Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
February-2018 Volume 41 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
February-2018 Volume 41 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Role of the cofilin 2 gene in regulating the myosin heavy chain genes in mouse myoblast C2C12 cells

  • Authors:
    • Hongyan Zhu
    • Huixin Yang
    • Song Zhao
    • Junfeng Zhang
    • Dan Liu
    • Yumin Tian
    • Zhiyi Shen
    • Yuhong Su
  • View Affiliations / Copyright

    Affiliations: College of Animal Science and Veterinary Medicine, Jinzhou Medical University, Jinzhou, Liaoning 121001, P.R. China, College of Veterinary Medicine, Nanjing Agricultural University, Nanjing, Jiangsu 210000, P.R. China, Central Laboratary, Jinzhou Medical University, Jinzhou, Liaoning 121001, P.R. China
  • Pages: 1096-1102
    |
    Published online on: November 17, 2017
       https://doi.org/10.3892/ijmm.2017.3272
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The cofilin 2 (CFL2) and myosin heavy chain (MyHC) genes play a key role in muscle development and myofibrillar formation. The aim of the present study was to investigate the effect of CFL2 on genes involved in fiber formation and the mechanisms underlying this process. Undifferentiated and differentiated C2C12 cells (UDT and DT, respectively) were transfected with CFL2 small interfering RNA (siRNA). CFL2 mRNA and protein levels were assessed using reverse transcription polymerase chain reaction (RT-PCR) and western blotting, respectively. MyHC gene expression in UDT and signaling pathway-related factors were observed with quantitative PCR (RT‑qPCR) and western blotting. Fluorescence microscopy was used to analyze the cytoskeletal effects of CFL2. The mRNA and protein expressions of CFL2, four MyHC isoforms (MyHC-I, MyHC-IIa, MyHC-IIb and MyHC-IIx), p38 mitogen-activated protein kinase, cAMP-response element-binding protein, AMP-activated protein kinase α1, and myocyte enhancer factor 2C, were significantly decreased in UDT. However, extracellular signal-regulated kinase 2 expression was significantly increased. Slightly decreased CFL2 protein and mRNA expression was observed in DT C2C12 cells transfected with CFL2 siRNA. Fluorescence microscopy revealed a significant decrease of CFL2 in the cytoplasm, but not the nucleus, of UDT, compared with normal cells. These results indicated that the mouse CFL2 gene may be involved in the regulation of MyHC via the key signaling molecules of CFL2-related signaling pathways.

Introduction

The cofilin 2 (CFL2) gene plays a key role in muscle development in mammals. CFL plays a crucial role in the regulation of actin by enhancing the turnover of actin filaments (1,2). Mammalian CFL occurs as non-muscle type (CFL1) or muscle-type (CFL2). In embryos, CFL1 is predominantly expressed in non-myoblast cells. The CFL2 protein appears in skeletal and cardiac myoblasts, particularly in the I bands and Z lines of skeletal myoblasts. During muscle development, CFL1 expression decreases, while CFL2 expression increases and eventually becomes predominant in mature mammalian skeletal myoblasts (3). The CFL2 transcript is spliced using either exon1a or exon1b to form the CFL2a and CFL2b transcripts, respectively. The CFL2a transcript is found in various tissues, while the CFL2b transcript is mainly found in mature skeletal muscle. CFL binds and polymerizes filamentous F-actin and inhibits the polymerization of monomeric G-actin in a pH-dependent manner, in part through interactions with tropomyosins (4,5).

Four isoforms of myosin heavy chain (MyHC) are expressed in skeletal muscle throughout the period of development, and are determinants of muscle development (6): I, slow oxidative; IIa, fast oxidative; IIb, fast glycolytic; and IIx/d, mixed (7). It was previously suggested that MyHC composition affects meat quality in livestock (8). Meat characteristics, in particular edibility, may be strongly affected by muscle fiber types, which depend on MyHC mRNA expression (8). Indeed, the expression of MyHC-I is associated with the pH value of the meat 24 h after death (pH24h) and drip loss (a characteristic of meat that represents its water-retaining capacity), while MyHC-II expression is correlated with juiciness, off-flavor, and tenderness of the meat (8). Our previous study demonstrated that CFL2b overexpression regulated the fast muscle fiber trait by increasing the expression of MyHC-IIb and -IIx/d (9). However, the effects on MyHC when CFL2 is disrupted have not been determined.

MyHC and CFL expression are associated with four cellular signaling pathways, including AMP-activated protein kinase (AMPK) (10,11), calmodulin (CaM), Rho, and mitogen-activated protein kinase (MAPK) (12–14). Five important proteins in these pathways, including extracellular signal-regulated kinase 2 (ERK2) (15), p38 MAPK (16), myocyte enhancer factor 2C (MEF2C) (17,18), cAMP-response element-binding protein (CBP) (16) and AMPKα1 (19), may affect the expression of MyHC after inhibiting CFL2 expression.

