Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
June-2017 Volume 39 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
June-2017 Volume 39 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Variable TERRA abundance and stability in cervical cancer cells

  • Authors:
    • Bong-Kyeong Oh
    • Ponnarath Keo
    • Jaeman Bae
    • Jung Hwa Ko
    • Joong Sub Choi
  • View Affiliations / Copyright

    Affiliations: Institute of Medical Science, Hanyang University College of Medicine, Seoul 133-791, Republic of Korea, Department of Obstetrics and Gynecology, Hallym University Kangdong Sacred Heart Hospital, Seoul 05355, Republic of Korea
  • Pages: 1597-1604
    |
    Published online on: April 20, 2017
       https://doi.org/10.3892/ijmm.2017.2956
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Telomeres are transcribed into long non-coding RNA, referred to as telomeric repeat-containing RNA (TERRA), which plays important roles in maintaining telomere integrity and heterochromatin formation. TERRA has been well characterized in HeLa cells, a type of cervical cancer cell. However, TERRA abundance and stability have not been examined in other cervical cancer cells, at least to the best of our knowledge. Thus, in this study, we measured TERRA levels and stability, as well as telomere length in 6 cervical cancer cell lines, HeLa, SiHa, CaSki, HeLa S3, C-33A and SNU-17. We also examined the association between the TERRA level and its stability and telomere length. We found that the TERRA level was several fold greater in the SiHa, CaSki, HeLa S3, C-33A and SNU-17 cells, than in the HeLa cells. An RNA stability assay of actinomycin D-treated cells revealed that TERRA had a short half-life of ~4 h in HeLa cells, which was consistent with previous studies, but was more stable with a longer half-life (>8 h) in the other 5 cell lines. Telomere length varied from 4 to 9 kb in the cells and did not correlate significantly with the TERRA level. On the whole, our data indicate that TERRA abundance and stability vary between different types of cervical cancer cells. TERRA degrades rapidly in HeLa cells, but is maintained stably in other cervical cancer cells that accumulate higher levels of TERRA. TERRA abundance is associated with the stability of RNA in cervical cancer cells, but is unlikely associated with telomere length.

Introduction

Telomeres protect chromosomal ends from replicative attrition (1,2). The maintenance of telomere length and structure is critical to preserving telomere integrity. The majority of human cancer cells maintain telomere length via the activation of telomerase, which allows unlimited cell growth (3). Telomerase reverse transcriptase (TERT) is a rate-limiting component of telomerase that is expressed only in telomerase-positive cells (4,5). Telomere DNA, tandem (TTAGGG)n repeats, is tightly associated with specialized telomeric protein complexes, termed shelterin (6).

Telomeres are transcribed from the subtelomere toward the telomere into heterogeneous long non-coding RNA, which are referred to as telomeric repeat-containing RNA or TERRA (7,8). TERRA is found in most eukaryotes (9–11), and its transcription is carried out primarily by RNA polymerase II (RNAPII) in humans and yeasts (8,9,11,12). As with other RNAPII-mediated transcription, transcriptional activity is repressed by telomere heterochromatin regulation (12,13). Human TERRA has a short half-life and a cap structure at its 5′-end, and a small fraction of TERRA is polyadenylated at its 3′-end; polyadenylation is known to increase TERRA stability (14). TERRA accumulates in highly proliferating cancer cells, and elevated TERRA levels are found in various types of human cancer (15). However, whether elevated TERRA levels result from changes in transcriptional activity or increased stability of the RNA remains poorly understood.

TERRA is involved in various processes, such as telomere protection, telomere replication and the epigenetic state of telomere chromatin (16). However, the effects of telomere length on TERRA transcription remain controversial. A correlation between TERRA upregulation and short telomeres has been found in patients with immunodeficiency, centromeric instability and facial anomalies syndrome (17). The induction of TERRA transcription at a specific chromosome leads to telomere shortening of that chromosome (18). TERRA mimicking RNA oligonucleotide acts as a telomerase inhibitor (19). Moreover, cancer cells exhibit decreased TERRA levels upon telomere elongation mediated by telomerase overexpression (13). Taken together, the data from these studies suggest that telomere length is related to TERRA expression in a negative manner. By contrast, telomere over-elongation does not cause marked differences in TERRA abundance in Saccharomyces cerevisiae (20), which has also been observed in primary human lung fibroblasts and HeLa cells (21). Moreover, a lack of correlation between these two parameters has been reported in human cell lines (22). Thus, further studies are warranted to explore the functional effects of telomere length on TERRA expression.

