Role of inhibitor of growth 4 in the suppression of human melanoma cells through the Fas/FasL-mediated apoptosis pathway
- Authors:
- Published online on: November 20, 2017 https://doi.org/10.3892/ijmm.2017.3274
- Pages: 1055-1061
Abstract
Introduction
Melanoma is one of the most lethal forms of skin tumors, responsible for >80% of all diagnosed skin cancer-related mortalities (1). Melanoma is a serious public health problem in all countries throughout the world due to its unfavorable prognosis and the limited treatments available (2). Despite advances in melanoma treatment, with several novel targeted therapies, as a result of the special characteristics and usual resistance to standard chemotherapy, there is no systemic and effective therapy that has a clear effect on the overall survival of patients with malignant melanoma (3). Although our understanding of the molecular biology of malignant melanoma has increased in recent years, the molecular mechanism of melanomagenesis is not completely understood.
Melanoma cells are highly resistant to traditional chemotherapeutic and radiotherapeutic treatments (4). Immunotherapies (involving cancer vaccines, adoptive immunotherapy, antibodies and cytokines) focus on alternative therapies (5). The challenge is to translate successful results from immune modulation trials into clinical meaningful results in phase 2 or randomized phase 3 drug trials (6). Combining cancer vaccines with the adoptive transfer of T cells has been shown to increase the levels of circulating tumor antigen-specific regulatory T cells in patients, however, these approaches produce only a few patient's clinical responses (7). These observations in melanoma support the fact that tumor resistance to immune system-mediated destruction may be the main process in the tumor microenvironment (7). To improve the concepts of immune-based treatments, a better understanding of the local and systemic tumor-resistance mechanisms is important in melanoma patients.
The five members of the inhibitor of growth (ING) gene family are ING1, ING2, ING3, ING4 and ING5. The ING family have garnered attention due to their putative roles as tumor suppressor genes (8,9). ING4 is a member of the ING family that has been demonstrated to play important roles in numerous cancer-related cellular processes including DNA damage, hypoxia, cell proliferation, apoptosis, the cell cycle, migration and angiogenesis (8). ING4 is located in chromosome 12p13 and encodes a 249-amino acid protein containing a conserved C-terminal plant homeodomain finger motif and two nuclear localization signals (10). ING4 expression is reduced in primary melanomas and metastatic melanomas (11). Upregulation of ING4 has been shown to decrease the cell population in S phase, diminish the colony forming efficiency and induce apoptosis in a p53-dependent manner (10,11). However, the precise role of ING4 in melanoma angiogenesis is unclear.
The Fas death receptor/Fas ligand (Fas/FasL) system is a key regulator of apoptosis (12). The Fas/FasL system, one of the major extrinsic apoptosis signaling pathways, is a key regulator of T-cell apoptosis (13). The Fas/FasL-induced apoptotic pathway is active in early- and intermediate-phase melanomas, but is often impaired in highly metastatic melanomas (14). The lack expression of Fas is correlated with the poor prognosis of malignant melanomas (15). Recent findings revealed that the Fas expression was downregulated and FasL expression was upregulated during melanoma progression (16).
The present study sought to investigate the impact of ING4 on malignant melanoma cells. Firstly, lentivirus (LV)-ING4-short hairpin (shRNA) or LV-ING4 were transfected into human melanoma A375 cells. Next, the effects of ING4 overexpressed or knockdown were determined on the apoptosis of A375 cells and CD3+ T cells. The study aimed to reveal the potential effects of ING4 in the regulation of the apoptosis pathway in A375 cells and CD3+ T cells. The study also aimed to demonstrate that ING4 can serve as a target for gene therapy in human melanoma cells.
Materials and methods
Cell and culture
The human melanoma A375 cell line, obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA), was cultured in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA), supplemented with 10% fetal bovine serum (MinHai Bio-Engineering, Co., Ltd., Lanzhou, China) and 1% penicillin-streptomycin (Invitrogen; Thermo Fisher Scientific, Inc.) in a humidified atmosphere at 37°C, in the presence of 5% CO2 and 95% air. After selection of infected A375 cells, the CD3+ T cells were co-cultured with A375 cells in WT, LV-control, LV-ING4-shRNA and LV-ING4 groups separately.