To identify the involvement of CFL2 in skeletal muscle and the period during which CFL2 exerts its effects, the present study investigated the effects of CFL2 on actin fibers by studying the CFL2 and MyHC genes in undifferentiated and differentiated C2C12 cells transfected with the CFL2 siRNA. In addition, the protein expression of pathway-related genes, including ERK2, p38 MAPK, MEF2C, CBP and AMPKα1, was determined.

Materials and methods

Cell culture and transfection

Mouse C2C12 myoblasts (GNM26) obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China) were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% (v/v) fetal calf serum (both from Invitrogen; Thermo Fisher Scientific, Carlsbad, CA, USA) at 37°C with 5% CO2 in humidified chambers. Differentiation of C2C12 cells was induced by replacing the medium with 2% horse serum for 6 days.

Cells in 6-well plates were transfected with CFL2 small interfering RNA (siRNA) using the liposome method (FuGene HD transfection reagent; Roche, Shanghai, China) when they reached 50% confluence, according to the manufacturer's instructions (9). The RNA interfering effects of siRNAs were confirmed by western blotting and reverse transcription-quantitative polymerase chain reaction (RT-qPCR). The undifferentiated cells were then screened with 500 µg/ml of G418 (Roche) to obtain single cell clones.

siRNA for CFL2 gene

Two siRNA pairs (CFL2-1 and CFL2-2; Table I) were selected for targeting the murine CFL2 gene (NM_007688) using a web-based siRNA design application (http://sirna.wi.mit.edu/home.php) (20). The selected siRNA pairs were then synthesized by Genechem (Shanghai, China). Undifferentiated cells were transfected with siRNA concentrations of 50, 100 and 150 nmol/l of CFL2-1, and 50 and 100 nmol/l of CFL2-2. Cells transfected with scramble siRNA were used as controls. The effects of CFL2 siRNA were identified by RT-PCR and western blotting.

Table I

siRNA sequences for the target sites in the CFL2 gene.

Table I

siRNA sequences for the target sites in the CFL2 gene.

siRNAPrimer sequences (5′-3′)Target site
CFL2-1F: CUGAAAGUGCACCGUUAAAdTdT315–337
R: UUUAACGGUGCACUUUCAGdTdT
CFL2-2F: GCUCUAAAGAUGCCAUUAAdTdT354–376
R: UUAAUGGCAUCUUUAGAGCdTdT
Scramble CTTGAAGGAAAGCCACTAT–

[i] CFL2, cofilin 2; F, forward primer; R, reverse primer.

Experimental groups

Cells were divided into the following groups: Undifferentiated, C2C12 cells transfected with scramble siRNA (UDN); undifferentiated, C2C12 cells transiently transfected with CFL2 siRNA (UDT); differentiated, C2C12 cells transfected with scramble siRNA (DN); and differentiated, C2C12 cells transiently transfected with CFL2 siRNA (DT).

RT-PCR

RNA was extracted from C2C12 cells using an RNeasy mini kit (Qiagen, Hilden, Germany), and first-strand cDNA was synthesized from purified total RNA with a reverse transcription kit (Takara, Dalian, China). RT-PCR was performed according to standard protocols using the primers indicated in Table II. The final volumes of each reaction were 20 µl, including 10 pmol primers, 2 mM MgCl2, 2.5 mM dNTP, and 1 U TaqDNA polymerase (Takara). The samples underwent PCR as follows: Denaturation for 5 min at 94°C; 30 cycles of 30 sec at 94°C, 30 sec at 56.7°C, and 45 sec at 72°C; and extension for 10 min at 72°C. Following amplification, 10 µl PCR product was analyzed using 1% agarose gel electrophoresis and visualized using ethidium bromide and UV light.

Table II

RT-PCR primers for the target genes.

Table II

RT-PCR primers for the target genes.

Target genesPrimer sequences (5′-3′)PCR product size
CFL2F: ATCTTGGTGGGTGACATTGG322 bp
R: CAAGGGAAACTACAACACTGC
GAPDHaF: GCAGTGGCAAAGTGGAGATT790 bp
R: TGAAGTCGCAGGAGACAACC
GAPDHbF: GCGAGACCCCACTAACATC171 bp
R: TTCACACCCATCACAAACA

a Primer of GAPDH used in Fig. 1A.

b Primer of GAPDH used in Fig. 2A. RT-PCR, reverse transcription-polymerase chain reaction; CFL2, cofilin 2; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; F, forward primer; R, reverse primer.