TERRA is well characterized in HeLa, a cervical cancer cell line, as a model cell line (14). However, TERRA stability and abundance have not been examined in other cervical cancer cells, at least to the best of our knowledge. Thus, in this study, we measured TERRA level and stability, as well as telomere length in 6 human cervical cancer cells and examined whether TERRA abundance is related to stability and telomere length. We found that TERRA was more stable in cells with high levels of TERRA, but that telomere length is unlikely to be associated with TERRA expression in cervical cancer cells.

Materials and methods

Cell culture

The cells were grown in Dulbecco's modified Eagle's medium or RPMI-1640 supplemented with 10% fetal bovine serum (both from Wellgene, Seoul, Korea), 100 µg/ml of streptomycin, and 100 U/ml of penicillin (Gibco, Carlsbad, CA, USA). The SiHa, CaSki, HeLa, HeLa S3 and SNU-17 cells were purchased from the Korean Cell Line Bank (KCLB, Seoul, Korea), and C-33A was generously provided by the Yonsei Cancer Center, Seoul, Korea.

Slot-blot analysis of TERRA

Total RNA was isolated from the cells using TRIzol® reagent (Invitrogen, Carlsbad, CA, USA) or Tri-RNA (Favorgen, Koahsiung, Taiwan) according to the manufacturer's instructions. Total RNA was diluted to 0.02 µg/µl, and 20, 100 or 200 µl of the RNA dilution was immobilized onto a nylon membrane (Hybond™ N+; Amersham Biosciences, Piscataway, NJ, USA) for the detection of TERRA. Similarly, 10, 50 or 100 µl of RNA dilution at a concentration of 0.004 µg/µl was loaded for the detection of 18S rRNA. After UV cross-linking (Stratagene, La Jolla, CA, USA), the filters were hybridized with either a 3′-end DIG-labeled oligonucleotide d(CCCTAA)4 or a DIG-random-labeled 18S rDNA probe overnight at 45°C, and detection was performed using a detection starter kit (Roche, Mannheim, Germany). The blot hybridized with DIG-d(CCCTAA)4 was erased in 50% formamide, 5% sodium dodecyl sulfate and 50 mM Tris-HCl, pH 7.4 at 60°C, for 60 min twice, and reprobed with DIG-d(TTAGGG)4. DIG-labeled d(CCCTAA)4 and d(TTAGGG)4, and DIG-random-labeled 18S rDNA probes were generated using terminal transferase and DIG-High Prime (both from Roche), respectively. For the TERRA stability assay, total RNA was isolated from the cells treated with actinomycin D (Act D; Sigma, St. Louis, MO, USA) at 5 µg/ml for the times indicated in the figures, and slot blotting was performed as described above.

Reverse transcription-quantitative-polymerase chain reaction (RT-qPCR)

cDNA was generated using M-MLV reverse transcriptase (Invitrogen). cDNA synthesis was performed with 1.0 µg of total RNA in a total volume of 20 µl according to the manufacturer's instructions (Invitrogen). The reaction was incubated at 37°C for 50 min and then terminated at 70°C for 15 min for specific primers or at 25°C for 10 min, 37°C for 50 min, and 70°C for 15 min for random primers (Takara, Kyoto, Japan). The primers used for reverse transcription are as follows: 5′-AGTCCGCCTAGAAGCATTTG-3′ for β-actin (14), and 5′-CCCTAACCCTAACCCTAACCCTAACCCTAA-3′ for TERRA (14). PCR reactions were performed in 10 µl containing 1X SYBR®-Green PCR master mix (Roche), 0.2 µM of each forward and reverse primer (Table I) and 1.0 µl of cDNA. The negative control included nuclease-free water instead of cDNA. PCR was performed with a LightCycler® 480 Sequence Detection system (Roche) under the following conditions: denaturation at 95°C for 5 min, then 45 cycles at 95°C for 15 sec, 60°C for 15 sec, and 72°C for 15 sec. The comparative CT method (ΔΔCT) was used for quantification and was calculated as follows: ΔCT = CT (target gene) − CT (reference gene), and ΔΔCT = ΔCT (sample) − ΔCT (control). Relative quantification was derived by 2−ΔΔCq.

Table I

Oligonucleotides used for RT-qPCR.

Table I

Oligonucleotides used for RT-qPCR.

