Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
April-2017 Volume 39 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2017 Volume 39 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Possible protective role of the ABCA4 gene c.1268A>G missense variant in Stargardt disease and syndromic retinitis pigmentosa in a Sicilian family: Preliminary data

  • Authors:
    • Rosalia D'Angelo
    • Luigi Donato
    • Isabella Venza
    • Concetta Scimone
    • Pasquale Aragona
    • Antonina Sidoti
  • View Affiliations / Copyright

    Affiliations: Department of Biomedical Sciences, Odontoiatric and Morphofunctional Images, University of Messina, I-98125 Messina, Italy, Department of Clinical and Experimental Medicine, University of Messina, I-98125 Messina, Italy
  • Pages: 1011-1020
    |
    Published online on: March 10, 2017
       https://doi.org/10.3892/ijmm.2017.2917
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

In the wide horizon of ophthalmologically rare diseases among retinitis pigmentosa forms, Stargardt disease has gradually assumed a significant role due to its heterogeneity. In the present study, we aimed to support one of two opposite hypotheses concerning the causative or protective role of heterozygous c.1268A>G missense variant of the ABCA4 gene in Stargardt disease and in syndromic retinitis pigmentosa. This study was based on a family consisting of three members: proband, age 54, with high myopia, myopic chorioretinitis and retinal dystrophy; wife, age 65, with mild symptoms; daughter, age 29, asymptomatic. After genetic counseling, ABCA4 and RP1 gene analysis was performed. The results highlighted an important genetic picture. The proband was found to carry two variant RP1 SNPs, rs2293869 (c.2953A>T) and rs61739567 (c.6098G>A), and, a wild-type condition for four RP1 polymorphisms, rs444772 (c.2623G>A) and three SNPs in the ‘hot-spot’ region, exon 4. The proband's wife, instead, showed an opposite condition compared to her husband: a homozygous mutated condition for the first four SNPs analyzed, while the last two were wild-type. Regarding the ABCA4 gene, the proband evidenced a wild-type condition. Furthermore, the wife showed a heterozygous condition of ABCA4 rs3112831 (c.1268A>G). As expected, the daughter presented heterozygosity for all variants of both genes. In conclusion, even though the c.1268A>G missense variant of the ABCA4 gene has often been reported as causative of disease, and in other cases protective of disease, in our family case, the variant appears to reduce or delay the risk of onset of Stargardt disease.

Introduction

In the wide horizon of ophthalmologically rare diseases among retinitis pigmentosa forms, Stargardt disease (OMIM #248200) has gradually assumed an important role due to its heterogeneity. Stargardt disease, known also as fundus flavimaculatus in the late onset form, or heredomacular degeneration, causes progressive bilateral decrease in vision between childhood and teenage years, reaching a plateau phase shortly after rapid reduction in visual acuity by the age of 50. Most patients show a decrease of up to 6/60 or worse, reaching a condition called 'legal blindness'. Stargardt patients develop irregularly shaped yellowish-white flecks or spots in the macula, causing decreased central vision. There is usually no problem regarding peripheral vision, and therefore they rarely have issues with bumping into objects when moving around (due to rod apoptosis). In late stages of the disease, the involvement of cones may also induce impairment of color vision. Other symptoms usually include wavy vision, blind spots, blurriness, and difficulty adapting to dim lighting (1). Gene therapy could be a future solution (2). Stargardt disease is an inherited condition mainly autosomal recessive, and the major causative gene involved is ABCA4 (3), also known as ABCR (4). It is located on the short arm of chromosome 1 (1p22), and encodes for a cytospecific member of the ATP-binding cassette (ABC) transporter superfamily, retina photoreceptor specific. The protein consists of two transmembrane domains (TMDs), also known as membrane-spanning domains (MSDs) or integral membrane (IM) domains. It consists of α-helices, embedded in the membrane bilayer, and is an allosteric protein. The sequence and architecture of TMDs are variable, reflecting the chemical diversity of substrates that can be translocated. The nucleotide binding domain (NBD), on the other hand, is located in the cytoplasm and has a highly conserved sequence, and is the site for ATP binding (4). The structural architecture of ABC transporters consists minimally of two TMDs and two NBDs (5).

The protein plays a fundamental role in the visual cycle. To be precise, it is an inward-directed retinoid flipase, which imports substrates from the lumen to the cytoplasmic side of retinal disc membranes. The substrates are all-trans-retinaldehyde (ATR) and N-retinyl-phosphatidyl-ethanolamine (NR-PE), an intermediate derived from the reaction of ATR with phosphatidyl-ethanolamine (PE) located in disc membranes. ATR, once transported to the cytoplasmic side, is reduced to vitamin A by trans-retinol dehydrogenase (tRDH). Then, transferred to the retinal pigment epithelium (RPE), it is converted to 11-cis-retinal. Abca4 protein is involved in photoresponse, removing ATR/NR-PE from the extracellular photoreceptor surfaces during bleach recovery. More than 700 mutations in the ABCA4 gene (OMIM #601691) have been found to cause Stargardt macular degeneration, most of which consist of single nucleotide variants (SNVs). An altered Abca4 protein cannot remove NR-PE from photoreceptor cells, thus it combines with other ATR molecules. This, in turn, leads to condensation, oxidation, hydrolysis and rearrangements. All of these reactions produce the bis-retinoid Di-retinoid-pyridinium-ethanolamine (A2E) (6), among which is lipofuscin, one of the constituents of fatty yellow pigments that builds up in retinal cells (7). This is toxic to the retina, leading to photoreceptor apoptosis and Stargardt macular degeneration progressive vision loss in patients. Different phenotypes are associated with variable residual functions of the protein, due to several variants of the ABCA4 gene. It is therefore fundamental to analyze the gene in the most complete way, in order to develop a correct differential diagnosis for each case of Stargardt disease. This is one of the most difficult challenges due to the very common overlapping symptoms of the pathology, and contrasting data. An example is provided by the variant of our case study, regarded as a non-pathogenic polymorphism (SNP), as a high-penetrance disease-causing variant, or even as a possible protecting factor. Similar to other pathologies, there is not just one gene implicated in etiopathogenesis, and ABCA4 could play a strong role in the development of retinitis pigmentosa.