Construction of overexpression or knockdown ING4 vectors in A375 cells
pcDNA3.1-ING4 was constructed as described previously (17). Lentiviral vector (pLKO.1) constructs containing ING4 cDNA or shRNA sequences for ING4 and an empty vector were purchased from Open Biosystems; GE Healthcare Dharmacon, Inc. (Lafayette, CO, USA). Lentiviral constructs were used to transiently transfect 293FT packaging cells along with 3 µg VSV-G pseudoviral particles. At 16 h post-transduction, the supernatant was replaced by Opti-MEM medium supplemented with HEPES (Invitrogen; Thermo Fisher Scientific, Inc.). Viral supernatant was harvested from the 293FT cells at 48 h post-transfection and filtered to remove non-adherent cells. Subconfluent A375 cells were infected by centrifugation at 300 × g for 5 min at 4°C using virus-containing medium and 8 µg/ml polybrene. Infected A375 cells were selected for using 2 µg/ml puromycin starting at 24 h after the initial infection. The cells were identified at the protein levels using western blot analysis.
Preparation of CD3+ T cells
Peripheral blood mononuclear cells (PBMCs) were isolated from the peripheral blood of healthy donors using Ficoll density gradient centrifugation at 300 × g for 10 min at 20°C. Activation and expansion of anti-CD3 T cells from PBMCs at 14 days post-centrifugation was performed as previously described (18). CD3+ T-cell expansion resulted in a product increase of 98.85±1.06% on day 15. CD3+ T cells were cultured in RPMI-1640 containing 10% fetal calf serum (Invitrogen; Thermo Fisher Scientific, Inc.). The research protocol was approved by the Biomedical Research Ethics Committee of the First Affiliated Hospital of Harbin Medical University (2014-R-034).
Analysis of apoptosis with Annexin V/7-aminoactinomycin D (7-AAD) staining
Annexin V-fluorescein isothiocyanate (FITC) and 7-AAD (BD Biosciences, San Jose, CA, USA) were used for detection of apoptotic cells in the melanoma A375 cells and CD3+ T cells, according to the manufacturer's protocols, and then analyzed by a dual-staining protocol with fluorescence-activated cell sorting using FACScan (BD Biosciences, Franklin Lakes, NJ, USA). Cell populations (1×106) were labeled with Annexin V and 7-AAD (BD Biosciences) following the provider's procedure, and analyzed by flow cytometry.
In vivo model
A total of 20 BALB/c nude mice were purchased from the Shanghai Laboratory Animal Center (Shanghai, China). Mice were allowed free access to sterilized water and food, and were housed in individual ventilated cages at 23±5°C under a 12-h light/dark cycle. The A375 cells were resuspended in serum-free DMEM at a concentration of 1×107 cells/ml. A total volume of 0.2 ml cell suspension (total 2×106 cells) was then injected subcutaneously into the right anterior armpit of nude mice to establish a xenograft model. The 20 injected mice were randomly divided into 4 groups: WT, LV-control, LV-ING4-shRNA and LV-ING4 (n=5 per group). The experimental protocol was approved by the Animal Care and Use Committee of the First Affiliated Hospital of Harbin Medical University.
Western blot analysis
Melanoma A375 cells or CD3+ T cells were lysed in buffer containing 150 mmol/l NaCl, 1% NP-40, 50 mmol/l Tris (pH 8.0) and 20% glycerol, and normalized to total protein concentration using Bio-Rad protein assay reagent (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Whole cell proteins (30 µg) were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to PVDF membranes using the Bio-Rad electro-transfer system (Bio-Rad Laboratories, Inc.). The filters were hybridized with ING4 (sc-135742), poly(ADP-ribose) polymerase (PARP; sc-136208), caspase-8 (sc-6136), caspase-3 (sc-271759), Fas (sc-4856) and FasL (sc-71096) (all 1:1,000 dilution; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) for 1 h at room temperature. Anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH; 1:1,000 dilution; sc-47724; Santa Cruz Biotechnology, Inc.) was used as a loading control. The membrane was blocked by 5% fat-free milk for 1 h at room temperature and then incubated with the appropriate primary antibody diluted in 3% BSA solution at 4°C overnight. After incubation with DyLight dye-conjugated secondary antibodies (cat. no. 35518; 1:10,000; Thermo Fisher Scientific, Inc.) for 1 h at room temperature, blots were scanned by the Odyssey Western Detection system (LI-COR Biosciences, Lincoln, NE USA), followed by quantification with ImageStudio software (LI-COR Biosciences).
