Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
December-2016 Volume 38 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2016 Volume 38 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Seven novel and six de novo PHEX gene mutations in patients with hypophosphatemic rickets

  • Authors:
    • Shan-Shan Li
    • Jie-Mei Gu
    • Wei-Jia Yu
    • Jin-Wei He
    • Wen-Zhen Fu
    • Zhen-Lin Zhang
  • View Affiliations / Copyright

    Affiliations: Metabolic Bone Disease and Genetics Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People's Hospital, Shanghai 200233, P.R. China
    Copyright: © Li et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 1703-1714
    |
    Published online on: November 7, 2016
       https://doi.org/10.3892/ijmm.2016.2796
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Inactivating mutations in phosphate-regulating gene with homologies to endopeptidase on the X chromosome (PHEX) have been identified as a cause of X-linked hypophosphatemic rickets (XLH; OMIM 307800). In the present study, we enrolled 43 patients from 18 unrelated families clinically diagnosed with hypophosphatemic rickets and 250 healthy controls. For each available individual, all 22 exons with their exon-intron boundaries of the PHEX gene were directly sequenced. The levels of serum fibroblast growth factor 23 (FGF23) were measured as well. Sequencing analysis detected 17 different PHEX gene mutations, and 7 of these were identified as novel: 3 missense mutations, including c.304G>A (p.Gly102Arg) in exon 3, c.229T>C (p.Cys77Arg) in exon 3 and c.824T>C (p.Leu275Pro) in exon 7; 2 deletion mutations, including c.528delT (p.Glu177LysfsX44) in exon 5 and c.1234delA (p.Ser412ValfsX12) in exon 11; and 2 alternative splicing mutations, including c.436_436+1delAG in intron 4 at splicing donor sites and c.1483-1G>C in intron 13 at splicing acceptor sites. Moreover, 6 mutations were proven to be de novo in 6 sporadic cases and the probands were all females. No mutations were found in the 250 healthy controls. The serum levels of FGF23 varied widely among the patients with XLH, and no significant difference was found when compared with those of the healthy controls. On the whole, the findings of this study provide new insight into the spectrum of PHEX mutations and provide potential evidence of a critical domain in PHEX protein. In addition, the finding of an overlap of the serum FGF23 levels between the patients with XLH and the healthy controls indicates its limited diagnostic value in XLH.

Introduction

Inherited hypophosphatemic rickets, characterized by bone mineralization disorders due to hypophosphatemia, secondary to a leak of phosphate from the kidneys, was first introduced by Albright et al (1). The clinical characteristics of the disease include growth retardation, bending of the weight-bearing extremities, and the resistance to vitamin D therapy during early childhood. Subsequently, patients suffer from spontaneous dental abscesses, extensive bone pain and arthropathy with aging. X-linked hypophosphatemic rickets (XLH; OMIM 307800), with an occurrence of appproximately 1 in 20,000 live births, is known as the most prevalent form of inherited hypophosphatemic rickets (2,3). The mutation in the phosphate-regulating gene with homologies to endopeptidase on the X chromosome (PHEX; MIM 300550) was identified in 1995 as the causative gene for the disease (4). Thereafter, the genetic basis of other less prevalent types of inherited hypophosphatemic rickets, such as autosomal dominant hypophosphatemic rickets (ADHR; OMIM 193100) and autosomal recessive hypophosphatemic rickets (ARHR1; OMIM 241520), was successively clarified (5,6). Nevertheless, the underlying pathogenesis for some sporadic cases without known genetic mutations remains to be determined and the significant findings of key roles of microRNAs (miRNAs of miRs) involved in bone formation may provide potential research issues (7–9).

The PHEX gene, located on X chromosome Xp22.1, is composed of 22 exons spanning 243 kb and encodes for 749 amino acid proteins (10). It exhibits great homology to the M13 zinc metallopeptidases, a class of type 2 integral membrane glycoproteins that includes neprilysin (NEP), endothelin-converting enzymes 1 and 2 (ECE-1 and ECE-2), as well as the Kell antigen (KELL) (11). These proteins show the common structural traits of a short N-terminal cytoplasmic domain, a single transmembrane hydrophobic region and a large extracellular domain. The latter contains 10 highly conserved cysteine residues and two zinc-binding motifs and is involved in the secondary structure conformation or catalytic activity of the protein (11). It has been demonstrated that the tissue-specific expression of the PHEX gene and its mRNA expression is predominantly detected in bone lineage cells; for instance, osteoblasts, osteocytes and odontoblasts (10,12). However, the exact mechanisms through which inactivated PHEX leads to abnormal skeletal and renal manifestations in XLH have not yet been fully clarified. Studies have suggested the existence of phosphatonin that is responsible for the regulation of phosphate homeostasis in the Hyp mouse (13), an animal model of XLH with a 3′ deletion of the PHEX gene. Based on the finding of increased fibroblast growth factor 23 (FGF23) transcripts in the Hyp mouse, FGF23 was then regarded as a leading candidate for phosphatonin downstream of PHEX (14).

An extensive mutation analysis of the genetic defects of the PHEX gene only revealed a few cases in China (15–21). In the present study, we screened a total of 18 affected families for mutations in the PHEX gene in order to interpret the mutation traits in Chinese patients and potentially provide evidence of a critical domain in PHEX protein. Moreover, the serum FGF23 levels in affected individuals were also measured as this may also contribute to our understanding of the molecular basis of XLH.