In our hypothesis, the indirect effects of a mutated ABCA4 could influence the activity of RP1, one of the most frequent causative genes of syndromic or non-syndromic retinitis pigmentosa (8). Retinitis pigmentosa 1 (OMIM #180100), the most common form, shows high involvement of the RP1 gene, located on 8q12. It is an autosomal dominant form with relatively late onset of night blindness, usually by the third decade of life, with slow progression. Characteristic clinical findings include diffuse retinal pigmentation, progressive decrease in recordable ERGs, and concentric visual field loss. Funduscopic findings comprise retinal atrophy, bone-spicule-like pigment deposits, and vascular attenuation (9). Rp1 protein is located in the region of the axoneme of rod and cone photo-receptors. The photo-receptor axoneme begins at the basal body in the distal inner segment and passes through the connecting cilium. It is considered the primary pass for continuous polarized transport of proteins and membrane needed in outer segments to substitute older discs with new ones (10,11). The junction between the connecting cilium and the outer segment is also where disc morphogenesis occurs (12,13). It has been pointed out (14) that RP1 could play a role in controlling the orientation and organization of outer segment discs. It may function as a connection between newly formed discs and the axoneme, and this interaction helps discs form in the correct orientation and stack up into outer segments. Proteins present in the disc rims, such as Abca4, Rom1 and peripherin are potential candidates for such an interaction (14). In this study, we report the genetic condition of a family where each carry several variants on the ABCA4 gene and RP1.

Materials and methods

Clinical data

The target of our study is a Sicilian family with three members. The proband, 54-year-old father, showed a symptomatology common to syndromic retinitis pigmentosa and Stargardt disease: high myopia and myopic chorioretinitis, irregular astigmatism, incipient cataract and retinal dystrophy. All of these disorders have left the patient severely visually impaired, with a useful visual acuity of 1/20 in both eyes and short perceptions of light and colors since pediatric age. Fundus examination showed peripheral degeneration, an area of vitreous traction and macular thickness reduced in the right eye. The left eye showed degenerative myopia. Pattern evoked potential (PEP) and flash evoked potential (FEP) confirmed typical signs of retinitis pigmentosa, as shown in pattern electroretinogram (PERG) and flash electroretinogram (FERG) (Figs. 1Figure 2Figure 3–4). The proband's wife, 65 years of age, showed only a slight reduction in sensitivity on left eye peripheral areas. Their 29-year-old daughter, instead, has revealed no ophthalmologic symptoms (Fig. 5).

Figure 1

Pattern evoked potential (PEP) for right (A) and left (B) eyes of the proband father. Evoked visual potential morphology was markedly impaired. Component P00 was scarcely detectable. Severe decrease in amplitudes (N75-P100) below normal limits and marked increase in peak times for the P100 component beyond normal limits were noted.

Figure 2

Flash evoked potential (FEP) for right (A) and left (B) eyes of the proband father. Evoked visual potentials of normal morphology, amplitudes (N2-P2) and peak time for the component P2 within the standard limits were noted.

Figure 3

Pattern electroretinogram (PERG) for right (A) and left (B) eyes of the proband father. The first shows severe decrease in amplitude, N35-P50 and P50-N95, lower than normal limits, with an increase in the peak time for the P50 component within normal limits; the second, instead, shows an extinct ERG.

Figure 4

Flash electroretinogram (FERG) for right (A) and left (B) eyes of the proband father. The 30 Hz Flicker response shows a decrease in amplitudes for photopic b-wave below normal limits, while implicit times are standard.

Figure 5

Clinical examination of the proband's daughter: visual field (A), fundus (B) and OCT (C). All of these results highlight a healthy condition.

Following detailed genetic counseling, ABCA4 and RP1 gene analysis was requested. The research followed the tenets of the Declaration of Helsinki and informed consent was obtained from the subjects after explanation of the nature and possible consequences of the study.

ABCA4 and RP1 genotyping

Genomic DNA was extracted from heparinized peripheral blood using the salting out method and then stored in TE buffer (l0 mM Tris-HCI, l mM EDTA, pH 8.0) until analysis. Coding exons (50 for ABCA4 and 4 for RP1, respectively), intron-exon boundaries and promoter regions of the 2 genes were screened using primers designed according to the ABCA4 and RP1 published nucleotide sequence of GenBank (accession no. NG_009073.1 and NG_009840.1, respectively).