RT-qPCR

RT-qPCR was performed to detect mRNA expression of MyHC-I, MyHC-IIa, MyHC-IIb, MyHC-IIx and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) in UDN, UDT, DN and DT. The cDNA template was prepared from mRNA directly harvested from CFL2-transfected cells at 1×106 cells/well. First-strand reverse transcription was performed using 100 ng total RNA with a reverse transcription kit (Takara); the RT-qPCR primers were also from Takara (Table III). SYBR-Green RT-qPCR assay for the target genes was performed in optical 96-well plates using the SYBR® Premix EX Taq™ II (DRR081A; Takara) and the 7500 Fast Real-Time PCR system (Applied Biosystems, Foster City, MA, USA), according to the manufacturer's instructions. Results were detected quantitatively in real-time by relative quantitation of two standard curves. The process consisted of 41 cycles, including 1 cycle of 10 sec at 95°C and 40 cycles of 5 sec at 95°C and 20 sec at 60°C. All experiments were performed three times, each time in triplicate.

Table III

Oligonucleotide primers for RT-qPCR.

Table III

Oligonucleotide primers for RT-qPCR.

GenesPrimer sequences (5′-3′)PCR product size
MyHC-IF: ATGAGCTGGAGGCTGAGCA124 bp
R: TGCAGCCGCAGTAGGTTCTT
MyHC-IIaF: ATTCTCAGGCTTCAGGATTTGGTG114 bp
R: CTTGCGGAACTTGGATAGATTTGTG
MyHC-IIbF: GAGTTCATTGACTTCGGGATGG143 bp
R: TGCTGCTCATACAGCTTGTTCTTG
MyHC-IIxF: AAGGGTCTGCGCAAACATGA173 bp
R: TTGGCCAGGTTGACATTGGA
GAPDHF: GCGAGACCCCACTAACATC171 bp
R: TTCACACCCATCACAAACA

[i] RT-qPCR, reverse transcription-quantitative polymerase chain reaction; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; MyHC, myosin heavy chain; F, forward primer; R, reverse primer.

Western blotting

Western blotting for CFL2, p38, ERK2, CBP, AMPKα1, MEF2C and GAPDH was performed in UDN and UDT. The cells were washed, harvested, lysed with a lysis buffer [20 mM Tris-Cl, pH 7.5, 150 mM NaCl, 1% sodium dodecyl sulfate (SDS), 1% Triton X-100, 10 µg/ml leupeptin, 1 mM aprotinin and 1 mM phenylmethanesulfonyl fluoride] on ice for 30 min, and centrifuged at 14,000 × g at 4°C for 15 min. Proteins were resolved by SDS-polyacrylamide gel electrophoresis, transferred onto polyvinylidene difluoride membranes, blocked at room temperature for 1 h in 5% bovine serum albumin (BSA), and then incubated overnight at 4°C on a rotator with the primary antibodies: CFL2 (1:1,000; goat, SAB2500255; Sigma-Aldrich; Merck KGaA, St. Louis, MO, USA), p38 (1:1,000; mouse, ab31828), ERK2 (1:1,000; rabbit, ab32081), CBP (1:1,000; mouse, ab50702), AMPKα1 (1:1,000; mouse, ab80039) (all from Abcam, Cambridge, MA, USA), MEF2C (1:1,000; rabbit, SAB2103534; Sigma-Aldrich; Merck KGaA) and GAPDH (1:2,000; mouse, ab8245; Abcam). The membranes were washed four times with TBST and incubated for 1 h with an appropriate horseradish peroxidase (HRP)-conjugated secondary antibody (1:3,000). Immunoreactivity was visualized with an enhanced chemiluminescence detection reagent (ECL; Pierce, Rockford, IL, USA). All the experiments were performed three times, each time in triplicate.

CFL2 and F-actin analysis by fluorescence microscopy

CFL2 siRNA was transfected into cells. CFL2 and F-actin were labeled with fluorescein isothiocyanate (FITC) and tetramethylrhodamine (TRITC)-labeled phalloidin (Sigma-Aldrich; Merck KGaA) to differentiate between UDN and UDT. In terms of TRITC-labeled phalloidin methodology, UDN and UDT were grown on glass coverslips until they reached the logarithmic growth stage. Specimens were then washed three times in phosphate-buffered saline (PBS) and fixed with 4% paraformaldehyde at room temperature for 30 min. After washing three times with PBS, the specimens were permeabilized with 0.2% Triton X-100 for 10 min, washed three times with PBS, and blocked with 1% BSA for 30 min. The coverslips were incubated for 10 min with diluted phalloidin (1:200, protected from light) and washed three times in PBS. The coverslips were mounted and observed with 90% glycerol in PBS. Notably, the FITC methodology is equivalent to the TRITC-labeled phalloidin approach, but additionally requires an overnight antibody incubation step prior to hybridization with diluted FITC (1:100, protected from light). UDN were used as controls. The cells were examined using a Zeiss epifluorescence microscope (Carl Zeiss AG, Oberkochen, Germany), as described in Table IV.