Materials and methods

Ethics statement and study subjects

This study was approved by the Ethics Committee of the Shanghai Jiao Tong University Affiliated Sixth People's Hospital (Shanghai, China) and all subjects or their guardians (for the under-aged participants) provided written informed consent prior to enrollment. The subjects enrolled in this study were from the Department of Osteoporosis and Bone Diseases in Shanghai Jiao Tong University Affiliated Sixth People's Hospital, Shanghai, China over the past 3 years. A total of 18 unrelated Chinese families with hypophosphatemic rickets was examined and all subjects were of Han ethnicity. The pedigrees of the families with hypophosphatemic rickets are shown in Fig. 1. The diagnosis of hypophosphatemic rickets was mainly based on a history of childhood rickets, clinical manifestations and biochemical tests indicating hypophosphatemia along with elevated levels of serum alkaline phosphatases. Patients with secondary rickets due to malnutrition, medication or tumor-induced osteomalacia were excluded. Finally, 65 individuals, including 43 patients, and 250 unrelated healthy controls were recruited and subjected to blood sampling followed by DNA analyses. In addition, another 95 healthy controls with normal serum phosphate and calcium levels and normal renal function were randomly selected to carry out measurements of serum levels of FGF23 in order to derive a reference range.

Figure 1

Pedigree of families 1–11 with hypophosphatemic rickets. The black symbols represent the affected individuals, and the open symbols represent the unaffected individuals. The circles and squares indicate females and males, respectively. The arrows identify the probands in the families. Pedigree of families 12–18 with hypophosphatemic rickets. The black symbols represent the affected individuals, and the open symbols represent the unaffected individuals. The circles and squares indicate females and males, respectively. The arrows identify the probands in the families.

Mutation screening

To detect mutations in the PHEX gene, all DNA samples from the probands were initially analyzed. When a PHEX mutation was confirmed, DNA from first-degree relatives, as well as the symptomatic individuals was then screened for the detected mutation. A proband was identified as a sporadic case if the PHEX mutation was not detected in the parents, namely if both were asymptomatic.

Mutation analyses of the affected individuals were performed by the direct sequencing of polymerase chain reaction (PCR) products amplified from genomic DNA. The DNA was extracted from peripheral white blood cells by proteinase K digestion followed by purification with phenol/chloroform and isopropyl alcohol precipitation. The DNA sequence for the PHEX gene was obtained from the available online database (NCBI Reference Sequence Accession no. NG_007563.2). All the 22 exons with their adjacent intronic sequences of the PHEX gene were amplified by PCR with 21 pairs of sequencing primers designed using Primer 3 software (http://bioinfo.ut.ee/primer3-0.4.0/). The primer sequences are presented in Table I. Direct sequencing was performed using the BigDye Terminator Cycle Sequencing Ready Reaction kit, version 3.1 and the PCR products were directly sequenced using an automated ABI PRISM 3130 sequencer (both from Applied Biosystems, Foster City, CA, USA). Simultaneously, single-nucleotide polymorphisms (SNPs) were identified using PolyPhred (http://droog.gs.washington.edu/polyphred/) and novel mutations were identified using HGMD (http://www.hgmd.cf.ac.uk/). Mutations were checked using Mutalyzer 2.0 (http://mutalyzer.nl/check). The DNA sequences obtained were aligned with homologous sequences that had been deposited into GenBank using the CluxtalX 1.83 algorithm. To predict the impact of missense mutations on protein structure and function, Polymorphism Phenotyping v2 (PolyPhen-2; http://genetics.bwh.harvard.edu/pph2) (22) and Sorting Tolerant from Intolerant (SIFT; http://sift.jcvi.org) (23) were used based on sequence alignments.

Table I

List of primer sequences used for PCR amplification of the PHEX gene.

Table I

List of primer sequences used for PCR amplification of the PHEX gene.

ExonsForward primer (5′→3′)Reverse primer (5′→3′)
1 AGGGACTTTGCTGAGGGAGAG CCACTCGAAGCCACTTACACC
2 TGGGTTTTGGAATACCGTGTC AAGAGAGGCCATTCAGCCTTC
3 CAAGGCTTGGAAACTGGTTGA TTATGTTGAGATCTGGGAGTCCA
4 GGCACCATATGTGGGTGGATA GTTTGCCCTGCTGACTTTGTC
5 CACATTGAAGCGTGGATCGTA CGGGAGAAGGGAATATTCTGG
6 GCTCTGCCCAATCATGTTACC GCAGCCTGGTAAGGCACATAG
7 GGGTGCCTGGTATTGCATAAT CCAATGGGCAATGACACAAA
8 ACCACACCAAAGCCTTGAAAA GAGCCAATGCCAACAATTACC
9 GGATGGCAATGATCAGGAGTT GACAGTGCTTTTGGCCAGTTC
10 ATGTTCACTCTGAGGGCTGGA GGCTACAAACTCCCCCTGTCT
11 CAGCCATGGGTTTTATCCAAA CCCACTCCCCTGGAAAACTAC
12 AGTGTTGCCAGAGCATGGAGT AGGAAAGGCCGAATTACAAGG
13 TCGATTCAGTCACCTTCTCCA GAAAGGCACAAGGCCAGTAAA
14 TGACTGATGCAGCTTCTCTGC ATGCTAGAAATGGGGGACCTG
15 GCAGGGACAGCCCTTTAGATT GCCACTTTTGGGGGAAATAAG
16 GTGCAAAATGGTTTCCCTGAA GTCCAGCCATACACCCTGGTA
17 AAGCAGTTTATCTTGGCTTTCCA CAAGCCATCACAGCAAGACAC
18 CTGCTTTTTGAAGGCTTGTCG ATGCCTGGTTAAGGGATGACC
19 TTGATGCCTCTTGCTGAATGA AAATGAACCTAGCCCCAAGGA
20 TGGTAAGCAACAGGACATGGA AGGGCTGCTAACCCATTTGAT
21 TTCCTGGGCACATATACGATTC TTTTGGCTGCAAAATGGAAAT
22 CAGAACCTGTTGATGTGCAAGA GCCAACACCCTAAAATGGACA

[i] PCR, polymerase chain reaction; PHEX, phosphate-regulating gene with homology to endopeptidase on the X chromosome.