Polymerase chain reaction (PCR)

PCR amplifications were carried out in a 50 μl solution containing MgCl2 (2.5 mM), dNTPs (0.2 mM), 0.2 μl of each primer (10 μM), 0.8 μg of genomic DNA and 1 unit of Euro Taq polymerase (EuroClone Spa Life Sciences Division, Milan, Italy). DNA amplification was performed on a thermal cycler Gene Amp PCR System 2700 (PE Applied Biosystems, Foster City, CA, USA) as follows. After an initial denaturation step at 94°C for 5 min, the samples were subjected to 35 cycles of amplification consisting of 40 sec of denaturation at 95°C, 35 sec of annealing and 45 sec of extension at 72°C. The annealing temperature was optimized for each primer set. A final extension at 72°C was carried out for l0 min. Following PCR, 5 μl of amplified product was examined by electrophoresis on a 2% agarose gel. PCR of RP1 (4 exons) and ABCA4 (50 exons) required 12 and 43 primer pairs. See Tables I and II for the sequences of primers.

Table I

RP1 primer sequences.

Table I

RP1 primer sequences.

ExonForward primerReverse primer
1 TGCAGAGCATGCTAGGAACT TATCAGCATATTGTGAAGGTTG
2 TCTGGATGTCTGCAGCTATAT AGATGAGATTCCAGTCAGATTCT
3 TGCTCAGTGATGATGTCTTTC TTTCTGTGGTGGAAGAAACTG
4a GCTGCCTCTTCCTTTGGATAT GGCAAACCATTATTATGTGACAT
4b ATCAAATGGAGGAGTCATCATTA TCTCAAATACCCAGATGCCACT
4c CATCCTTGAGCAAAAACCCAA AGCATCAACTTGACAGAAGCTA
4d CAAATGCCAGGTTCACTTGCA TGACATTTTGATGTGACACCAAT
4e CTTGGATTCAACTGAAGAGTT AGCCTCTTACTGATTATTTCAT
4f TTAATACAGTGGTAAATGGA TGAAATTCCACAGAATTATAA
4g CATAGGATTTGTTAAAAGGGC AATAACAGTTAGTATTGGGCAAT
4h TGTCTCTGATGATGCTATTAAA TACTGCTTTCAAGATCAGTTAAA
4i ATCTCAACCAAGTAGTAAGAG TATATCATCATATAGTCATGCAG

Table II

ABCA4 primer sequences.

Table II

ABCA4 primer sequences.

ExonForward primerReverse primer
1 AACTAAGGGCTTATGTGTAAT CACTGCTTCAGTGCTAATC
2 TCCTACTGCACACATGGGATC TTACATGCATCATAGACATGA
3 ACACATGAGATGCTCCTGCT TCTGCTCCTAAGAGGTTAG
4 TGTAAGGATACTCAATGTAGT TTCACCAAGGTGATGTTCAA
5 AGTTGAGTTACAAGTGTTTCC TGAATGTGAACACAAGGAAG
6 GATCTTAATTCCTGTCGCCA AAGGATTGTCCAGAACACCA
7 AACATATAGGAGATCAGACTG TTGGGATGTGAACAGGTGCT
8 TAAGGCTCATCCTAGTATTCT GTTCATGTCCAGAATTGCT
9 TGCTACTAATGATGAGCTTGT CAGTGATGACTGTGGATGG
10 CCATCCACAGTCATCACTG TGATCTAACTCCAATAGCG
11 CGCTATTGGAGTTAGATCA AGACCACTTGACTTGCTAA
12–13 ACCAGACTCTGGAGTTAAGC CATTAGCGTGTCATGGAGG
14 AGAGTCCTCTGGTGGCTAG CTGCAGACTTGATGATGTG
15 CACATCATCAAGTCTGCAG AAGCTAGATGTCACGCTCT
16 ACTTGCAACTCCTCTGAGAG GCTGTTGCTAGTCAGATGT
17 AGGAACTCAGCACATGGAGT TGAGGAGTCACTGTTGCAT
18 GCTGACCTTACACTGAGAGA TCAAGTAGAGCCAGTAGGAT
19 CAAGATTATTGGTCTTGCTGT ATCAGCCATTCATGATCACA
20 AGATTGTGTGATCAGGCTTG TTCCACACACATGCAGATG
21 AAGCAGTGCCTGGCATATAG CTCTCTGAATGAATGTCCAC
22 TGGATGTATACACTGGTGCT TCTGAGCAGCAGAGGCAGA
23–24 ACAGTGAGCATCTTGATTGC GTGGTTCCTGTACTCAGCT
25 TACAGTATGTAGGAAGCTATG CTTCAGAATGTGTTCATCGA
26 CACATAATTGATGACAAGCCA AGGAATGATGGCTTACTAAG
27–28 GCAGACTTGATGGAGCATCA CTGGTCTCGAACTCAGGTG
29 GATGATTAAGCTACCAGCCT ACAGAATGTTCTGGTGGCC
30–31 GGCCACCAGAACATTCTGT CAACGCCTGCCATCTTGAA
32 CAAGCTAGAGATGGTTATTC CTACTAGATCAAATAGGAAG
33 TCAACTGTGTCATCTGTATG GCAGCCAGCTTGAACTATA
34 ATCATTGAAGTGAGAACTAG CTTCTATGGTCTTCTGATAT
35 CATATGACCTGACAACAGGA ACTTATGTCCTCCAAGAAGA
36–37–38 AGAGAGCTACTAGTAGGCGT GAATCCTCTCAGGATGTTCA
39 TAGTGGAGTGACAGCTTCAA CCTGCGGTGCAGTGATTAT
40 GACTAGTGACAGCTTAACATA CTGGTTATCAGCTTCAGACC
41 ACAGAGTATATACACAGCTAG ACAGCTGCTACATGTACGAT
42–43 TACTTCATGACCTCCATTGC AGTGGATGCTCTTCACATAT
44–45 CAGAAGGAAGCAGAAGCAAG TCTCATGTGGCTAGTGGAAG
46 CAAGTGCTTAGTAGCCACAT CAACAGAGGAATCTCTTAAC
47 CATGGAAGAATCTGACAGGA GAGATGCATCTTCAGGATAA
48 TCATTCTGGAGGCGTGAGAT GTGGATTAAGGCAATGACAG
49–50 CTGTCATTGCCTTAATCCAC TCTTATCAGCATGATGGCCT
51 ATTCCTGAGCTCAAGTGATC AACACACCATAGCATCACAG
52 GTAGGACACAAGCCATACCA GATGTGATGAGGATGTGGTG
53 ACACATCTCGTATGTGTGTC AAGACTAGTCCATTCACTTC
Sequencing