Table IV

Fluorescent staining of CFL2 and F-actin in C2C12 cells.

Table IV

Fluorescent staining of CFL2 and F-actin in C2C12 cells.

CFL2 expression levelsFluorescent staining method
CFL2F-actin
LowIgG antibody labeling with FITCTRITC-labeled phalloidin
NormalIgG antibody labeling with FITCTRITC-labeled phalloidin

[i] CFL2, cofilin 2; Ig, immunoglobulin; FITC, fluorescein isothiocyanate; TRITC, tetramethylrhodamine.

Statistical analyses

The results were analyzed using SPSS 17.0 software (IBM, Armonk, NY, USA). Data are presented as means ± standard deviation. Experimental and control groups were compared using analysis of variance followed by Least Significant Difference post hoc analysis. P-values <0.05 were considered to indicate statistically significant differences.

Results

Knockdown of CFL2 by CFL2 siRNA

We first validated the RNA interference (RNAi) effects of CFL2 siRNAs. RT-PCR amplification of CFL2 and GAPDH was analyzed (Fig. 1A). The results revealed that CFL2-1 siRNA at 50 nM exerted the strongest inhibitory effect of all five experimental groups (P<0.05; Fig. 1B), whereas, as expected, the scramble siRNA exerted no effect on CFL2 expression. The results of western blotting were consistent with the RT-PCR results (Fig. 1C and D). Therefore, the most effective siRNA sequence for CFL2 was CFL2-1 siRNA at a concentration of 50 nM.

Figure 1

Cofilin 2 (CFL2) mRNA and protein expression in C2C12 cells transfected with CFL2 siRNA. (A) Representative image of RT-PCR. (B) Statistical data of (A). (C) Representative image of western blotting. (D) Statistical data of (C). The histogram shows the results as mean ± standard deviation of three experiments performed in triplicate. Expression was normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH). M, 100 bp standard marker. *P<0.05 vs. scramble siRNA group; #P<0.05 vs. CLF2-1 siRNA 50 nmol/l. siRNA, small interfering RNA; RT-PCR, reverse transcription-polymerase chain reaction.

MyHC expression is downregulated in undifferentiated C2C12 cells treated with CFL2 RNAi

RNAi significantly inhibited CFL2 in undifferentiated cells (P<0.05) and in DT compared with DN (P<0.05; Fig. 2A and B). Therefore, regardless of cellular differentiation, RNAi significantly inhibited CFL2 mRNA expression in C2C12 cells. Western blot analyses were also consistent with the RT-PCR results (P<0.05; Fig. 2C and D).

Figure 2

Cofilin 2 (CFL2) mRNA and protein expression after RNAi in undifferentiated and differentiated C2C12 cells. (A) Representative image of RT-PCR of CFL2 and glyceraldehyde 3-phosphate dehydrogenase (GAPDH). M, 100 bp standard marker. (B) Statistical data. GAPDH was used as an internal control. (C) Representative image of western blotting of CFL2 and GAPDH. (D) Statistical data. GAPDH was used as an internal control. All experiments were performed three times, each time in triplicate. *P<0.05 UDT vs. UDN and DT vs. DN. UDN, undifferentiated C2C12 cells transfected with scramble siRNA; UDT, undifferentiated C2C12 cells transiently transfected with CFL2 siRNA; DN, differentiated C2C12 cells transfected with scramble siRNA; DT, differentiated C2C12 cells transiently transfected with CFL2 siRNA.

RT-qPCR amplification was used to determine the expression of MyHC genes in differentiated and undifferentiated C2C12 cells following CFL2 siRNA transfection. The MyHC/GAPDH expression in undifferentiated and differentiated cells is shown in Fig. 3. MyHC-I, MyHC-IIa, MyHC-IIb and MyHC-IIx gene expressions were significantly decreased in UDT (P<0.05). However, in DT, RNAi had almost no effect on MyHC expression, suggesting that MyHC expression is generally proportional to that of CFL2 prior to differentiation of cells into muscle fibers. These results suggest that MyHC mRNA expression was elevated after differentiation (P<0.05), and that MyHC genes were not significantly affected by downregulation of CFL2 only in undifferentiated cells. With this in mind, subsequent experiments were only performed in the UDT and UDN groups.