Measurement of circulating intact FGF23 levels

Serum FGF23 leels were measured using an intact human FGF23 enzyme-linked immunosorbent assay (ELISA) kit obtained from Kainos Laboratories Inc. (Tokyo, Japan). The detectable concentration ranged from 3 to 800 pg/ml. This assay has been validated in previous studies (16,24).

Statistical analyses

Normally distributed variables are presented as the means ± SD, and non-normally distributed variables as the median (2.5th and 97.5th percentiles). Comparisons between groups were made using unpaired Student's t-tests for normal data, and the Wilcoxon rank sum test for non-normal data. Values of P<0.05 were considered to indicate statistically significant differences. Statistical analyses were performed using SPSS 13.0 software.

Results

The baseline clinical data and PHEX gene mutation analyses of 65 participants originating from 18 families are summarized in Table II. A total of 43 patients was confirmed to have XLH according to their clinical and genetic evidence. All the patients exhibited varying degrees of growth retardation, bending legs, dental anomalies, hypophosphatemia, markedly elevated serum alkaline phosphatase levels and normal serum calcium. The median (25th and 75th percentiles) age of the patients was 22.0 (8.3, 29.5) years and the median serum phosphate levels were 0.70 (0.57, 0.80) mmol/l.

Table II

Clinical findings and PHEX mutations identified in families affected by XLH.

Table II

Clinical findings and PHEX mutations identified in families affected by XLH.

Family no.PatientaGenderAge (years)Clinical characteristicsSerum P-value (mmol/l)bMutation siteMutation typeDNA levelProtein level
1III-2F21Growth retardation; teeth falling out; genu valgum0.68Exon 15Missensec.1601C>Tp.P534L
III-1F22Growth retardation; genu valgum0.73Exon 15Missensec.1601C>Tp.P534L
II-7F48Short stature; teeth falling out; genu valgum0.75Exon 15Missensec.1601C>Tp.P534L
2III-1M30Growth retardation; teeth falling out; genu varumNAExon 11Nonsensec.1294A>Tp.K432X
I-2F78Short stature0.56Exon 11Nonsensec.1294A>Tp.K432X
II-3M51Short stature; failure to walk; teeth falling out; genu varum0.64Exon 11Nonsensec.1294A>Tp.K432X
3II-2F23Growth retardation; genu varum0.86Exon 22Missensec.2192T>Cp.F731S
I-1M53Short stature; genu varum0.72Exon 22Missensec.2192T>Cp.F731S
4IV-2M5Growth retardation; genu varum0.84Intron13Alternative splicingc.1483-1G>Cp.?
III-4F39Short stature0.54Intron 13Alternative splicingc.1483-1G>Cp.?
5II-2F28Short stature; genu varum0.60Intron 10Alternative splicingc.1174-1G>Ap.?
III-1F4Growth retardation; genu varum0.67Intron 10Alternative splicingc.1174-1G>Ap.?
6III-15F11Growth retardation; teeth falling out; genu varum0.75Exon 11Deletionc.1234delAp.S412VfsX12
II-12F36Short stature; teeth falling out; genu varum0.60Exon 11Deletionc.1234delAp.S412VfsX12
II-8F43Short stature; teeth falling out; genu varum0.77Exon 11Deletionc.1234delAp.S412VfsX12
III-11M11Growth retardation; genu varum0.68Exon 11Deletionc.1234delAp.S412VfsX12
III-12F12Growth retardation; genu varum0.77Exon 11Deletionc.1234delAp.S412VfsX12
7III-3F28Short stature; genu varum0.69Intron 4Alternative splicing c.436_436+1delAGp.?
II-4F59Short stature; genu varumNAIntron 4Alternative splicing c.436_436+1delAGp.?
II-6F56Short stature; genu varum0.54Intron 4Alternative splicing c.436_436+1delAGp.?
II-8F52Short stature; genu varumNAIntron 4Alternative splicing c.436_436+1delAGp.?
8III-3F27Short stature; genu varum0.55Exon 7Missensec.824T>Cp.L275P
III-2F30Short stature; genu varum0.42Exon 7Missensec.824T>Cp.L275P
IV-1F8Growth retardation; genu varum0.90Exon 7Missensec.824T>Cp.L275P
II-4F54Growth retardation; genu varum; teeth falling out0.62Exon 7Missensec.824T>Cp.L275P
9IV-3F19Growth retardation; genu valgum0.50Exon 8Nonsensec.931C>Tp.E311X
10III-1F2Genu varum; rib eversion; pectus carinatum0.75Intron 7Alternative splicingc.849+1G>Cp.?
11III-1F10Growth retardation; genu varum0.70Intron 4Alternative splicingc.436+1G>Cp.?
12IV-10F24Short stature; genu varum; thoracic deformity0.55Exon 3Missensec.304G>Ap.G102R
III-5M53Short stature; genu varum; spinal deformity; teeth falling out0.32Exon 3Missensec.304G>Ap.G102R
IV-8F27Short stature; genu varum; loose teeth0.64Exon 3Missensec.304G>Ap.G102R
13II-4F27Short stature; genu varum; teeth falling out0.56Exon 3Missensec.229T>Cp.C77R
III-2F1.5Genu varum; pillow bald0.88Exon 3Missensec.229T>Cp.C77R
14III-6M30Short stature; teeth falling out; lower limb deformity; limited mobility0.53Exon 18Insertionc.1843dupAp.T615nfsX6
II-10F63Short stature; lower limb deformity0.40Exon 18Insertionc.1843dupAp.T615nfsX6
III-1M36Short stature; lower limb deformity0.52Exon 18Insertionc.1843dupAp.T615nfsX6
III-5F31Short stature; lower limb deformity0.75Exon 18Insertionc.1843dupAp.T615nfsX6
15III-2M8Growth retardation; genu varum; pectus carinatum; rib eversion0.87Intron 14Alternative splicing c.1586_1586+1delAGp.?
III-1F10Growth retardation; genu varum0.54Intron 14Alternative splicing c.1586_1586+1delAGp.?
II-5F37Short stature; genu varum0.65Intron 14Alternative splicing c.1586_1586+1delAGp.?
16III-1F5Genu varum0.78Exon 5Deletionc.528delTp.E177KfsX44
17III-1F4Genu varum1.02Intron 14Alternative splicing c.1586_1586+1delAGp.?
18III-1F15Genu varum; teeth falling out0.54Exon 8Nonsensec.871C>Tp.R291X