TranscriptPrimers sequences (5′→3′)Refs.
10q-TERRAF: GAATCCTGCGCACCGAGAT(13)
R: CTGCACTTGAACCCTGCAATAC(13)
13q-TERRAF: GCACTTGAACCCTGCAATACAG(24)
R: CCTGCGCACCGAGATTCT(24)
15q-TERRAF: CAGCGAGATTCTCCCAAGCTAAG(14)
R: AACCCTAACCACATGAGCAACG(14)
16p-TERRAF: TGCAACCGGGAAAGATTTTATT(24)
R: GCCTGGCTTTGGGACAACT(24)
17q-TERRAF: AGCTACCTCTCTCAACACCAAGAAG(24)
R: GTCCATGCATTCTCCATTGATAAG(24)
XqYq-TERRAF: CCCCTTGCCTTGGGAGAA(24)
R: GAAAGCAAAAGCCCCTCTGA(24)
XpYp-TERRAF: GCAAAGAGTGAAAGAACGAAGCTT(14)
R: CCCTCTGAAAGTGGACCAATCA(14)
TERTF: CTGGAACCATAGCGTCAGGGThis study
R: ACAGAAACCACGGTCACTCGThis study
PinX1F: CACTCCAGAGGAGAACGAAACCThis study
R: CACCGGCTTGGCAAAGTACTThis study
TRF1F: TGCTTTCAGTGGCTCTTCTG(34)
R: ATGGAACCCAGCAACAAGAC(34)
TRF2F: TTGTGGGGTCCTTGGACATA(34)
R: CCAGTAGAAAACTGGTCAAGGAA(34)
β-actinF: TGTACGCCAACACAGTGCTG(13)
R: GCTGGAAGGTGGACAGCG(13)
snU1F: GGCGAGGCTTATCCATTG(14)
R: CCCACTACCACAAATTATGC(14)

[i] TERRA, telomeric repeat-containing RNA; TRF1, telomere repeat-binding factor 1; F, forward; R, reverse.

Southern blot analysis of the terminal restriction fragment

Genomic DNA was isolated using standard phenol-chloroform extraction following proteinase K (Invitrogen) treatment, and digested with HinfI overnight at 37°C. HinfI-digested DNA (5 µg) was fractionated on an 0.8% agarose gel and transferred onto a nylon membrane using the upward capillary method. Hybridization was performed with a 3′-end DIG-labeled d(TTAGGG)4 (Roche) probe at 45°C overnight. The membrane was washed and hybridization was detected as recommended by the manufacturer (Roche). Telomere length was measured as the highest peak of the signal intensity using Image Lab software (Bio-Rad, Hercules, CA, USA).

Statistical analysis

Statistical analysis was assessed using a Student's t-test and Spearman's correlation as deemed appropriate. The level of statistical significance was set at P<0.05.

Results and Discussion

Variable TERRA levels in cervical cancer cells

Slot-blot analysis was performed to monitor the TERRA levels in the 6 cervical cancer cells, HeLa, SiHa, CaSki, HeLa S3 (a clonal derivative of the parent HeLa line), C-33A and SNU-17. Total RNA was blotted onto a membrane and hybridization was followed with a strand-specific TERRA probe, d(CCCTAA)4-DIG (Fig. 1A). Hybridization with the d(CCCTAA)4-DIG probes was quantified as a ratio relative to the level measured in HeLa cells following normalization by 18S rRNA (Fig. 1B). The hybridization signal was approximately 2- to 4-fold greater in the SiHa, CaSki, HeLa S3, C-33A and SNU-17 cells than in the HeLa cells (Fig. 1A and 1B). The blot used for TERRA detection was stripped and reprobed with a DIG-labeled d(TTAGGG)4 probe identical to the TERRA repeat sequences, and this hybridization resulted in weak signals (Fig. 1A). This indicated that RNAs with UUAGGG repeats, which are considered to be TERRA, are abundant in cervical cancer cells, whereas CCCUAA-containing RNA molecules exist at very low levels.

Figure 1

Expression of telomeric repeat-containing RNA (TERRA) in cervical cancer cells. (A) Slot-blot analysis of TERRA in 6 cervical cancer cell lines. Total RNA extracted from cells at 90% confluency was slot-blotted and hybridized with a DIG-labeled d(CCCTAA)4 probe for TERRA or with a DIG-random-primed 18S rRNA probe as an internal control. The blot used for TERRA detection was rinsed and reprobed with a DIG-labeled d(TTAGGG)4 probe. The amount of total RNA immobilized in each slot is indicated. (B) Quantification of TERRA in (A). TERRA level normalized by 18S rRNA was quantified as a ratio relative to that of HeLa cells. Error bars were derived from 2 independent assays (*P<0.05, **P< 0.005 by t-test). (C) RT-qPCR of TERRA in cervical cancer cells. Scheme of a subtelomere and telomere (left panel). Arrowheads indicate the positions of the primers used for RT-qPCR. TERRA level was measured by RT-qPCR (right panel). Relative RT-qPCR represents the value calculated using the ΔΔCq method relative to HeLa cells and β-actin. Error bars were derived from 3 independent experiments (means ± SD; *P<0.05, **P<0.005 by t-test).