Figure 3

Myosin heavy chain (MyHC) mRNA expression with cofilin 2 (CFL2) RNAi in differentiated and undifferentiated C2C12 cells, using RT-qPCR. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal control. The level of mRNA in the UDN group was set as 1 and the other groups were normalized to UDN. All experiments were performed three times, each time in triplicate. **P<0.01. RT-qPCR, reverse transcription-quantitative polymerase chain reaction; UDN, undifferentiated C2C12 cells transfected with scramble siRNA; UDT, undifferentiated C2C12 cells transiently transfected with CFL2 siRNA; DN, differentiated C2C12 cells transfected with scramble siRNA; DT, differentiated C2C12 cells transiently transfected with CFL2 siRNA.

Muscle fiber signaling pathway-related factors are altered by CFL2 RNAi in undifferentiated C2C12 cells

The expression of key signaling molecules in the AMPK, CaM, Rho and MAPK pathways (including p38 MAPK, ERK2, CBP, AMPKα1 and MEF2C) was measured by western blotting. The expressions of p38 MAPK, CBP, AMPKα1 and MEF2C proteins were significantly decreased in UDT (P<0.05). By contrast, ERK2 protein expression was significantly increased compared with UDN (P<0.05; Fig. 4).

Figure 4

p38, ERK2, CBP, AMPKα1 and MEF2C protein expression in UDN and UDT. (A) Representative image of western blotting of p38, ERK2, CBP, AMPKα1 and MEF2C protein expression in UDN and UDT. (B) Statistical data. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal control. All experiments were performed three times, each time in triplicate. *P<0.05 vs. UDN. UDN, undifferentiated C2C12 cells transfected with scramble siRNA; UDT, undifferentiated C2C12 cells transiently transfected with CFL2 siRNA; ERK2, extracellular signal-regulated kinase 2; CBP, cAMP-response element-binding protein; AMPK, AMP-activated protein kinase; MEF2C, myocyte enhancer factor 2C.

CFL2 alters F-actin formulation in C2C12 cells

In UDN, CFL2 (green fluorescence) was diffusely distributed in the cytoplasm and nucleus of the cells (Fig. 5A). UDT exhibited a similar diffuse CFL2 distribution pattern (Fig. 5B).

Figure 5

Cofilin 2 (CFL2) and F-actin localization in C2C12 cells. (A and B) CFL2 expression and distribution pattern in UDN and UDT (magnification, ×200). (C and D) F-actin expression and distribution pattern in UDN and UDT (magnification, ×200). UDN, undifferentiated C2C12 cells transfected with scramble siRNA; UDT, undifferentiated C2C12 cells transiently transfected with CFL2 siRNA.

F-actin structures were not significantly different in UDT compared to UDN with CFL2 expression. The F-actin bundles, however, exhibited a tendency to form amorphous diffuse patterns (Fig. 5C and D).

Discussion

The aim of the present study was to demonstrate the effects of the mouse myosin-binding protein CFL2 on the expression of MyHC, which may play a pivotal role in the cytoskeleton in undifferentiated C2C12 cells. The functions of CFL2 in undifferentiated and differentiated C2C12 cells were investigated and the results suggested that, in undifferentiated cells, the expression of MyHC genes decreased significantly after CFL2 RNAi; however, there was no obvious change in differentiated cells.

Effects of CFL2 on muscle fiber types

Four MyHC isoforms (I, IIa, IIx and IIb) are expressed in adult skeletal muscles (6). MyHCs are the primary molecular markers for distinguishing muscle fiber types and studying their characteristics. When CFL2 gene expression in C2C12 myoblasts is suppressed, the expression of MyHC-I, MyHC-IIa, MyHC-IIb and MyHC-IIx is significantly downregulated.

In addition, 6 days after C2C12 differentiation was induced using 2% horse serum, the CFL2 mRNA and protein expressions in DN were not significantly different from those in undifferentiated cells. The expression of MyHC-I, MyHC-IIa, MyHC-IIb and MyHC-IIx increased, indicating that MyHC is associated with myoblast differentiation. However, RNAi no longer affected the types of MyHC. This may indicate that interactions between CFL2 and MyHCs only occur in undifferentiated cells.

Molecular mechanisms of MyHC in C2C12 cells and CFL2 involvement

Within the four key cellular signaling pathways involved in muscle fiber regulation, there are five important signaling factors: p38 MAPK, ERK2, CBP, MEF2C and AMPKα1. The fast muscle fibers (MyHC-IIb/IIx) are preferentially affected by MAPK signaling. The dual-specific mitogen-activated protein kinase kinase 3 (MKK3) and the constitutively active MKK6 mutant upstream of p38 MAPK are involved in the maintenance of the fast muscle fiber phenotype (21); they may also be involved in the regulation of MyHC-IIx promoter activity in myotubes (12,22). The ERK pathway is also a major pathway that affects fast fibers, as demonstrated by increased MyHC-IIx and MyHC-IIb transcripts and decreased MyHC-I expression following ablation of the ERK1/2 pathway in cultured rat fetal myocytes (23). This mechanism is also consistent with the downregulation of CFL2 genes as a means to decrease p38 MAPK, MyHC-IIb and MyHC-IIx expression and to increase ERK2 expression.