a All the patients were pre-treated with calcitriol and phosphate apart from patient II2 in family 3 (F3-II2);

b The normal range for serum phosphate is 0.8–1.6 mmol/l. M, male; F, female; NA, not available.

We identified 17 different mutations in the PHEX gene from 18 unrelated families and the distribution of PHEX mutations were 6 alternative splicing mutations (35.3%), 5 missense mutations (29.4%), 3 nonsense mutations (17.6%), 2 deletion mutations (11.8%) and 1 insertion mutation (5.9%) (Fig. 2). Among these, 7 mutation sites were identified as novel and they were respectively detected from families 4, 6, 7, 8, 12, 13 and 16: c.1483-1G>C in intron 13 at splicing acceptor sites leading to truncated protein, c.1234delA (p.Ser412ValfsX12) in exon 11, c.436_436+1delAG in intron 4 at splicing donor sites leading to truncated protein, c.824T>C (p.Leu275Pro) in exon 7, c.304G>A (p.Gly102Arg) in exon 3, c.229T>C (p.Cys77Arg) in exon 3 and c.528delT (p.Glu177LysfsX44) in exon 5. PolyPhen−2 and SIFT were performed to assess the missense mutational consequence of PHEX, and all 3 missense mutations were predicted to be probably damaging with a score of 0.930 for L275R, 0.917 for G102R and 1.000 for C77R, and a SIFT score of <0.05. Notably, the amino acid residues at p.275, p.102 and p.77 were evolutionarily highly conserved across 12 different species as shown in Fig. 3. In addition, the probands from families 9, 10, 11, 16, 17 and 18 were identified as sporadic cases and the detected PHEX mutations were likely to be de novo, and the 6 probands were all female patients.

Figure 2

Mutational analyses of phosphate-regulating gene with homology to endopeptidase on the X chromosome (PHEX) gene in patients with hypophosphatemic rickets. (A) c.1601C>T in exon 15, (B) c.1294A>T in exon 11, (C) c.2192T>C in exon 22, (D) c.1483-1G>C in intron 13, (E) c.1174−1G>A in intron 11, (F) c.1234delA in exon 11, (G) c.436_436+1delAG in intron 4, (H) c.824T>C in exon 7, (I) c.931C>T in exon 8, (J) c.849+1G>C in intron 7, (K) c.436+1G>C in intron 4, (L) c.229T>C in exon 3. Mutational analyses of PHEX gene in patients with hypophosphatemic rickets. (M) c.304G>A in exon 3, (N) c.1843dupA in exon 18, (O) c.1586_1586+1delAG in intron 14, (P) c.528delT in exon 5 and (Q) c.871C>T in exon 8.

Figure 3

Evolutionary conservation of the residues p.77, p.102 and p.275. The C77R, G102R and L275P mutations occur at a highly conserved position in phosphate-regulating gene with homology to endopeptidase on the X chromosome (PHEX) gene, as shown by comparing the corresponding sequences of 12 different species.

Serum FGF23 levels were not normally distributed in either the normal controls or the XLH patients. The median value for intact serum FGF23 levels from the 95 healthy individuals aged between 22 to 77 years was 40.6 pg/ml and the reference range (2.5th and 97.5th percentiles) was from 24.6 to 136.8 pg/ml (Table III). For the patients with XLH, as shown in Table IV, the serum FGF23 levels were below the reference range in 4 of 11 subjects, within the range in 4 subjects, and mildly elevated in 3 subjects. The serum FGF23 levels exhibited a wide variation in the patients with XLH, and no significant differences were found when compared with those of the normal controls (p>0.05).

Table III

Serum intact human FGF23 levels in healthy controls.

Table III

Serum intact human FGF23 levels in healthy controls.

SubjectsFGF23 (pg/ml)SubjectsFGF23 (pg/ml)SubjectsFGF23 (pg/ml)SubjectsFGF23 (pg/ml)SubjectsFGF23 (pg/ml)
149.32045.73926.85847.27753.9
262.02120.74061.05950.37856.9
337.02231.94147.26029.97925.8
433.02337.04260.06130.48029.6
533.52434.54349.36243.28140.2
626.32551.34440.66340.18234.0
737.02634.04547.76460.58337.8
841.62793.14640.16537.68441.4
9153.82842.14756.96653.98534.1
1031.92931.44835.06751.38638.3
1123.83068.14959.06850.38747.6
1244.23171.75028.46930.98849.0
1335.03275.351136.07048.38939.3
1444.73365.65226.37141.19047.5
15116.63450.35338.17264.691137.4
16116.13539.15435.57335.09228.7
1751.83639.65527.47441.19335.1
1833.53782.45667.67530.99439.6
1930.93837.65733.57638.19554.6

[i] FGF23, fibroblast growth factor 23.