All PCR products were analyzed also by direct nucleotide sequence analysis by the dideoxynucleotide method with the BigDye Terminator 3.1 Cycle Sequencing kit on the 3500 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA).

Bioinformatic analysis

To clarify the hypothetical effects of the examined variants, a deep bioinformatic analysis with CLC Genomics workbench 8.0.1 (www.clcbio.com) for primary structure details, followed by PSIPRED secondary structure prediction (http://bioinf.cs.ucl.ac.uk/psipred/) was performed. Finally, RaptorX (http://raptorx.uchicago.edu) and Chimera software (http://www.cgl.ucsf.edu/chimera/) were used to highlight third structure aspects of ABCA4-mutated and wild-type predicted proteins.

Results

The entire genotype tree of the family is documented in Fig. 6. Regarding the proband, we report a wild-type condition for rs444772 (c.2623G>A) and for three SNPs of RP1 'hot-spot' region in exon 4 (15): rs446227 (c.5008G>A), rs414352 (c.5071T>C) and rs441800 (c.5175A>G). In contrast, we found a homozygous mutated condition regarding the other two RP1 SNPs, rs2293869 (c.2953A>T) and rs61739567 (c.6098G>A). The proband's wife, instead, showed an opposite situation, a homozygous mutated condition for the first four SNPs analyzed in her husband, while the last two were wild-type. Their daughter, as expected from the parents' genotypes, showed a heterozygous condition for all examined SNPs. Regarding the ABCA4 gene, the proband showed a wild-type condition for rs3112831 (c.1268A>G), while his wife and daughter were both heterozygous.

Figure 6

Family tree genotypes for RP1 and ABCA4. Mutated condition, due to present polymorphisms, is underlined. Black arrow indicates the proband.

We performed a search for Pfam domains on an Abca4-mutated protein sequence, against a wild-type sequence using CLC Genomics Workbench. The Pfam database, a large collection of protein families, each represented by multiple sequence alignments and hidden Markov models (HMMs), delivered the results shown in Table III. The rs3112831 implies that one of two TMD domains starts from aa 515 instead of 513 of the wild-type, altering the recognition site of the protein substrate (ATR or NR-PE).

Table III

Pfam protein domain prediction for wild-type and mutated Abca4.

Table III

Pfam protein domain prediction for wild-type and mutated Abca4.

SequenceDomainStartEndAccessionScoreE-valueDescriptionPredicted by
ABCA4
wild-type
ABC2_membrane_315971895PF12698.2136.41.1E-39ABC-2 family transporter proteinHMMER 3.1b1
(May 2013)
ABC_tran9461090PF00005.22105.32.9E-30ABC transporterHMMER 3.1b1
(May 2013)
ABC_tran19552099PF00005.2274.59.1E-21ABC transporterHMMER 3.1b1
(May 2013)
ABC2_membrane_3513856PF12698.261.18.6E-17ABC-2 family transporter proteinHMMER 3.1b1
(May 2013)
ABCA4
rs3112831
(c.1268A>G)
ABC2_membrane_315971895PF12698.2136.41.1E-39ABC-2 family transporter proteinHMMER 3.1b1
(May 2013)
ABC_tran9461090PF00005.22105.32.9E-30ABC transporterHMMER 3.1b1
(May 2013)
ABC_tran19552099PF00005.2274.59.1E-21ABC transporterHMMER 3.1b1
(May 2013)
ABC2_membrane_3515856PF12698.261.28.3E-17ABC-2 family transporter proteinHMMER 3.1b1
(May 2013)

[i] Main differences between the wild-type and mutated Abca4 domain are shown. Bold font indicates that the ABC2_membrane_3 domain in the mutated protein starts from aa 515 instead of aa 513 in the wild-type protein, due to the rs3112831 polymorphism.

Examining the micromolecular meanings of these alterations further, a deeper study with many bioinformatic analyses and predictions of primary, secondary and tertiary structures helped us visualize the potentially altered functions of Abca4. Starting from a complete protein report from CLC Genomics Workbench 8.0.1, we noted several important statistical differences which reflect the amino acid change (Table IV).

Table IV

CLC Genomics Workbench Abca4 wild-type and mutated Protein Statistic Report.

Table IV

CLC Genomics Workbench Abca4 wild-type and mutated Protein Statistic Report.