It was previously reported that ERK1/2 activity is more than 2-fold higher in fast muscle fibers compared with that in slow muscle fibers (15), suggesting that the ERK1/2 pathway may play a key role in maintaining the fast fiber phenotype. When p38 MAPK activity is inhibited, the promoter activities of fast-type MyHC-IIb and MyHC-IIx are downregulated. Moreover, p38α/β MAPK is known to mediate MyHC-IIb and MyHC-IIx expression via CBP and the MEF2C/D heterodimer (16). When combined with other transcriptional factors (17), MEF2C may affect MyHC isoform expression in mouse skeletal muscle (18). These prior findings are highly consistent with the results of the present study, in which MEF2C and CBP expression was decreased by CFL2 RNAi. Furthermore, a decrease in MEF2C expression has been associated with a decrease in MyHC-I muscle fibers (24). Expression of the MEF2C subunits may also be involved in activation of the p38 MAPK pathway. Thus, MEF2C and p38 synergistically regulate and promote type I muscle fibers.

Previously, the authors observed that skeletal muscle in wild-type mice commonly undergoes an AMPK-mediated shift from MyHC-IIb to MyHC-IIa and MyHC-IIx during exercise training (10). These prior results indicated that AMPKα1 and AMPKα2 may also alter skeletal muscle composition. This is consistent with the present results, which demonstrated down-regulation of AMPKα1, MyHC-IIa, MyHC-IIb and MyHC-IIx following CFL2 RNAi.

Notably, MyHC gene expression was altered in UDT due to RNAi, resulting in downregulation of MyHC-I, MyHC-IIa, MyHC-IIb and MyHC-IIx expression. Glycolytic fibers (MyHC-IIb) are the most common among these four muscle fiber types. According to the MyHC conversion rules (25–27), MyHC-I primarily transforms into MyHC-IIa. Additional studies are required to confirm the findings of the present study, in part owing to the complexity of MyHC conversion due to overlapping signaling pathways. Additionally, the MyHC isoforms that play a key role in the regulation of fast fibers may play a less important role in the regulation of slow fibers under certain physiological conditions. Although MyHC-I expression was also found to be decreased in the present study, other isoforms may be able to convert MyHCs. Future studies are required to elucidate these isoforms and their roles in the mechanism of MyHC conversion.

In conclusion, the findings of the present study indicate that mouse CFL2 may regulate MyHC. In addition, the expression of four MyHC isoforms in undifferentiated cells with CFL2 RNAi was found to be significantly decreased compared with that in differentiated cells. However, further investigations on the exact association of CFL2 with signaling pathway-related factors are required to fully elucidate the role of CFL2 in the regulation of MyHC.

Acknowledgments

The present study was supported by the National Natural Science Foundations of China (grant no. 31272415/C170102), the Natural Science Foundations of Liaoning Province (grant no. 2015020765) and the Training Programs of Innovation and Entrepreneurship for Undergraduates of Liaoning Province (grant no. 201610160051).

References

1 

Chhabra D and dos Remedios CG: Cofilin, actin and their complex observed in vivo using fluorescence resonance energy transfer. Biophys J. 89:1902–1908. 2005. View Article : Google Scholar : PubMed/NCBI

2 

Papalouka V, Arvanitis DA, Vafiadaki E, Mavroidis M, Papadodima SA, Spiliopoulou CA, Kremastinos DT, Kranias EG and Sanoudou D: Muscle LIM protein interacts with cofilin 2 and regulates F-actin dynamics in cardiac and skeletal muscle. Mol Cell Biol. 29:6046–6058. 2009. View Article : Google Scholar : PubMed/NCBI

3 

Mohri K, Takano-Ohmuro H, Nakashima H, Hayakawa K, Endo T, Hanaoka K and Obinata T: Expression of cofilin isoforms during development of mouse striated muscles. J Muscle Res Cell Motil. 21:49–57. 2000. View Article : Google Scholar : PubMed/NCBI

4 

Gillett GT, Fox MF, Rowe PS, Casimir CM and Povey S: Mapping of human non-muscle type cofilin (CFL1) to chromosome 11q13 and muscle-type cofilin (CFL2) to chromosome 14. Ann Hum Genet. 60:201–211. 1996. View Article : Google Scholar : PubMed/NCBI