Immunohistochemistry
Immunohistochemistry (IHC) was performed as described previously (19). Fine sections (4–5 µm) were prepared from formalin-fixed tissue sections on poly-L-lysine coated glass slides, and then stained with anti-PARP, -caspase-8, -caspase-3, -Fas and -FasL by IHC. Sections were evaluated and scored independently by an experienced pathologist unaware of the treatment group. At least 5 fields per slide were randomly chosen for analysis of IHC. The IHC was evaluated according to the intensity of reactivity using a 4-tier system: 0, no staining (-); 1, weak staining (+); 2, moderate staining (++); and 3, strong staining (+++).
RNA extraction and RT-qPCR
Total RNA was extracted by using the TRIzol reagent (Life Technologies, Carlsbad, CA, USA) according to the manufacturer's instructions. RNA was reverse transcribed into cDNA using the PrimeScript II 1st strand cDNA Synthesis kit (Takara, Shiga, Japan). qPCR was performed on an ABI Step-One plus machine using SYBR-Green qPCR Master Mix (Biotool, Jupiter, FL, USA). Primers used are as follows: ING4 forward, ATGACAGCTCTTCCAGCAA and reverse, AGAAACTGTGTTGGAATCCAAG; GAPDH forward, AATCCCATCACCATCTTCCA and reverse, TGGACTCCACGACGTACTCA. GAPDH was used as endogenous control and 2−ΔΔCt method was used to calculate the fold change.
Statistical analysis
All experiments were repeated at least three times, and data are expressed as the mean ± standard error of the mean. Comparisons among multiple groups were determined by one-way analysis of variance followed by Tukey's post-hoc test. Prism6 (GraphPad Software, Inc., La Jolla, CA, USA) was use to perform statistical analysis. P<0.05 was considered to indicate a statistically significant difference.
Results
Expression of ING4 in melanoma A375 cell transfectants
The expression of ING4 is 98% in dysplastic nevi, and then significantly decreased to 67 or 53% in primary melanomas and metastatic melanomas (11). After the wild-type, non-targeting lentiviral, ING4 lentiviral small hairpin RNA (LV-ING4-shRNA) and lentiviral pcDNA3.1-ING4 (LV-ING4) were transfected into A375 melanoma cell line, respectively, the expression of ING4 was evaluated by RT-PCR and western blot analysis. The overall knockdown efficiency of LV-ING4-shRNA was 80% (Fig. 1A) at the mRNA level and 70% at the protein levels (Fig. 1B and C). However, there was a significant increase in ING4 mRNA of 415% and protein of 275% in the A375/LV-ING4 group compared with the A375/LV-control (Fig. 1).
Overexpression of ING4 enhances apoptosis of melanoma A375 cells and CD3+ T cells
To examine the effect of ING4 on the A375 and T-cell co-culture system, CD3+ T cells were isolated from the blood samples of healthy donors. Flow cytometry analysis was performed to confirm the purity of CD3+ T cells from the A375 and CD3+ T-cell co-culture (Fig. 2).
Next, to determine whether the effect of ING4 in A375 melanoma cells to enhance the apoptosis of A375 cells or CD3+ T cells, the A375 cells were treated with wild-type, LV-control, LV-ING4-shRNA or LV-ING4, and then co-culture with CD3+ T cells at 48 h; double staining with Annexin V-FITC/PI was used to detect the cell apoptosis (Fig. 3). The percentage of early apoptotic cells (Annexin V-positive/7-AAD-negative) was 6.24±0.75% for the wild-type group, 6.02±1.52% for the LV-control group, 7.01±1.42% for the LV-ING4-shRNA group and 4.68±0.89% for the LV-ING4 group. In addition, the percentage of late apoptotic cells (Annexin V-positive/7-AAD -positive) was 5.76±1.37% for the wild-type group, 8.41±1.47% for the LV-control group, 5.98±1.21% for the LV-ING4-shRNA group and 54.37±6.13% for the LV-ING4 group (Fig. 3A).
Similar results were obtained with CD3+ T cells from the A375 and CD3+ T-cell co-culture system. As shown in Fig. 3B, the apoptosis of CD3+ T cells was significantly different in the A375 cells transfected with LV-ING4 (the early apoptotic cells, 16.47±2.63%; the late apoptotic cells, 43.20±4.96%) compared with that in the cells transfected with the LV-control (the early apoptotic cells, 6.21±0.87%; the late apoptotic cells, 7.76±1.49%); however, there was no significant difference compared with the LV-ING4-shRNA group in the A375 and CD3+ T cell co-culture system (Fig. 3B). These results suggest that increased ING4 expression in melanoma cells leads to increased lymphocyte apoptosis.