Wild-typers3112831
(c.1268A>G)
Sequence informations
 Weight (kDa)255,941255,901
 Isoelectric point6.126.1
Atomic composition
 Carbon (C)11.58811.587
 Nitrogen (N)3.0393.037
Count of hydrophobic and hydrophilic residues
 Hydrophobic (A, F, G, I,1.1831.184
 L, M, P, V, W)
 Other503502
Amino acid distribution table
 Histidine (H)52 (0.023)51 (0.022)
 Proline (P)129 (0.056)130 (0.057)
Counts of di-peptides
 Glu-His6 (0.03)5 (0.02)
 Glu-Pro8 (0.02)9 (0.03)

Furthermore, the substitution of the 423 histidine with a proline brings about important changes in electrical properties and solubility: the conjugate acid (protonated form) of the imidazole side chain in histidine has a pKa of ~6.0; when protonated, the imidazole ring bears two NH bonds and has a positive charge, equally distributed between both nitrogens. The distinctive cyclic structure of the proline side chain, instead, gives proline exceptional conformational rigidity, which affects the rate of peptide bond formation between proline and other amino acids. When proline is bound as an amide in a peptide bond, its nitrogen is not bound to any hydrogen, meaning it cannot act as a hydrogen bond donor, but can be a hydrogen bond acceptor. Figs. 7 and 8 show these differences.

Figure 7

Plot of electrical charge as a function of pH of wild-type (A) and mutated (B) Abca4. Arrows mark the increase in charge at the lowest pH in position 423 for mutated Abca4.

Figure 8

Hydrophobicity plot of wild-type (A) and mutated (B) Abca4. Arrows mark a lower hydrophobicity in position 423 for mutated Abca4.

In order to highlight changes in the secondary structure of Abca4, we chose PSIPRED (16), a popular structure prediction method that incorporates two feed-forward neural networks to perform an analysis of results obtained by the PSI-Blast homology search algorithm (17). The resulting scheme (Fig. 9) underlines how the 423H>P causes the substitution of a coil segment between position 504–505 with a helix, probably determining a spatial misfolding which affects the protein function.

Figure 9

PSIPRED secondary structure of wild-type (A) and mutated (B) Abca4. The 423 H>P substitution induces the insertion of a helix tract for a coiled tract in position 504–505 (evidenced in the circle).

Since ATP binding triggers NBD dimerization, the formation of the dimer may represent the 'power stroke'. Rotation and tilting of transmembrane α-helices may both contribute to these conformational changes, so it becomes a crucial forecast whether the examining variant can modify the tertiary structure. RaptorX (18–20) is a protein structure prediction server excelling at predicting 3D structures for protein sequences without close homologs in the Protein Data Bank (PDB). Given an input sequence, RaptorX predicts its secondary and tertiary structures as well as solvent accessibility and disordered regions. We used this web-based application to carry out our aim, and Chimera software (21) to get a detailed 3D picture of the predicted mutated Abca4 from RaptorX pdb exported files (Fig. 10). We hypothesize that the basic N of imidazole side chain acts as a nucleophile towards ATR or NR-PE atoms, constituting a crucial component of the recognition site of Abca4. The substitution of histidine with proline, due to atomic features of the latter, does not permit a correct interaction with ligands: when proline is bound as an amide in a peptide bond, its nitrogen is not bound to any hydrogen, meaning it cannot act as a hydrogen bond donor. In Fig. 11, we can see the entire predicted 3D structure of Abca4 before dimerization and all domains, emphasizing the 'transport channel' which involves the 423H>P substitution.

Figure 10

Details of 3D predicted structure of Abca4, using RaptorX web-based application and Chimera software. (A) Arrow indicates the region where 423 amino acid is located; red helix represents wild-type condition, while blue arrow the mutated condition; intramolecular bonds are depicted as colored lines. (B) Ball-and-stick model applied to analyzed the region of Abca4 wild-type predicted structure, with wired version of the surrounding portion represented. (C) Detail of (B), with the addition of the mutated portion of the examined protein region; the arrow focuses attention on proline side chain, as opposed to imidazole side chain of wild-type histidine.

Figure 11

3D predicted structure of mutated Abca4, using RaptorX web-based application and Chimera software. (A) Predicted structure of the whole Abca4 transporter, before dimerization. Green portions evidence the variant area of each subunit in two transmembrane domains (TMDs). (B) Detail of 'interaction site' which involves the examined mutated region of each subunit and ligands (not shown).

Discussion

We believe that RP1 homozygous variants found in the proband could be responsible for his phenotype. His wife, instead, although carrying a triple homozygous in the 'hot-spot' region of RP1, normally associated with retinitis pigmentosa pathology (15), was found to be only mildly affected. Regarding the ABCA4 gene, she was found to carry the c.1268A>G in heterozygosity. The non-affected daughter inherited a condition of heterozygosity for all analyzed variants of both genes, manifesting no typical symptoms of retinal pathologies upon examination.

Online genetic database (EMBASE, ENSEMBL and PUBMED) reports found variants as polymorphisms. The Human Gene Mutation Database (HGMD) classified two of these (c.5008G>A for RP1 and c.1268A>G for ABCA4) as disease-causing mutations with a question mark (DM?), denoting a probable/possible pathological mutation, reported to be pathogenic in the corresponding report, but where the author has indicated that there may be some degree of uncertainty.

The c.5008G>A, present in the wild-type condition in the proband, implies the change of an alanine in position 1670 with a threonine implemented by this variation and represents a regulatory region modification, due to its location in a promoter flanking region. As with other RP1 analyzed SNPs, it would appear to be implicated in retinitis pigmentosa phenotype of Chinese (22–25) and Indian (26) populations, as well as indicated as a member of the 'hot-spot' high causative region of RP1 (27).