5 

Ono S and Ono K: Tropomyosin inhibits ADF/cofilin-dependent actin filament dynamics. J Cell Biol. 156:1065–1076. 2002. View Article : Google Scholar : PubMed/NCBI

6 

Asaduzzaman M, Kinoshita S, Siddique BS, Asakawa S and Watabe S: Multiple cis-elements in the 5′-flanking region of embryonic/larval fast-type of the myosin heavy chain gene of torafugu, MYH(M743-2), function in the transcriptional regulation of its expression. Gene. 489:41–54. 2011. View Article : Google Scholar : PubMed/NCBI

7 

Solomon MB, West RL and Carpenter JW: Fiber types in the longissimus muscle from water buffalo and selected domestic beef breeds. Meat Sci. 13:129–135. 1985. View Article : Google Scholar : PubMed/NCBI

8 

Kang YK, Choi YM, Lee SH, Choe JH, Hong KC and Kim BC: Effects of myosin heavy chain isoforms on meat quality, fatty acid composition, and sensory evaluation in Berkshire pigs. Meat Sci. 89:384–389. 2011. View Article : Google Scholar : PubMed/NCBI

9 

Zhao W, Su YH, Su RJ, Ba CF, Zeng RX and Song HJ: The full length cloning of a novel porcine gene CFL2b and its influence on the MyHC expression. Mol Biol Rep. 36:2191–2199. 2009. View Article : Google Scholar : PubMed/NCBI

10 

Röckl KS, Hirshman MF, Brandauer J, Fujii N, Witters LA and Goodyear LJ: Skeletal muscle adaptation to exercise training: AMP-activated protein kinase mediates muscle fiber type shift. Diabetes. 56:2062–2069. 2007. View Article : Google Scholar : PubMed/NCBI

11 

Miranda L, Carpentier S, Platek A, Hussain N, Gueuning MA, Vertommen D, Ozkan Y, Sid B, Hue L, Courtoy PJ, et al: AMP-activated protein kinase induces actin cytoskeleton reorganization in epithelial cells. Biochem Biophys Res Commun. 396:656–661. 2010. View Article : Google Scholar : PubMed/NCBI

12 

Long YC, Widegren U and Zierath JR: Exercise-induced mitogen-activated protein kinase signalling in skeletal muscle. Proc Nutr Soc. 63:227–232. 2004. View Article : Google Scholar : PubMed/NCBI

13 

Madak-Erdogan Z, Ventrella R, Petry L and Katzenellenbogen BS: Novel roles for ERK5 and cofilin as critical mediators linking ERα-driven transcription, actin reorganization, and invasiveness in breast cancer. Mol Cancer Res. 12:714–727. 2014. View Article : Google Scholar : PubMed/NCBI

14 

Won KJ, Park SH, Park T, Lee CK, Lee HM, Choi WS, Kim SJ, Park PJ, Jang HK, Kim SH, et al: Cofilin phosphorylation mediates proliferation in response to platelet-derived growth factor-BB in rat aortic smooth muscle cells. J Pharmacol Sci. 108:372–379. 2008. View Article : Google Scholar : PubMed/NCBI

15 

Yang SH, Sharrocks AD and Whitmarsh AJ: MAP kinase signalling cascades and transcriptional regulation. Gene. 513:1–13. 2013. View Article : Google Scholar

16 

Meissner JD, Chang KC, Kubis HP, Nebreda AR, Gros G and Scheibe RJ: The p38alpha/beta mitogen-activated protein kinases mediate recruitment of CREB-binding protein to preserve fast myosin heavy chain IId/x gene activity in myotubes. J Biol Chem. 282:7265–7275. 2007. View Article : Google Scholar : PubMed/NCBI

17 

Al Madhoun AS, Mehta V, Li G, Figeys D, Wiper-Bergeron N and Skerjanc IS: Skeletal myosin light chain kinase regulates skeletal myogenesis by phosphorylation of MEF2C. EMBO J. 30:2477–2489. 2011. View Article : Google Scholar : PubMed/NCBI

18 

Lu J, McKinsey TA, Nicol RL and Olson EN: Signal-dependent activation of the MEF2 transcription factor by dissociation from histone deacetylases. Proc Natl Acad Sci USA. 97:4070–4075. 2000. View Article : Google Scholar : PubMed/NCBI

19 

Wright DC, Hucker KA, Holloszy JO and Han DH: Ca2+ and AMPK both mediate stimulation of glucose transport by muscle contractions. Diabetes. 53:330–335. 2004. View Article : Google Scholar : PubMed/NCBI

20 

Reynolds A, Leake D, Boese Q, Scaringe S, Marshall WS and Khvorova A: Rational siRNA design for RNA interference. Nat Biotechnol. 22:326–330. 2004. View Article : Google Scholar : PubMed/NCBI