Table IV

Serum intact human FGF23 in patients with XLH.

Table IV

Serum intact human FGF23 in patients with XLH.

Family no.- PatientaGenderAge (years)Serum P-value (mmol/l)bSerum FGF23 (pg/ml)cMutations in PHEX gene
F2-III1M30NA38.7c.1294A>T (Exon 11)
F2-II3M510.6440.4c.1294A>T (Exon 11)
F3-II2F230.8621.1c.2192T>C (Exon 22)
F5-II2F280.607.8c.1174-1G>A (Intron 10)
F6-III15F110.75171.5c.1234delA (Exon 11)
F9-IV3F190.5029.7c.931C>T (Exon 8)
F10-III1F20.75111.4c.849+1G>C (Intron 7)
F11-III1F100.7015.7c.436+1G>C (Intron 4)
F12-III5M530.3224.0c.304G>A (Exon 3)
F12-IV10F240.55162.2c.304G>A (Exon 3)
F12-IV8F270.64143.2c.304G>A (Exon 3)

a All the patients were pre-treated with calcitriol and phosphate apart from patient II-2 from family 3 (F3-II2).

b The normal range for phosphate is 0.8–1.6 mmol/l.

c Serum FGF23 in healthy controls (n=95): median 40.6 pg/ml, reference range (2.5th and 97.5th percentiles) 24.6–136.8 pg/ml. FGF23, fibroblast growth factor 23; M, male; F, female.

Discussion

Based on the PHEX mutation database (http://www.PHEXdb.mcgill.ca), the frequencies of different mutation types were 25% frameshifts, 23% alternative splicing, 22% missense, 18% nonsense, 8% deletion and 4% polymorphisms. The mutations were scattered throughout the gene and the majority would potentially influence the pattern of post-translational modification of the protein and alter its secondary structure, resulting in the loss of PHEX function (25,26). In this study, we identified 17 different PHEX mutations from 18 unrelated Chinese families, and to the best of our knowledge, 7 were novel.

Three novel missense mutations, namely, Cys77Arg, Gly102Arg and Leu275Pro, were detected. The residue p.77 was amongst the 10 highly conserved cysteine residues that were critical for disulfide-bond formation and protein folding (25,26). Thus, the single base change at this position would likely alter the secondary structure of the protein and render it out of action. Gly102 has been found to be conserved among NEP, PHEX and ECE-1 according to the multiple sequence alignment analysis in molecular research (27). Additionally, the glycine to arginine exchange was likely to increase the local charge of the PHEX gene product as arginine was positively charged, while glycine had an uncharged polar group. Therefore, it is possible that this base alteration plays a role in a different spatial conformation. The novel missense mutation detected in exon 7 involved a substitution of proline for leucine at residue 275. To date, there are only 14 different mutations confirmed in exon 7 and it is among the rarest mutant exons in line with the PHEX mutation database. Moreover, this site was estimated to be conserved with the replaced leucine occurred in both ECE-1 and PHEX. The 3 novel missense mutations identified in this study were shown to be highly conserved under the protein alignment of the PHEX gene from 12 different species and were verified to be pathogenic by bioinformatics tools (PolyPhen-2 and SIFT), which also rendered the evidence of their potential value for the phenotype in patients with XLH.

Three nonsense mutations: Lys432X in exon 11, Arg291X and Gln311X in exon 8 were detected in this study, all of which would cause the translation of truncated protein with accidental loss of C-terminal region. It was demonstrated that the C-terminal region in the large extracellular domain was abundant in conserved cysteine residues and contained the zinc-binding motifs in exons 17 and 19 (10,11). The cysteine residues are responsible for the secondary structure formation and contribute to conformation integrity. The highly conserved zinc-binding motifs among NEP, PHEX, ECE-1 and KELL, are essential for the catalytic activity of the protein. Therefore, these 2 nonsense mutations would inevitably lead to impaired PHEX protein function.

Six of the 17 PHEX mutations were identified as alternative splicing mutations, including 3 splice acceptor mutations and 3 splice donor mutations. Among these, 2 were novel mutations: 436_436+1delAG in the splice donor site of exon 4 and an alteration of C to G in intronic sequence 5' to initiate exon 11, -1 bp upstream. These 2 splicing mutations were predicted to result in the skipping of exons 4 and 11, respectively. Notably, both of the 2 affected exons comprised one conserved cyteine residue that was relevant for secondary structure transformation and thus protein function. That is, the newly identified 2≈splicing mutations were associated with the onset of XLH.

The remaining 3 mutations were 1234delA in exon 11, c.528delT in exon 5 and 1843dupA in exon 18, characterized as frameshift mutations. The mutation occurring in exon 18 was first reported by Gauche et al (28). It caused the replacement of aspartic acid for threonine at residue 615 and opened a new reading frame for 6 amino acids and deemed to disrupt the overall integrity of the PHEX protein. Moreover, the hetero-PHEX protein. Moreover, the heteroprotein. Moreover, the hetero zygous deletion of one adenine nucleotide and one thymine nucleotide in exons 11 and 5 were 2 novel mutations identified in our study. These mutations would result in premature termination of the PHEX protein.