Slot blotting is a tool which is used to monitor the UUAGGG repeat content rather than the number of TERRA molecules (23). Thus, the TERRA level was also assessed in subtelomeres using chromosome-specific RT-qPCR with primers matching the different chromosome arms (Fig. 1C and Table I). Note that the primer pairs used in this study amplify DNA fragments from more than one subtelomere due to the repetitive nature of subtelomeric DNA (7,13,24–27). TERRA for almost all subtelomeres tested in this study was more abundant in 5 of the cell lines compared with the HeLa cells (Fig. 1C). TERRA transcription at specific chromosome ends appeared to behave differently from that in the independent chromosome ends in some cells. For example, 16p TERRA was detected at a high level in the SiHa, C-33A and SNU-17 cells, and 15q TERRA was detected at a low level in the CaSki and C-33A cells. Overall, the results of RT-qPCR were consistent with those of slot blotting.

TERRA stability in cervical cancer cells

We wondered whether the variable TERRA levels in cervical cancer cells reflect different degrees of RNA stability. To assess this possibility, we measured the TERRA half-life by treating the cells with Act D to block transcription. RT-qPCR was used to monitor TERRA levels derived from chromosomes 10q and 17q over time (Fig. 2, left panels). The cell lines tested in this study were viable under these conditions. PinX1, which encodes a telomere-binding protein (6), β-actin and U1 small nuclear RNA (snRNA) were included in the analysis (Fig. 2). Act D treatment reduced the PinX1 mRNA levels in all cells to a half-life of 2–3 h in the SiHa, HeLa S3 and C-33A cells, and 4–5 h in the HeLa, CaSki and SNU-17 cells (Fig. 2, middle panels and Table II). These results confirmed that Act D inhibited RNAPII function effectively. The β-actin transcript was stable in the SiHa, CaSki, C-33A and SNU-17 cells with a half-life of >8 h; the half-life was shorter in the HeLa and HeLa S3 cells, approximately 5 h (Fig. 2, middle panels and Table II). U1 snRNA is transcribed by RNAPII and is known to be stable and abundant in human cells (28,29). This RNA was stably maintained in all cells tested with a half-life of >8 h (Fig. 2, right panels and Table II). U1 snRNA expression was slightly increased at later time points in almost all cell lines; in particular, a gradual increase was observed in the SiHa cells (Fig. 2, right panels). β-actin and U1 snRNA were initially included as internal controls; however, the level of these gene transcripts changed upon Act D treatment in some cells. Therefore, the RNA levels in the Act D-treated cells were quantified as a relative value against that of the untreated cells without normalization (Fig. 2).

Figure 2

Stability of telomeric repeat-containing RNA (TERRA) in six cervical cancer cell lines. Total RNA was extracted from the cells treated with actinomycin D (Act D) at 5 µg/ml for the indicated periods of time. RT-qPCR was performed to detect TERRA from 10q and 17q (left panels), mRNA levels of PinX1 and β-actin (middle panels), and U1 snRNA (right panels). RNA level was quantified as a ratio relative to that of untreated (0 h) cells. Error bars were derived from 3 independent experiments (means ± SD).

Table II

Summary of the half-life of TERRA, PinX1, β-actin and U1 snRNA, and telomere length in cervical cancer cells.

Table II

Summary of the half-life of TERRA, PinX1, β-actin and U1 snRNA, and telomere length in cervical cancer cells.

Cell line t1/2
Telomere length mean ± SD (kb)
TERRAPinX1β-actinU1 snRNA
HeLa10q, 4 h
17q, 4 h
5 h5 h>8 h5.6±0.72
SiHa10q, >8 h
17q, >2 h
2 h>8 h>8 h9.5±0.87
CaSki10q, >8 h
17q, >8 h
4 h>8 h>8 h5.0±0.63
HeLa S310q, >8 h
17q, >8 h
3 h5 h>8 h10.4±1.03
C-33A10q, >8 h
17q, >8 h
2 h>8 h>8 h4.5±1.47
SNU-1710q, >8 h
17q, >8 h
4 h>8 h>8 h5.9±0.52

[i] t1/2, approximate half-life value (Fig. 2).

