International Journal of Molecular Medicine 37.4 (2016): 1112-1118.
Chicago
Long, H., Gao, X., Lei, C., Zhu, B., Li, L., Zeng, C., Huang, J., Feng, J."miR-542-3p inhibits the growth and invasion of colorectal cancer cells through targeted regulation of cortactin". International Journal of Molecular Medicine 37, no. 4 (2016): 1112-1118. https://doi.org/10.3892/ijmm.2016.2505
Copy and paste a formatted citation
x
Spandidos Publications style
Long H, Gao X, Lei C, Zhu B, Li L, Zeng C, Huang J and Feng J: miR-542-3p inhibits the growth and invasion of colorectal cancer cells through targeted regulation of cortactin. Int J Mol Med 37: 1112-1118, 2016.
APA
Long, H., Gao, X., Lei, C., Zhu, B., Li, L., Zeng, C. ... Feng, J. (2016). miR-542-3p inhibits the growth and invasion of colorectal cancer cells through targeted regulation of cortactin. International Journal of Molecular Medicine, 37, 1112-1118. https://doi.org/10.3892/ijmm.2016.2505
MLA
Long, H., Gao, X., Lei, C., Zhu, B., Li, L., Zeng, C., Huang, J., Feng, J."miR-542-3p inhibits the growth and invasion of colorectal cancer cells through targeted regulation of cortactin". International Journal of Molecular Medicine 37.4 (2016): 1112-1118.
Chicago
Long, H., Gao, X., Lei, C., Zhu, B., Li, L., Zeng, C., Huang, J., Feng, J."miR-542-3p inhibits the growth and invasion of colorectal cancer cells through targeted regulation of cortactin". International Journal of Molecular Medicine 37, no. 4 (2016): 1112-1118. https://doi.org/10.3892/ijmm.2016.2505
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team