No hotspot mutations were found in XLH according to the present study in accordance with previous studies on PHEX mutations in Chinese patients (15–21). However, it was valued that exceeding 50% mutations occurred around exons 18 to 22 in the C-terminal region based on the mutation analyses in PHEXdb and it was speculated that this region may be the critical domain for PHEX function (29). We failed to determine the gene dosage effect on disease severity by comparing the phenotypes of hemizygous males to those of heterozygous females from the same family. An evidence-based study also indicated that there was no difference in severity of the disease between genders in mutant Hyp mouse (30). Theoretically, heterozygous females should have a less severe phenotype due to random X-inactivation, the process of transcriptional silencing of one of the X chromosomes bringing about half of the normal alleles, while males have none. Sabbagh et al owed the absence of gene dose effect to a threshold of PHEX activity that was required for maintaining normal protein function (25). In addition to the gender impact, questions remain as to the possibility of correlations among either mutation location or type with phenotype severity. In the present study, the association between genotype and phenotype in patients with XLH was not observed. It has been proposed that there is a trend towards a more severe phenotype with mutations located in the C-terminal region or with truncating mutations (31); however, this has yet to be verified in a larger sample size.

The aberrant activity of FGF23 was revealed as a common fundamental mechanism for the development of defects in phosphate and vitamin D metabolism in several hypophosphatemic diseases, including ADHR, XLH and tumor-induced osteomalacia (TIO) (5,32,33). The Hyp mouse, an animal model of XLH, provided evidence of increased levels of FGF23 transcripts due to the inactivated mutations of PHEX. Furthermore, an injection of FGF23 antibodies or the deletion of Fgf23 from the Hyp mouse has been shown to ameliorate or reverse the phosphate metabolic disorders (14,34). These findings strongly indicate the essential role of FGF23 in the regulation of systemic phosphate homeostasis in the Hyp mouse. However, we failed to observe a significant increase in serum FGF23 levels in all affected individuals compared with the healthy controls. Moreover, 4 of 11 patients with XLH even exhibited serum FGF23 levels below the reference range. Despite of the effect of confounding factors, the wide variation in serum FGF23 levels in XLH, as well as the overlapping FGF23 levels in XLH and healthy controls revealed its limited diagnostic value in patients with suspected XLH. Moreover, it was speculated that other factors, such as parathyroid hormone and 1,25-dihydroxyvitamin-D, were responsible for hypophosphatemia in patients with XLH with inappropriate low to normal serum FGF23 levels, and for the normal serum phosphorus in healthy subjects with high serum FGF23 levels (33,34). Additionally, it was suggested that hypophosphatemia alone was not entirely responsible for the skeletal phenotype in XLH and the potential direct local effects of FGF23 may be involved in bone mineralization independent of its systematic action in phosphate homeostasis (35,36).

In conclusion, we identified 17 different mutations in the PHEX gene in 18 unrelated Chinese families with hypophosphatemic rickets and 7 of these were novel. It should be noted that that 6 of the 17 PHEX mutations have been proven to be de novo, which suggests the frequent occurrence of sporadic cases of XLH in the Chinese population. The findings of the present study highlight the major role of PHEX gene mutations in hypophosphatemic rickets and emphasize the significance of genetic diagnosis in suspected cases to ascertain the clinical diagnosis of XLH, enabling timely intervention. Further studies are warranted in order to perform more extensive mutation analyses in affected individuals in order to elaborate the key domain in PHEX and the identification of unequivocal FGF23 function in the pathogenesis of XLH, subsequently, exploring for more effective treatments, not only for XLH, but also for associated diseases sharing similar molecular mechanism.

Acknowledgments

This study was supported by grants from the National Natural Science Foundation of China (nos. 81370978 and 81170803 to Z.-L.Z., and no. 81200646 to J.-M.G.), the National Basic Research Program of China (no. 2014CB942903), the Shanghai Leading Talents Award (051) to Z.-L.Z., the Science and Technology Commission of Shanghai Municipality (no. 14JC140500) to Z.-L.Z., the Shanghai Municipal Commission of Health and Family Planning (no. 2014ZYJB0009), the Science and Technology Commission of Chongqing Municipality (no. CSTC2013jcyjC00009) to Z.-L.Z.

References

1 

Albright F, Butler A and Bloomberg E: Rickets resistant to vitamin D therapy. Am J Dis Child. 54:529–547. 1937.

2 

Beck-Nielsen SS, Brock-Jacobsen B, Gram J, Brixen K and Jensen TK: Incidence and prevalence of nutritional and hereditary rickets in southern Denmark. Eur J Endocrinol. 160:491–497. 2009. View Article : Google Scholar

3 

Carpenter TO: New perspectives on the biology and treatment of X-linked hypophosphatemic rickets. Pediatr Clin North Am. 44:443–466. 1997. View Article : Google Scholar : PubMed/NCBI

4 

Francis F, Hennig S, Korn B, Reinhardt R, De Jong P, Poustka A, Lehrach H, Rowe PSN, Goulding JN, Summerfield T, et al: The HYP Consortium: A gene (PEX) with homologies to endopeptidases is mutated in patients with X-linked hypophosphatemic rickets. Nat Genet. 11:130–136. 1995. View Article : Google Scholar

5 

White KE, Evans WE, O'Riordan JLH, Speer MC, Econs MJ, Lorenz-Depiereux B, Grabowski M, Meitinger T and Strom TM: ADHR Consortium: Autosomal dominant hypophosphataemic rickets is associated with mutations in FGF23. Nat Genet. 26:345–348. 2000. View Article : Google Scholar

6 

Feng JQ, Ward LM, Liu S, Lu Y, Xie Y, Yuan B, Yu X, Rauch F, Davis SI, Zhang S, et al: Loss of DMP1 causes rickets and osteomalacia and identifies a role for osteocytes in mineral metabolism. Nat Genet. 38:1310–1315. 2006. View Article : Google Scholar : PubMed/NCBI

7 

Li H, Xie H, Liu W, Hu R, Huang B, Tan YF, Xu K, Sheng ZF, Zhou HD, Wu XP and Luo XH: A novel microRNA targeting HDAC5 regulates osteoblast differentiation in mice and contributes to primary osteoporosis in humans. J Clin Invest. 119:3666–3677. 2009. View Article : Google Scholar : PubMed/NCBI