Our RT-qPCR experiments revealed that the levels of TERRA derived from 10q and 17q decreased upon Act D treatment in HeLa cells (Fig. 2, left panels). The half-life of TERRA was approximately 4 h in the HeLa cells (Fig. 2 and Table II), which is similar to the approximate 3 h value measured using Act D in a northern blot analysis procedure reported previously (14). Unlike the HeLa cells, the other 5 cell lines did not exhibit a decrease in TERRA levels upon Act D treatment (Fig. 2, left panels). The half-life of TERRA was maintained at >8 h in the SiHa, CaSki and SNU-17 cells. Similar to the results of RT-qPCR, slot blotting of the total RNA assessed over time with a TERRA-specific probe revealed that TERRA was degraded more rapidly in the HeLa cells than in the SiHa, CaSki and SNU-17 cells (Fig. 3). It has been reported that a small fraction of TERRA contains a poly(A) tail at the 3′-end in HeLa (14). This may explain why TERRA has a short half-life in these cells. Although highly speculative, the other cervical cancer cells may maintain poly(A)+ TERRA as the predominant form. However, we cannot exclude the possibility that TERRA is transcribed by other RNA polymerases; for instance, RNAPI- or III-mediated TERRA transcription was less sensitive under our experimental condition in the cells, which may have allowed the persistent synthesis of TERRA.

Figure 3

Slot-blot analysis of telomeric repeat-containing RNA (TERRA) RNA from 6 cervical cancer cells over the indicated time course. Total RNA was extracted from the cells treated with actimomycin D at indicated periods of time, and 5 µg of RNA were loaded for TERRA and 0.4 µg for 18S rRNA per slot. Each sample was analyzed in duplicate. Hybridization was performed with a DIG-labeled d(CCCTAA)4 probe for TERRA and a DIG-random-primed 18S rDNA probe for 18S rRNA as an internal control. Two or three independent experiments were performed. TERRA levels normalized to 18S rRNA were quantified as a ratio relative to 0 h (graphs on the right).

Our RT-qPCR experiments revealed a gradual increase in TERRA levels, particularly 10q in HeLa S3 and 10q and 17q in C-33A cells, upon Act D treatment' (Fig. 2, left panels). We wondered whether this phenomenon would be detected by slot blotting. The results of slot blotting revealed that the UUAGGG signals increased in these cells upon Act D treatment (Fig. 3), indicating that the induced RNA detected by RT-qPCR was derived from telomeric RNA. The mechanism responsible for the increased TERRA accumulation in the presence of Act D remains unknown. TERRA may be released from RNA degradation cycles in these particular cells. It would be interesting to test whether newly synthesized RNA accounts for the increased TERRA. Collectively, these finding suggest that TERRA was less abundant and was degraded more rapidly in the HeLa cells, but was abundant and stable in the other 5 cell lines.

Telomere length and expression of telomere genes in cervical cancer cells

Telomere length was measured using Southern blot analysis of terminal restriction fragment lengths. The average telomere length was determined as the highest peak of the signal intensity. The telomeres were significantly longer in the SiHa and HeLa S3 cells than in the other 4 cell lines (Fig. 4A and Table II). To determine whether telomere length is related to TERRA expression in cervical cells, the TERRA levels measured by RT-qPCR were plotted against telomere length. Telomere length did not correlate significantly with the TERRA level (Fig. 4B, P=0.645). If anything, there was a tendency for cells with long telomeres to express higher levels of TERRA, and this was somewhat consistent with the results reported previously (30). This tendency was more evident after excluding from the analysis TERRA expression at 16p, which was particularly high compared with the expression at other chromosome ends (P=0.015) (Fig. 4B, graph on the right). Nonetheless, the number of cell lines tested in this study may be insufficient to reveal an association. Collectively, there was a lack of correlation between telomere length and TERRA transcription in the cervical cancer cells. The functional interaction between these two parameters may depend on the cell type, as noted previously (21).

Figure 4

Lack of correlation between telomere length and telomeric repeat-containing RNA (TERRA) expression in cervical cancer cells. (A) Southern blot of terminal restriction fragments in cervical cancer cells. Genomic DNA isolated from 2 independent cultures was digested with HinfI, transferred to a nylon membrane, and hybridized with a DIG-labeled d(TTAGGG)4 probe. Telomere length was determined by the highest peak signal. Error bars were derived from two measurements (graph on right). (B) Scatter plot of telomere length vs. TERRA expression. Telomere length and TERRA expression determined by RT-qPCR were plotted (graph on the left). The same analysis without TERRA at 16p is shown on the right. The data were analyzed using the Student's t-test.