The c.1268A>G, also found in the wild-type condition in the proband, represents a missense variation, which changes the histidine in position 423 with a proline, and is located within a regulatory region, showing enhancer features, involving one of TMD. It was regarded as a polymorphism found in hetero-zygosity in 101/440 controls in a comprehensive survey of sequence variation in the ABCA4 of a German population (28). The same variant presented as a high-penetrance disease-causing variant in a cohort of patients with Stargardt disease in a study in 2004 (29), and as a reducing risk factor more recently, also in a heterozygous model (30–32). Bioinformatic software predictions (Sift, PolyPhen 2, PROVEAN), analyzing non-synonymous coding SNP effects on protein function, give this variant the status of tolerated or neutral. Furthermore, studies suggest c.1268A>G as associated with late-onset Stargardt disease (33), with macular degeneration (34) and with retinitis pigmentosa (35), depending on the severity of the symptoms manifested. Despite all these studies, the phenotype associated with this ABCA variant is not clear.

According to our hypotheses, the c.1268A>G missense variant may play a protective role against the damaging RP1 'hot-spot' region variants in syndromic retinitis pigmentosa. These findings suggest that, in our family case, the variant examined led to an asymptomatic visual phenotype, without any typical features of Stargardt disease or syndromic retinitis pigmentosa. Our data are corroborated by the genetic (Fig. 6) and phenotypic (only a slight reduction in sensitivity on peripheral areas) condition of the proband's wife and daughter (the latter without any typical or atypical symptomatology), suggesting the likely delaying effect of the analyzed polymorphisms regarding pathology onset. We believe that Rp1 and Abca4 could interact, directly or indirectly, in order to extend the half-life of photoreceptors. In particular, we speculate that the missense variant 1268A>G of ABCA4 induces a misfolding into an encoded protein, which decreases the transport of ATR/NR-PE and, consequently, a lower quantity of PE from disc membranes is consumed in spontaneous adduct formation with ATR. This renewed stability of disc membrane lipids could compensate for the lack due to RP1 homozygous variation in the 'hot-spot' region, which results in a misfolded protein unable to guarantee the correct stacking of discs and, above all, proper lipid transport from the inner to the outer segment, in order to build new functional discs.

In conclusion, we analyzed the effects of ABCA4 rs3112831 in a family with members showing a retinal pathological genotypic condition for ABCA4 and RP1, but without any evidence of phenotypic manifestations. Even thought the c.1268A>G missense variant of the ABCA4 gene has often been reported as causative of disease, and in other cases protective of disease, in our family case, the variant appears to reduce or delay the risk of onset of Stargardt disease.

References

1 

Duno M, Schwartz M, Larsen PL and Rosenberg T: Phenotypic and genetic spectrum of Danish patients with ABCA4-related retinopathy. Ophthalmic Genet. 33:225–231. 2012. View Article : Google Scholar : PubMed/NCBI

2 

Maugeri A, Klevering BJ, Rohrschneider K, Blankenagel A, Brunner HG, Deutman AF, Hoyng CB and Cremers FP: Mutations in the ABCA4 (ABCR) gene are the major cause of autosomal recessive cone-rod dystrophy. Am J Hum Genet. 67:960–966. 2000. View Article : Google Scholar : PubMed/NCBI

3 

Sun H and Nathans J: ABCR: Rod photoreceptor-specific ABC transporter responsible for Stargardt disease. Methods Enzymol. 315:879–897. 2000. View Article : Google Scholar : PubMed/NCBI

4 

Rees DC, Johnson E and Lewinson O: ABC transporters: The power to change. Nat Rev Mol Cell Biol. 10:218–227. 2009. View Article : Google Scholar : PubMed/NCBI

5 

Ambudkar SV, Dey S, Hrycyna CA, Ramachandra M, Pastan I and Gottesman MM: Biochemical, cellular, and pharmacological aspects of the multidrug transporter. Annu Rev Pharmacol Toxicol. 39:361–398. 1999. View Article : Google Scholar : PubMed/NCBI

6 

Jang YP, Matsuda H, Itagaki Y, Nakanishi K and Sparrow JR: Characterization of peroxy-A2E and furan-A2E photooxidation products and detection in human and mouse retinal pigment epithelial cell lipofuscin. J Biol Chem. 280:39732–39739. 2005. View Article : Google Scholar : PubMed/NCBI

7 

Cideciyan AV, Aleman TS, Swider M, Schwartz SB, Steinberg JD, Brucker AJ, Maguire AM, Bennett J, Stone EM and Jacobson SG: Mutations in ABCA4 result in accumulation of lipofuscin before slowing of the retinoid cycle: A reappraisal of the human disease sequence. Hum Mol Genet. 13:525–534. 2004. View Article : Google Scholar : PubMed/NCBI

8 

Pierrottet CO, Zuntini M, Digiuni M, Bazzanella I, Ferri P, Paderni R, Rossetti LM, Cecchin S, Orzalesi N and Bertelli M: Syndromic and non-syndromic forms of retinitis pigmentosa: A comprehensive Italian clinical and molecular study reveals new mutations. Genet Mol Res. 13:8815–8833. 2014. View Article : Google Scholar : PubMed/NCBI

9 

Chang S, Vaccarella L, Olatunji S, Cebulla C and Christoforidis J: Diagnostic challenges in retinitis pigmentosa: Genotypic multiplicity and phenotypic variability. Curr Genomics. 12:267–275. 2011. View Article : Google Scholar : PubMed/NCBI