8 

Hu R, Liu W, Li H, Yang L, Chen C, Xia ZY, Guo LJ, Xie H, Zhou HD, Wu XP and Luo XH: A Runx2/miR-3960/miR-2861 regulatory feedback loop during mouse osteoblast differentiation. J Biol Chem. 286:12328–12339. 2011. View Article : Google Scholar : PubMed/NCBI

9 

Li CJ, Cheng P, Liang MK, Chen YS, Lu Q, Wang JY, Xia ZY, Zhou HD, Cao X, Xie H, et al: MicroRNA-188 regulates age-related switch between osteoblast and adipocyte differentiation. J Clin Invest. 125:1509–1522. 2015. View Article : Google Scholar : PubMed/NCBI

10 

Du L, Desbarats M, Viel J, Glorieux FH, Cawthorn C and Ecarot B: cDNA cloning of the murine Pex gene implicated in X-linked hypophosphatemia and evidence for expression in bone. Genomics. 36:22–28. 1996. View Article : Google Scholar : PubMed/NCBI

11 

Francis F, Strom TM, Hennig S, Böddrich A, Lorenz B, Brandau O, Mohnike KL, Cagnoli M, Steffens C, Klages S, et al: Genomic organization of the human PEX gene mutated in X-linked dominant hypophosphatemic rickets. Genome Res. 7:573–585. 1997.PubMed/NCBI

12 

Ruchon AF, Tenenhouse HS, Marcinkiewicz M, Siegfried G, Aubin JE, DesGroseillers L, Crine P and Boileau G: Developmental expression and tissue distribution of Phex protein: Effect of the Hyp mutation and relationship to bone markers. J Bone Miner Res. 15:1440–1450. 2000. View Article : Google Scholar : PubMed/NCBI

13 

Nesbitt T, Fujiwara I, Thomas R, Xiao ZS, Quarles LD and Drezner MK: Coordinated maturational regulation of PHEX and renal phosphate transport inhibitory activity: Evidence for the pathophysiological role of PHEX in X-linked hypophosphatemia. J Bone Miner Res. 14:2027–2035. 1999. View Article : Google Scholar

14 

Liu S, Zhou J, Tang W, Jiang X, Rowe DW and Quarles LD: Pathogenic role of Fgf23 in Hyp mice. Am J Physiol Endocrinol Metab. 291:E38–E49. 2006. View Article : Google Scholar : PubMed/NCBI

15 

Jap TS, Chiu CY, Niu DM and Levine MA: Three novel mutations in the PHEX gene in Chinese subjects with hypophosphatemic rickets extends genotypic variability. Calcif Tissue Int. 88:370–377. 2011. View Article : Google Scholar : PubMed/NCBI

16 

Xia W, Meng X, Jiang Y, Li M, Xing X, Pang L, Wang O, Pei Y, Yu LY, Sun Y, et al: Three novel mutations of the PHEX gene in three Chinese families with X-linked dominant hypophosphatemic rickets. Calcif Tissue Int. 81:415–420. 2007. View Article : Google Scholar : PubMed/NCBI

17 

Kang QL, Xu J, Zhang Z, He JW, Lu LS, Fu WZ and Zhang ZL: Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets. Biochem Biophys Res Commun. 423:793–798. 2012. View Article : Google Scholar : PubMed/NCBI

18 

Yue H, Yu JB, He JW, Zhang Z, Fu WZ, Zhang H, Wang C, Hu WW, Gu JM, Hu YQ, et al: Identification of two novel mutations in the PHEX gene in Chinese patients with hypophosphatemic rickets/osteomalacia. PLoS One. 9:e978302014. View Article : Google Scholar : PubMed/NCBI

19 

Liu S, Wei M, Xiao J, Wang CY and Qiu ZQ: Three PHEX gene mutations in Chinese subjects with hypophosphatemic rickets and literature review. Zhongguo Dang Dai Er Ke Za Zhi. 16:518–523. 2014.In Chinese. PubMed/NCBI

20 

Yang L, Yang J and Huang X: PHEX gene mutation in a Chinese family with six cases of X-linked hypophosphatemic rickets. J Pediatr Endocrinol Metab. 26:1179–1183. 2013. View Article : Google Scholar : PubMed/NCBI

21 

Yuan L, Wu S, Xu H, Xiao J, Yang Z, Xia H, Liu A, Hu P, Lu A, Chen Y, et al: Identification of a novel PHEX mutation in a Chinese family with X-linked hypophosphatemic rickets using exome sequencing. Biol Chem. 396:27–33. 2015. View Article : Google Scholar

22 

Adzhubei IA, Schmidt S, Peshkin L, Ramensky VE, Gerasimova A, Bork P, Kondrashov AS and Sunyaev SR: A method and server for predicting damaging missense mutations. Nat Methods. 7:248–249. 2010. View Article : Google Scholar : PubMed/NCBI

23 

Ng PC and Henikoff S: SIFT: Predicting amino acid changes that affect protein function. Nucleic Acids Res. 31:3812–3814. 2003. View Article : Google Scholar : PubMed/NCBI

24 

Smith ER, McMahon LP and Holt SG: Method-specific differences in plasma fibroblast growth factor 23 measurement using four commercial ELISAs. Clin Chem Lab Med. 51:1971–1981. 2013. View Article : Google Scholar : PubMed/NCBI

25 

Sabbagh Y, Boileau G, Campos M, Carmona AK and Tenenhouse HS: Structure and function of disease-causing missense mutations in the PHEX gene. J Clin Endocrinol Metab. 88:2213–2222. 2003. View Article : Google Scholar : PubMed/NCBI