The shelterin proteins, telomere repeat-binding factor 1 (TRF1) and TRF2, are important for recruiting other shelterin proteins to telomeres and negatively regulate telomere length (6). PinX1, a TRF1-interacting protein, inhibits telomerase activity and regulates telomere length in a negative manner (31). TERT, a catalytic component of telomerase, acts as a positive regulator of telomere length (32). It has recently been reported that TRF1 and TRF2 associate functionally with TERRA transcription; for instance, the depletion of TRF1 or TRF2 leads to the accumulation of TERRA (33). In this study, we measured the mRNA levels of TERT, PinX1, TRF1 and TRF2 (Fig. 5A), and we examined whether these are related to telomere length and TERRA level. The mRNA levels of none of these genes correlated significantly with telomere length or TERRA level in cervical cancer cells (Fig. 5B and 5C).

Figure 5

Expression of telomere genes in cervical cancer cells. (A) RT-qPCR of telomere-related genes in cervical cancer cells. First-strand cDNA was synthesized by random hexamer priming, RT-qPCR was performed with SYBR-Green reagents, and β-actin was used as a control. Relative RT-PCR represents the values calculated by the comparative (ΔΔCT) method relative to the values for β-actin and HeLa cells. Error bars were derived from two independent assays. (B) Scatter plot of telomere length vs. the levels of telomere genes. Telomere length measured by Southern blotting and telomere gene levels determined by RT-qPCR are plotted. (C) Scatter plot of telomeric repeat-containing RNA (TERRA) level vs. levels of telomere genes. TERRA levels measured by slot blotting and levels of telomere genes are plotted. (B and C) P-values by Spearman correlation analysis were not indicated as they were much higher than 0.05.

In conclusion, TERRA abundance and stability vary between types of cervical cancer cells. TERRA is degraded rapidly in HeLa cells, but is maintained stably in other cervical cancer cell lines. TERRA abundance is associated with the stability of the RNA in cervical cancer cells; however, there was a lack of correlation between the TERRA level and telomere length. Additional studies are warranted to explore the mechanisms that regulate TERRA steady-state levels.

Acknowledgments

This study was supported by the Basic Science Research Program through the the National Research Foundation of Korea (NRF) funded by the Ministry of Education (nos. 2010-0008254, 2014R1A1A2054542 to B.-K.O.) and funded by the Ministry of Science, ICT and Future Planning (no. 2011-0015638 to B.-K.O.) and by the Hanyang University (no. 201200000002989 to J.S.C.).

References

1 

Greider CW and Blackburn EH: Identification of a specific telomere terminal transferase activity in Tetrahymena extracts. Cell. 43:405–413. 1985. View Article : Google Scholar : PubMed/NCBI

2 

de Lange T: Shelterin: The protein complex that shapes and safeguards human telomeres. Genes Dev. 19:2100–2110. 2005. View Article : Google Scholar : PubMed/NCBI

3 

Shay JW, Zou Y, Hiyama E and Wright WE: Telomerase and cancer. Hum Mol Genet. 10:677–685. 2001. View Article : Google Scholar : PubMed/NCBI

4 

Bodnar AG, Ouellette M, Frolkis M, Holt SE, Chiu CP, Morin GB, Harley CB, Shay JW, Lichtsteiner S and Wright WE: Extension of life-span by introduction of telomerase into normal human cells. Science. 279:349–352. 1998. View Article : Google Scholar : PubMed/NCBI

5 

Nakayama J, Tahara H, Tahara E, Saito M, Ito K, Nakamura H, Nakanishi T, Tahara E, Ide T and Ishikawa F: Telomerase activation by hTRT in human normal fibroblasts and hepatocellular carcinomas. Nat Genet. 18:65–68. 1998. View Article : Google Scholar : PubMed/NCBI

6 

Palm W and de Lange T: How shelterin protects mammalian telomeres. Annu Rev Genet. 42:301–334. 2008. View Article : Google Scholar : PubMed/NCBI

7 

Azzalin CM, Reichenbach P, Khoriauli L, Giulotto E and Lingner J: Telomeric repeat containing RNA and RNA surveillance factors at mammalian chromosome ends. Science. 318:798–801. 2007. View Article : Google Scholar : PubMed/NCBI

8 

Schoeftner S and Blasco MA: Developmentally regulated transcription of mammalian telomeres by DNA-dependent RNA polymerase II. Nat Cell Biol. 10:228–236. 2008. View Article : Google Scholar