10 

Young RW: The renewal of photoreceptor cell outer segments. J Cell Biol. 33:61–72. 1967. View Article : Google Scholar : PubMed/NCBI

11 

Anderson DH, Fisher SK and Steinberg RH: Mammalian cones: Disc shedding, phagocytosis, and renewal. Invest Ophthalmol Vis Sci. 17:117–133. 1978.PubMed/NCBI

12 

Kinney MS and Fisher SK: The photoreceptors and pigment epithelim of the adult Xenopus retina: Morphology and outer segment renewal. Proc R Soc Lond B Biol Sci. 201:131–147. 1978. View Article : Google Scholar : PubMed/NCBI

13 

Steinberg RH, Fisher SK and Anderson DH: Disc morphogenesis in vertebrate photoreceptors. J Comp Neurol. 190:501–508. 1980. View Article : Google Scholar : PubMed/NCBI

14 

Liu Q, Lyubarsky A, Skalet JH, Pugh EN Jr and Pierce EA: RP1 is required for the correct stacking of outer segment discs. Invest Ophthalmol Vis Sci. 44:4171–4183. 2003. View Article : Google Scholar : PubMed/NCBI

15 

El Shamieh S, Boulanger-Scemama E, Lancelot ME, Antonio A, Démontant V, Condroyer C, Letexier M, Saraiva JP, Mohand-Saïd S, Sahel JA, et al: Targeted next generation sequencing identifies novel mutations in RP1 as a relatively common cause of autosomal recessive rod-cone dystrophy. Biomed Res Int. 2015:4856242015. View Article : Google Scholar : PubMed/NCBI

16 

Buchan DW, Minneci F, Nugent TC, Bryson K and Jones DT: Scalable web services for the PSIPRED Protein Analysis Workbench. Nucleic Acids Res. 41:W349–W357. 2013. View Article : Google Scholar : PubMed/NCBI

17 

Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W and Lipman DJ: Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 25:3389–3402. 1997. View Article : Google Scholar : PubMed/NCBI

18 

Källberg M, Wang H, Wang S, Peng J, Wang Z, Lu H and Xu J: Template-based protein structure modeling using the RaptorX web server. Nat Protoc. 7:1511–1522. 2012. View Article : Google Scholar : PubMed/NCBI

19 

Ma J, Wang S, Zhao F and Xu J: Protein threading using context-specific alignment potential. Bioinformatics. 29:i257–i265. 2013. View Article : Google Scholar : PubMed/NCBI

20 

Peng J, Xu J and Raptor X: RaptorX: Exploiting structure information for protein alignment by statistical inference. Proteins. 79(Suppl 10): 161–171. 2011. View Article : Google Scholar : PubMed/NCBI

21 

Pettersen EF, Goddard TD, Huang CC, Couch GS, Greenblatt DM, Meng EC and Ferrin TE: UCSF Chimera - a visualization system for exploratory research and analysis. J Comput Chem. 25:1605–1612. 2004. View Article : Google Scholar : PubMed/NCBI

22 

Wang DY, Fan BJ, Chan WM, Tam OS, Chiang WY, Lam SC and Pang CP: Digenic association of RHO and RP1 genes with retinitis pigmentosa among Chinese population in Hong Kong. Zhonghua Yi Xue Za Zhi. 85:1613–1617. 2005.In Chinese. PubMed/NCBI

23 

Zhang X, Yeung KY, Pang CP and Fu W: Mutation analysis of retinitis pigmentosa 1 gene in Chinese with retinitis pigmentosa. Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 19:194–197. 2002.In Chinese. PubMed/NCBI

24 

Sheng X, Zhang X, Wu W, Zhuang W, Meng R and Rong W: Variants of RP1 gene in Chinese patients with autosomal dominant retinitis pigmentosa. Can J Ophthalmol. 43:208–212. 2008. View Article : Google Scholar : PubMed/NCBI

25 

Zhang X, Chen LJ, Law JP, Lai TY, Chiang SW, Tam PO, Chu KY, Wang N, Zhang M and Pang CP: Differential pattern of RP1 mutations in retinitis pigmentosa. Mol Vis. 16:1353–1360. 2010.PubMed/NCBI

26 

Gandra M, Anandula V, Authiappan V, Sundaramurthy S, Raman R, Bhattacharya S and Govindasamy K: Retinitis pigmentosa: Mutation analysis of RHO, PRPF31, RP1, and IMPDH1 genes in patients from India. Mol Vis. 14:1105–1113. 2008.PubMed/NCBI

27 

Schwartz SB, Aleman TS, Cideciyan AV, Swaroop A, Jacobson SG and Stone EM: De novo mutation in the RP1 gene (Arg677ter) associated with retinitis pigmentosa. Invest Ophthalmol Vis Sci. 44:3593–3597. 2003. View Article : Google Scholar : PubMed/NCBI

28 

Rivera A, White K, Stöhr H, Steiner K, Hemmrich N, Grimm T, Jurklies B, Lorenz B, Scholl HP, Apfelstedt-Sylla E, et al: A comprehensive survey of sequence variation in the ABCA4 (ABCR) gene in Stargardt disease and age-related macular degeneration. Am J Hum Genet. 67:800–813. 2000. View Article : Google Scholar : PubMed/NCBI