21 

Delling U, Tureckova J, Lim HW, De Windt LJ, Rotwein P and Molkentin JD: A calcineurin-NFATc3-dependent pathway regulates skeletal muscle differentiation and slow myosin heavy-chain expression. Mol Cell Biol. 20:6600–6611. 2000. View Article : Google Scholar : PubMed/NCBI

22 

Kramer HF and Goodyear LJ: Exercise, MAPK, and NF-kappaB signaling in skeletal muscle. J Appl Physiol (1985). 103:388–395. 2007. View Article : Google Scholar

23 

Shi H, Scheffler JM, Pleitner JM, Zeng C, Park S, Hannon KM, Grant AL and Gerrard DE: Modulation of skeletal muscle fiber type by mitogen-activated protein kinase signaling. FASEB J. 22:2990–3000. 2008. View Article : Google Scholar : PubMed/NCBI

24 

Bassel-Duby R and Olson EN: Signaling pathways in skeletal muscle remodeling. Annu Rev Biochem. 75:19–37. 2006. View Article : Google Scholar : PubMed/NCBI

25 

Weiss A, McDonough D, Wertman B, Acakpo-Satchivi L, Montgomery K, Kucherlapati R, Leinwand L and Krauter K: Organization of human and mouse skeletal myosin heavy chain gene clusters is highly conserved. Proc Natl Acad Sci USA. 96:2958–2963. 1999. View Article : Google Scholar : PubMed/NCBI

26 

Whitmer JD, Koslovsky JS, Bähler M and Mercer JA: Chromosomal location of three unconventional myosin heavy chain genes in the mouse. Genomics. 38:235–237. 1996. View Article : Google Scholar : PubMed/NCBI

27 

Knotts S, Rindt H, Neumann J and Robbins J: In vivo regulation of the mouse beta myosin heavy chain gene. J Biol Chem. 269:31275–31282. 1994.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhu H, Yang H, Zhao S, Zhang J, Liu D, Tian Y, Shen Z and Su Y: Role of the cofilin 2 gene in regulating the myosin heavy chain genes in mouse myoblast C2C12 cells. Int J Mol Med 41: 1096-1102, 2018.
APA
Zhu, H., Yang, H., Zhao, S., Zhang, J., Liu, D., Tian, Y. ... Su, Y. (2018). Role of the cofilin 2 gene in regulating the myosin heavy chain genes in mouse myoblast C2C12 cells. International Journal of Molecular Medicine, 41, 1096-1102. https://doi.org/10.3892/ijmm.2017.3272
MLA
Zhu, H., Yang, H., Zhao, S., Zhang, J., Liu, D., Tian, Y., Shen, Z., Su, Y."Role of the cofilin 2 gene in regulating the myosin heavy chain genes in mouse myoblast C2C12 cells". International Journal of Molecular Medicine 41.2 (2018): 1096-1102.
Chicago
Zhu, H., Yang, H., Zhao, S., Zhang, J., Liu, D., Tian, Y., Shen, Z., Su, Y."Role of the cofilin 2 gene in regulating the myosin heavy chain genes in mouse myoblast C2C12 cells". International Journal of Molecular Medicine 41, no. 2 (2018): 1096-1102. https://doi.org/10.3892/ijmm.2017.3272
Copy and paste a formatted citation
x
Spandidos Publications style
Zhu H, Yang H, Zhao S, Zhang J, Liu D, Tian Y, Shen Z and Su Y: Role of the cofilin 2 gene in regulating the myosin heavy chain genes in mouse myoblast C2C12 cells. Int J Mol Med 41: 1096-1102, 2018.
APA
Zhu, H., Yang, H., Zhao, S., Zhang, J., Liu, D., Tian, Y. ... Su, Y. (2018). Role of the cofilin 2 gene in regulating the myosin heavy chain genes in mouse myoblast C2C12 cells. International Journal of Molecular Medicine, 41, 1096-1102. https://doi.org/10.3892/ijmm.2017.3272
MLA
Zhu, H., Yang, H., Zhao, S., Zhang, J., Liu, D., Tian, Y., Shen, Z., Su, Y."Role of the cofilin 2 gene in regulating the myosin heavy chain genes in mouse myoblast C2C12 cells". International Journal of Molecular Medicine 41.2 (2018): 1096-1102.
Chicago
Zhu, H., Yang, H., Zhao, S., Zhang, J., Liu, D., Tian, Y., Shen, Z., Su, Y."Role of the cofilin 2 gene in regulating the myosin heavy chain genes in mouse myoblast C2C12 cells". International Journal of Molecular Medicine 41, no. 2 (2018): 1096-1102. https://doi.org/10.3892/ijmm.2017.3272
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team