9 

Luke B, Panza A, Redon S, Iglesias N, Li Z and Lingner J: The Rat1p 5′ to 3′ exonuclease degrades telomeric repeat-containing RNA and promotes telomere elongation in Saccharomyces cerevisiae. Mol Cell. 32:465–477. 2008. View Article : Google Scholar : PubMed/NCBI

10 

Vrbsky J, Akimcheva S, Watson JM, Turner TL, Daxinger L, Vyskot B, Aufsatz W and Riha K: siRNA-mediated methylation of Arabidopsis telomeres. PLoS Genet. 6:e10009862010. View Article : Google Scholar : PubMed/NCBI

11 

Bah A, Wischnewski H, Shchepachev V and Azzalin CM: The telomeric transcriptome of Schizosaccharomyces pombe. Nucleic Acids Res. 40:2995–3005. 2012. View Article : Google Scholar :

12 

Nergadze SG, Farnung BO, Wischnewski H, Khoriauli L, Vitelli V, Chawla R, Giulotto E and Azzalin CM: CpG-island promoters drive transcription of human telomeres. RNA. 15:2186–2194. 2009. View Article : Google Scholar : PubMed/NCBI

13 

Arnoult N, Van Beneden A and Decottignies A: Telomere length regulates TERRA levels through increased trimethylation of telomeric H3K9 and HP1α. Nat Struct Mol Biol. 19:948–956. 2012. View Article : Google Scholar : PubMed/NCBI

14 

Porro A, Feuerhahn S, Reichenbach P and Lingner J: Molecular dissection of telomeric repeat-containing RNA biogenesis unveils the presence of distinct and multiple regulatory pathways. Mol Cell Biol. 30:4808–4817. 2010. View Article : Google Scholar : PubMed/NCBI

15 

Deng Z, Wang Z, Xiang C, Molczan A, Baubet V, Conejo-Garcia J, Xu X, Lieberman PM and Dahmane N: Formation of telomeric repeat-containing RNA (TERRA) foci in highly proliferating mouse cerebellar neuronal progenitors and medulloblastoma. J Cell Sci. 125:4383–4394. 2012. View Article : Google Scholar : PubMed/NCBI

16 

Azzalin CM and Lingner J: Telomere functions grounding on TERRA firma. Trends Cell Biol. 25:29–36. 2015. View Article : Google Scholar

17 

Yehezkel S, Segev Y, Viegas-Péquignot E, Skorecki K and Selig S: Hypomethylation of subtelomeric regions in ICF syndrome is associated with abnormally short telomeres and enhanced transcription from telomeric regions. Hum Mol Genet. 17:2776–2789. 2008. View Article : Google Scholar : PubMed/NCBI

18 

Pfeiffer V and Lingner J: TERRA promotes telomere shortening through exonuclease 1-mediated resection of chromosome ends. PLoS Genet. 8:e10027472012. View Article : Google Scholar : PubMed/NCBI

19 

Redon S, Reichenbach P and Lingner J: The non-coding RNA TERRA is a natural ligand and direct inhibitor of human telomerase. Nucleic Acids Res. 38:5797–5806. 2010. View Article : Google Scholar : PubMed/NCBI

20 

Iglesias N, Redon S, Pfeiffer V, Dees M, Lingner J and Luke B: Subtelomeric repetitive elements determine TERRA regulation by Rap1/Rif and Rap1/Sir complexes in yeast. EMBO Rep. 12:587–593. 2011. View Article : Google Scholar : PubMed/NCBI

21 

Farnung BO, Brun CM, Arora R, Lorenzi LE and Azzalin CM: Telomerase efficiently elongates highly transcribing telomeres in human cancer cells. PLoS One. 7:e357142012. View Article : Google Scholar : PubMed/NCBI

22 

Smirnova A, Gamba R, Khoriauli L, Vitelli V, Nergadze SG and Giulotto E: TERRA expression levels do not correlate with telomere length and radiation sensitivity in human cancer cell lines. Front Oncol. 3:1152013. View Article : Google Scholar : PubMed/NCBI

23 

Van Beneden A, Arnoult N and Decottignies A: Telomeric RNA expression: Length matters. Front Oncol. 3:1782013. View Article : Google Scholar : PubMed/NCBI

24 

Deng Z, Wang Z, Stong N, Plasschaert R, Moczan A, Chen HS, Hu S, Wikramasinghe P, Davuluri RV, Bartolomei MS, et al: A role for CTCF and cohesin in subtelomere chromatin organization, TERRA transcription, and telomere end protection. EMBO J. 31:4165–4178. 2012. View Article : Google Scholar : PubMed/NCBI