29 

Oh KT, Weleber RG, Stone EM, Oh DM, Rosenow J and Billingslea AM: Electroretinographic findings in patients with Stargardt disease and fundus flavimaculatus. Retina. 24:920–928. 2004. View Article : Google Scholar : PubMed/NCBI

30 

Aguirre-Lamban J, González-Aguilera JJ, Riveiro-Alvarez R, Cantalapiedra D, Avila-Fernandez A, Villaverde-Montero C, Corton M, Blanco-Kelly F, Garcia-Sandoval B and Ayuso C: Further associations between mutations and polymorphisms in the ABCA4 gene: Clinical implication of allelic variants and their role as protector/risk factors. Invest Ophthalmol Vis Sci. 52:6206–6212. 2011. View Article : Google Scholar : PubMed/NCBI

31 

Brión M, Sanchez-Salorio M, Cortón M, de la Fuente M, Pazos B, Othman M, Swaroop A, Abecasis G, Sobrino B and Carracedo A; Spanish multi-centre group of AMD: Genetic association study of age-related macular degeneration in the Spanish population. Acta Ophthalmol. 89:e12–e22. 2011. View Article : Google Scholar

32 

Webster AR, Héon E, Lotery AJ, Vandenburgh K, Casavant TL, Oh KT, Beck G, Fishman GA, Lam BL, Levin A, et al: An analysis of allelic variation in the ABCA4 gene. Invest Ophthalmol Vis Sci. 42:1179–1189. 2001.PubMed/NCBI

33 

Yatsenko AN, Shroyer NF, Lewis RA and Lupski JR: Late-onset Stargardt disease is associated with missense mutations that map outside known functional regions of ABCR (ABCA4). Hum Genet. 108:346–355. 2001. View Article : Google Scholar : PubMed/NCBI

34 

Baum L, Chan WM, Li WY, Lam DS, Wang PB and Pang CP: ABCA4 sequence variants in Chinese patients with age-related macular degeneration or Stargardt's disease. Ophthalmologica. 217:111–114. 2003. View Article : Google Scholar : PubMed/NCBI

35 

Valverde D, Riveiro-Alvarez R, Aguirre-Lamban J, Baiget M, Carballo M, Antiñolo G, Millán JM, Garcia Sandoval B and Ayuso C: Spectrum of the ABCA4 gene mutations implicated in severe retinopathies in Spanish patients. Invest Ophthalmol Vis Sci. 48:985–990. 2007. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
D'Angelo R, Donato L, Venza I, Scimone C, Aragona P and Sidoti A: Possible protective role of the ABCA4 gene c.1268A>G missense variant in Stargardt disease and syndromic retinitis pigmentosa in a Sicilian family: Preliminary data. Int J Mol Med 39: 1011-1020, 2017.
APA
D'Angelo, R., Donato, L., Venza, I., Scimone, C., Aragona, P., & Sidoti, A. (2017). Possible protective role of the ABCA4 gene c.1268A>G missense variant in Stargardt disease and syndromic retinitis pigmentosa in a Sicilian family: Preliminary data. International Journal of Molecular Medicine, 39, 1011-1020. https://doi.org/10.3892/ijmm.2017.2917
MLA
D'Angelo, R., Donato, L., Venza, I., Scimone, C., Aragona, P., Sidoti, A."Possible protective role of the ABCA4 gene c.1268A>G missense variant in Stargardt disease and syndromic retinitis pigmentosa in a Sicilian family: Preliminary data". International Journal of Molecular Medicine 39.4 (2017): 1011-1020.
Chicago
D'Angelo, R., Donato, L., Venza, I., Scimone, C., Aragona, P., Sidoti, A."Possible protective role of the ABCA4 gene c.1268A>G missense variant in Stargardt disease and syndromic retinitis pigmentosa in a Sicilian family: Preliminary data". International Journal of Molecular Medicine 39, no. 4 (2017): 1011-1020. https://doi.org/10.3892/ijmm.2017.2917
Copy and paste a formatted citation
x
Spandidos Publications style
D'Angelo R, Donato L, Venza I, Scimone C, Aragona P and Sidoti A: Possible protective role of the ABCA4 gene c.1268A>G missense variant in Stargardt disease and syndromic retinitis pigmentosa in a Sicilian family: Preliminary data. Int J Mol Med 39: 1011-1020, 2017.
APA
D'Angelo, R., Donato, L., Venza, I., Scimone, C., Aragona, P., & Sidoti, A. (2017). Possible protective role of the ABCA4 gene c.1268A>G missense variant in Stargardt disease and syndromic retinitis pigmentosa in a Sicilian family: Preliminary data. International Journal of Molecular Medicine, 39, 1011-1020. https://doi.org/10.3892/ijmm.2017.2917
MLA
D'Angelo, R., Donato, L., Venza, I., Scimone, C., Aragona, P., Sidoti, A."Possible protective role of the ABCA4 gene c.1268A>G missense variant in Stargardt disease and syndromic retinitis pigmentosa in a Sicilian family: Preliminary data". International Journal of Molecular Medicine 39.4 (2017): 1011-1020.
Chicago
D'Angelo, R., Donato, L., Venza, I., Scimone, C., Aragona, P., Sidoti, A."Possible protective role of the ABCA4 gene c.1268A>G missense variant in Stargardt disease and syndromic retinitis pigmentosa in a Sicilian family: Preliminary data". International Journal of Molecular Medicine 39, no. 4 (2017): 1011-1020. https://doi.org/10.3892/ijmm.2017.2917
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team