ING4 regulates the protein expression involved in the apoptosis pathway in CD3+ and melanoma A375 cells
In order to investigate the molecular mechanisms in the apoptosis of CD3+ and A375 melanoma cells, the effects of ING4 on the expression of target proteins involved in the apoptosis of CD3+ and melanoma A375 cells was investigated. The protein expression levels of PARP, caspase-8 and caspase-3, which were involved in cell apoptosis according to western blot analysis, were determined. The protein expression of Fas and FasL was also examined. The results showed that increased ING4 expression reduced the PARP, caspase-8 and caspase-3 levels, but significantly increased the Fas and FasL protein expression in the CD3+ T cells and the melanoma A375 cells (Fig. 4). The levels of PARP, caspase-8, caspase-3, Fas and FasL were also analyzed in nude mice livers by IHC. Higher expression of Fas and FasL, as well as lower expression of PARP, caspase-8 and caspase-3 was observed in the livers of the LV-ING4 group compared with other groups (Fig. 5).
Discussion
ING4, a novel member of the conserved ING family, has been identified as a critical tumor suppressor in various cancer types. Previous studies suggested that knockdown of ING4 gene expression or ING4 gene deletion was associated with the progression or poor prognosis of high-grade tumors, such as those in lung cancer (20,21), brain tumors (19,22,23) and those in ovarian cancer (24). In addition, previous findings have shown that ING4 expression is significantly reduced in human malignant melanomas, and that through regulating different signaling pathways, ING4 level is closely associated with the proliferation, apoptosis, invasion, metastasis and survival of malignant melanomas cells (11). Meanwhile, a previous study showed that ING4 could significantly reduce tumor cell growth via the regulation of cell cycle progression according to experiments where exogenous ING4 was transfected into a lung cancer cell line (17). We hypothesized that ING4 could play an inhibitory role by inducing cell apoptosis in human malignant melanomas. The present study was designed to elucidate the possible mechanisms of the ING4 expression involved in the induction of A375 cell apoptosis.
Apoptosis or programmed cell death consists of the ordered disassembly of the cell from within, as opposed to necrosis or accidental cell death (25). Cellular immunity plays an important role in the antitumor immune response. CD3+ T cells recognize peptides of exogenous antigens, which are presented by major histocompatibility complex class II molecules. Through the release of cytokines, CD3+ T cells activate natural killer cells, enhance the cytotoxicity of effector cells and increasing the sensitivity of cytotoxic T lymphocytes to target cells, and subsequently lyse tumor cells with perforin or by inducing cell apoptosis (26). To reveal the apoptotic effect of ING4 in melanoma A375 cells and CD3+ T cells, dual staining with Annexin V-FITC/7-AAD was used to measure cell apoptosis. It was found that ING4 overexpression could induce melanoma A375 cells and CD3+ T-cell apoptosis significantly (Fig. 3). Apoptosis may be induced through the extrinsic pathway (activation of cell surface death receptors) or the intrinsic pathway (alterations in the integrity of the mitochondrial membrane that induce the release of cytochrome c). These pathways converge at the level of the effector caspases (caspase-3, -6, -7 and -8) (27). Once activated, these effector caspases cleave cytoskeletal and nuclear proteins, including PARP, thereby initiating cellular disassembly (27). The present study demonstrated that PARP, caspase-8 and caspase-3 were decreased in response to overexpression of ING4 in melanoma cells (Figs. 4 and 5), thereby supporting the premise that cell death occurs in a manner consistent with apoptosis.
Cell death induced by Fas/FasL interaction results in apoptotic signaling in numerous different cell types (28). Fas, FasL and caspase-8 play important roles in the regulation of apoptosis induction (29). In the present study, the data showed that overexpression of ING4 markedly activated Fas and FasL proteins in melanoma cells and CD3+ T cells (Figs. 4 and 5).