25 

Riethman HC, Xiang Z, Paul S, Morse E, Hu XL, Flint J, Chi HC, Grady DL and Moyzis RK: Integration of telomere sequences with the draft human genome sequence. Nature. 409:948–951. 2001. View Article : Google Scholar : PubMed/NCBI

26 

Riethman H, Ambrosini A, Castaneda C, Finklestein J, Hu XL, Mudunuri U, Paul S and Wei J: Mapping and initial analysis of human subtelomeric sequence assemblies. Genome Res. 14:18–28. 2004. View Article : Google Scholar : PubMed/NCBI

27 

Ambrosini A, Paul S, Hu S and Riethman H: Human subtelomeric duplicon structure and organization. Genome Biol. 8:R1512007. View Article : Google Scholar : PubMed/NCBI

28 

Ro-Choi TS, Raj NB, Pike LM and Busch H: Effects of alpha-amanitin, cycloheximide, and thioacetamide on low molecular weight nuclear RNA. Biochemistry. 15:3823–3828. 1976. View Article : Google Scholar : PubMed/NCBI

29 

Noonberg SB, Scott GK and Benz CC: Evidence of post-transcriptional regulation of U6 small nuclear RNA. J Biol Chem. 271:10477–10481. 1996. View Article : Google Scholar : PubMed/NCBI

30 

Vitelli V, Falvo P, Khoriauli L, Smirnova A, Gamba R, Santagostino M, Nergadze SG and Giulotto E: More on the lack of correlation between terra expression and telomere length. Front Oncol. 3:2452013. View Article : Google Scholar : PubMed/NCBI

31 

Zhou XZ and Lu KP: The Pin2/TRF1-interacting protein PinX1 is a potent telomerase inhibitor. Cell. 107:347–359. 2001. View Article : Google Scholar : PubMed/NCBI

32 

Autexier C and Lue NF: The structure and function of telomerase reverse transcriptase. Annu Rev Biochem. 75:493–517. 2006. View Article : Google Scholar : PubMed/NCBI

33 

Porro A, Feuerhahn S, Delafontaine J, Riethman H, Rougemont J and Lingner J: Functional characterization of the TERRA transcriptome at damaged telomeres. Nat Commun. 5:53792014. View Article : Google Scholar : PubMed/NCBI

34 

Scheibe M, Arnoult N, Kappei D, Buchholz F, Decottignies A, Butter F and Mann M: Quantitative interaction screen of telomeric repeat-containing RNA reveals novel TERRA regulators. Genome Res. 23:2149–2157. 2013. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Oh B, Keo P, Bae J, Ko JH and Choi JS: Variable TERRA abundance and stability in cervical cancer cells. Int J Mol Med 39: 1597-1604, 2017.
APA
Oh, B., Keo, P., Bae, J., Ko, J.H., & Choi, J.S. (2017). Variable TERRA abundance and stability in cervical cancer cells. International Journal of Molecular Medicine, 39, 1597-1604. https://doi.org/10.3892/ijmm.2017.2956
MLA
Oh, B., Keo, P., Bae, J., Ko, J. H., Choi, J. S."Variable TERRA abundance and stability in cervical cancer cells". International Journal of Molecular Medicine 39.6 (2017): 1597-1604.
Chicago
Oh, B., Keo, P., Bae, J., Ko, J. H., Choi, J. S."Variable TERRA abundance and stability in cervical cancer cells". International Journal of Molecular Medicine 39, no. 6 (2017): 1597-1604. https://doi.org/10.3892/ijmm.2017.2956
Copy and paste a formatted citation
x
Spandidos Publications style
Oh B, Keo P, Bae J, Ko JH and Choi JS: Variable TERRA abundance and stability in cervical cancer cells. Int J Mol Med 39: 1597-1604, 2017.
APA
Oh, B., Keo, P., Bae, J., Ko, J.H., & Choi, J.S. (2017). Variable TERRA abundance and stability in cervical cancer cells. International Journal of Molecular Medicine, 39, 1597-1604. https://doi.org/10.3892/ijmm.2017.2956
MLA
Oh, B., Keo, P., Bae, J., Ko, J. H., Choi, J. S."Variable TERRA abundance and stability in cervical cancer cells". International Journal of Molecular Medicine 39.6 (2017): 1597-1604.
Chicago
Oh, B., Keo, P., Bae, J., Ko, J. H., Choi, J. S."Variable TERRA abundance and stability in cervical cancer cells". International Journal of Molecular Medicine 39, no. 6 (2017): 1597-1604. https://doi.org/10.3892/ijmm.2017.2956
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team