26 

Beck-Nielsen SS, Brixen K, Gram J and Brusgaard K: Mutational analysis of PHEX, FGF23, DMP1, SLC34A3 and CLCN5 in patients with hypophosphatemic rickets. J Hum Genet. 57:453–458. 2012. View Article : Google Scholar : PubMed/NCBI

27 

Rowe PS, Oudet CL, Francis F, Sinding C, Pannetier S, Econs MJ, Strom TM, Meitinger T, Garabedian M, David A, et al: Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP). Hum Mol Genet. 6:539–549. 1997. View Article : Google Scholar : PubMed/NCBI

28 

Gaucher C, Walrant-Debray O, Nguyen TM, Esterle L, Garabédian M and Jehan F: PHEX analysis in 118 pedigrees reveals new genetic clues in hypophosphatemic rickets. Hum Genet. 125:401–411. 2009. View Article : Google Scholar : PubMed/NCBI

29 

Filisetti D, Ostermann G, von Bredow M, Strom T, Filler G, Ehrich J, Pannetier S, Garnier JM, Rowe P, Francis F, et al: Non-random distribution of mutations in the PHEX gene, and under-detected missense mutations at non-conserved residues. Eur J Hum Genet. 7:615–619. 1999. View Article : Google Scholar : PubMed/NCBI

30 

Qiu ZQ, Tenenhouse HS and Scriver CR: Parental origin of mutant allele does not explain absence of gene dose in X-linked Hyp mice. Genet Res. 62:39–43. 1993. View Article : Google Scholar : PubMed/NCBI

31 

Holm IA, Nelson AE, Robinson BG, Mason RS, Marsh DJ, Cowell CT and Carpenter TO: Mutational analysis and genotype-phenotype correlation of the PHEX gene in X-linked hypophosphatemic rickets. J Clin Endocrinol Metab. 86:3889–3899. 2001. View Article : Google Scholar : PubMed/NCBI

32 

Jonsson KB, Zahradnik R, Larsson T, White KE, Sugimoto T, Imanishi Y, Yamamoto T, Hampson G, Koshiyama H, Ljunggren O, et al: Fibroblast growth factor 23 in oncogenic osteomalacia and X-linked hypophosphatemia. N Engl J Med. 348:1656–1663. 2003. View Article : Google Scholar : PubMed/NCBI

33 

Weber TJ, Liu S, Indridason OS and Quarles LD: Serum FGF23 levels in normal and disordered phosphorus homeostasis. J Bone Miner Res. 18:1227–1234. 2003. View Article : Google Scholar : PubMed/NCBI

34 

Aono Y, Yamazaki Y, Yasutake J, Kawata T, Hasegawa H, Urakawa I, Fujita T, Wada M, Yamashita T, Fukumoto S and Shimada T: Therapeutic effects of anti-FGF23 antibodies in hypophosphatemic rickets/osteomalacia. J Bone Miner Res. 24:1879–1888. 2009. View Article : Google Scholar : PubMed/NCBI

35 

Sapir-Koren R and Livshits G: Bone mineralization is regulated by signaling cross talk between molecular factors of local and systemic origin: The role of fibroblast growth factor 23. Biofactors. 40:555–568. 2014. View Article : Google Scholar : PubMed/NCBI

36 

Sitara D, Kim S, Razzaque MS, Bergwitz C, Taguchi T, Schüler C, Erben RG and Lanske B: Genetic evidence of serum phosphate-independent functions of FGF-23 on bone. PLoS Genet. 4:e10001542008. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Li S, Gu J, Yu W, He J, Fu W and Zhang Z: Seven novel and six de novo PHEX gene mutations in patients with hypophosphatemic rickets. Int J Mol Med 38: 1703-1714, 2016.
APA
Li, S., Gu, J., Yu, W., He, J., Fu, W., & Zhang, Z. (2016). Seven novel and six de novo PHEX gene mutations in patients with hypophosphatemic rickets. International Journal of Molecular Medicine, 38, 1703-1714. https://doi.org/10.3892/ijmm.2016.2796
MLA
Li, S., Gu, J., Yu, W., He, J., Fu, W., Zhang, Z."Seven novel and six de novo PHEX gene mutations in patients with hypophosphatemic rickets". International Journal of Molecular Medicine 38.6 (2016): 1703-1714.
Chicago
Li, S., Gu, J., Yu, W., He, J., Fu, W., Zhang, Z."Seven novel and six de novo PHEX gene mutations in patients with hypophosphatemic rickets". International Journal of Molecular Medicine 38, no. 6 (2016): 1703-1714. https://doi.org/10.3892/ijmm.2016.2796
Copy and paste a formatted citation
x
Spandidos Publications style
Li S, Gu J, Yu W, He J, Fu W and Zhang Z: Seven novel and six de novo PHEX gene mutations in patients with hypophosphatemic rickets. Int J Mol Med 38: 1703-1714, 2016.
APA
Li, S., Gu, J., Yu, W., He, J., Fu, W., & Zhang, Z. (2016). Seven novel and six de novo PHEX gene mutations in patients with hypophosphatemic rickets. International Journal of Molecular Medicine, 38, 1703-1714. https://doi.org/10.3892/ijmm.2016.2796
MLA
Li, S., Gu, J., Yu, W., He, J., Fu, W., Zhang, Z."Seven novel and six de novo PHEX gene mutations in patients with hypophosphatemic rickets". International Journal of Molecular Medicine 38.6 (2016): 1703-1714.
Chicago
Li, S., Gu, J., Yu, W., He, J., Fu, W., Zhang, Z."Seven novel and six de novo PHEX gene mutations in patients with hypophosphatemic rickets". International Journal of Molecular Medicine 38, no. 6 (2016): 1703-1714. https://doi.org/10.3892/ijmm.2016.2796
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team