Furthermore, the results suggested that overexpression of ING4 level enhances the apoptosis of A375 cells, which may contribute to a close association with Fas/FasL pathway activation (Figs. 4 and 5). To the best of our knowledge, this study shows that ING4 functions as a tumor suppressor protein in human melanomas. It validates the theory that ING4 can serve as a prognostic marker and a therapeutic target in human melanomas.
In conclusion, in the present study, vectors LV-ING4 and LV-ING4-shRNA were generated and the effect of overexpression of ING4 on the apoptosis of human melanoma A375 cells and CD3+ T cells was investigated. The results demonstrated that the high expression level of ING4 could significantly increase melanomas cell apoptosis via the Fas/FasL pathway activation, and also induce the apoptosis of CD3+ T cells. This indicates that ING4 gene therapy could be considered as a novel approach to treat human melanomas.
Acknowledgments
This study was supported by the National Natural Science Foundation of China (grant no. 81072234).
References
Siegel R, Ma J, Zou Z and Jemal A: Cancer statistics, 2014. CA Cancer J Clin. 64:9–29. 2014. View Article : Google Scholar : PubMed/NCBI | |
Rubin KM and Lawrence DP: Your patient with melanoma: Staging, prognosis, and treatment. Oncology (Williston Park). 23(Suppl 8): 13–21. 2009. | |
Grossman D and Altieri DC: Drug resistance in melanoma: Mechanisms, apoptosis, and new potential therapeutic targets. Cancer Metastasis Rev. 20:3–11. 2001. View Article : Google Scholar | |
La Porta CA: Mechanism of drug sensitivity and resistance in melanoma. Curr Cancer Drug Targets. 9:391–397. 2009. View Article : Google Scholar : PubMed/NCBI | |
Alexandrescu DT, Ichim TE, Riordan NH, Marincola FM, Di Nardo A, Kabigting FD and Dasanu CA: Immunotherapy for melanoma: current status and perspectives. J Immunother. 33:570–590. 2010. View Article : Google Scholar : PubMed/NCBI | |
Korn EL, Liu P-Y, Lee SJ, Chapman JA, Niedzwiecki D, Suman VJ, Moon J, Sondak VK, Atkins MB, Eisenhauer EA, et al: Meta-analysis of phase II cooperative group trials in metastatic stage IV melanoma to determine progression-free and overall survival benchmarks for future phase II trials. J Clin Oncol. 26:527–534. 2008. View Article : Google Scholar : PubMed/NCBI | |
Gajewski TF: Identifying and overcoming immune resistance mechanisms in the melanoma tumor microenvironment. Clin Cancer Res. 12:2326s–2330s. 2006. View Article : Google Scholar : PubMed/NCBI | |
Coles AH and Jones SN: The ING gene family in the regulation of cell growth and tumorigenesis. J Cell Physiol. 218:45–57. 2009. View Article : Google Scholar | |
Gunduz M, Gunduz E, Rivera RS and Nagatsuka H: The inhibitor of growth (ING) gene family: Potential role in cancer therapy. Curr Cancer Drug Targets. 8:275–284. 2008. View Article : Google Scholar : PubMed/NCBI | |
Shiseki M, Nagashima M, Pedeux RM, Kitahama-Shiseki M, Miura K, Okamura S, Onogi H, Higashimoto Y, Appella E, Yokota J, et al: p29ING4 and p28ING5 bind to p53 and p300, and enhance p53 activity. Cancer Res. 63:2373–2378. 2003.PubMed/NCBI | |
Li J, Martinka M and Li G: Role of ING4 in human melanoma cell migration, invasion and patient survival. Carcinogenesis. 29:1373–1379. 2008. View Article : Google Scholar : PubMed/NCBI | |
Friesen C, Herr I, Krammer PH and Debatin K-M: Involvement of the CD95 (APO-1/FAS) receptor/ligand system in drug-induced apoptosis in leukemia cells. Nat Med. 2:574–577. 1996. View Article : Google Scholar : PubMed/NCBI | |
Hahne M, Rimoldi D, Schröter M, Romero P, Schreier M, French LE, Schneider P, Bornand T, Fontana A, Lienard D, et al: Melanoma cell expression of Fas(Apo-1/CD95) ligand: Implications for tumor immune escape. Science. 274:1363–1366. 1996. View Article : Google Scholar : PubMed/NCBI | |
Bullani RR, Wehrli P, Viard-Leveugle I, Rimoldi D, Cerottini JC, Saurat JH, Tschopp J and French LE: Frequent downregulation of Fas (CD95) expression and function in melanoma. Melanoma Res. 12:263–270. 2002. View Article : Google Scholar : PubMed/NCBI | |
Helmbach H, Rossmann E, Kern MA and Schadendorf D: Drug-resistance in human melanoma. Int J Cancer. 93:617–622. 2001. View Article : Google Scholar : PubMed/NCBI | |
Ekmekcioglu S, Okcu MF, Colome-Grimmer MI, Owen-Schaub L, Buzaid AC and Grimm EA: Differential increase of Fas ligand expression on metastatic and thin or thick primary melanoma cells compared with interleukin-10. Melanoma Res. 9:261–272. 1999. View Article : Google Scholar : PubMed/NCBI | |
Li X, Cai L, Liang M, Wang Y, Yang J and Zhao Y: ING4 induces cell growth inhibition in human lung adenocarcinoma A549 cells by means of Wnt-1/β-catenin signaling pathway. Anat Rec (Hoboken). 291:593–600. 2008. View Article : Google Scholar | |
Clay TM, Custer MC, Sachs J, Hwu P, Rosenberg SA and Nishimura MI: Efficient transfer of a tumor antigen-reactive TCR to human peripheral blood lymphocytes confers anti-tumor reactivity. J Immunol. 163:507–513. 1999.PubMed/NCBI | |
Li X, Cai L, Chen H, Zhang Q, Zhang S, Wang Y, Dong Y, Cheng H and Qi J: Inhibitor of growth 4 induces growth suppression and apoptosis in glioma U87MG. Pathobiology. 76:181–192. 2009. View Article : Google Scholar : PubMed/NCBI | |
Wang QS, Li M, Zhang LY, Jin Y, Tong DD, Yu Y, Bai J, Huang Q, Liu FL, Liu A, et al: Downregulation of ING4 is associated with initiation and progression of lung cancer. Histopathology. 57:271–281. 2010. View Article : Google Scholar : PubMed/NCBI | |
Li X, Zhang Q, Cai L, Wang Y, Wang Q, Huang X, Fu S, Bai J, Liu J, Zhang G, et al: Inhibitor of growth 4 induces apoptosis in human lung adenocarcinoma cell line A549 via Bcl-2 family proteins and mitochondria apoptosis pathway. J Cancer Res Clin Oncol. 135:829–835. 2009. View Article : Google Scholar | |
Garkavtsev I, Kozin SV, Chernova O, Xu L, Winkler F, Brown E, Barnett GH and Jain RK: The candidate tumour suppressor protein ING4 regulates brain tumour growth and angiogenesis. Nature. 428:328–332. 2004. View Article : Google Scholar : PubMed/NCBI | |
Shen JC, Unoki M, Ythier D, Duperray A, Varticovski L, Kumamoto K, Pedeux R and Harris CC: Inhibitor of growth 4 suppresses cell spreading and cell migration by interacting with a novel binding partner, liprin α1. Cancer Res. 67:2552–2558. 2007. View Article : Google Scholar : PubMed/NCBI | |
Liu Y, Yu L, Wang Y, Zhang Y, Wang Y and Zhang G: Expression of tumor suppressor gene ING4 in ovarian carcinoma is correlated with microvessel density. J Cancer Res Clin Oncol. 138:647–655. 2012. View Article : Google Scholar : PubMed/NCBI | |
Chan FK-M, Luz NF and Moriwaki K: Programmed necrosis in the cross talk of cell death and inflammation. Annu Rev Immunol. 33:79–106. 2015. View Article : Google Scholar : | |
Chen G and Emens LA: Chemoimmunotherapy: Reengineering tumor immunity. Cancer Immunol Immunother. 62:203–216. 2013. View Article : Google Scholar : PubMed/NCBI | |
Fulda S and Debatin KM: Extrinsic versus intrinsic apoptosis pathways in anticancer chemotherapy. Oncogene. 25:4798–4811. 2006. View Article : Google Scholar : PubMed/NCBI | |
Hohlbaum AM, Moe S and Marshak-Rothstein A: Opposing effects of transmembrane and soluble Fas ligand expression on inflammation and tumor cell survival. J Exp Med. 191:1209–1220. 2000. View Article : Google Scholar : PubMed/NCBI | |
Nagata S and Golstein P: The Fas death factor. Science. 267:1449–1456. 1995. View Article : Google Scholar : PubMed/NCBI |