Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
April-2018 Volume 41 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2018 Volume 41 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

miR‑186, a serum microRNA, induces endothelial cell apoptosis by targeting SMAD6 in Kawasaki disease

  • Authors:
    • Rongzhou Wu
    • Danping Shen
    • Hareshwaree Sohun
    • Donghui Ge
    • Xianda Chen
    • Xuliang Wang
    • Ruiyao Chen
    • Yuqing Wu
    • Jingjing Zeng
    • Xing Rong
    • Xiaoping Su
    • Maoping Chu
  • View Affiliations / Copyright

    Affiliations: Children's Heart Center, Institute of Cardiovascular Development and Translational Medicine, The Second Affiliated Hospital & Yuying Children's Hospital of Wenzhou Medical University, Wenzhou, Zhejiang 325027, P.R. China, Wenzhou Medical University, Wenzhou, Zhejiang 325035, P.R. China
    Copyright: © Wu et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 1899-1908
    |
    Published online on: January 18, 2018
       https://doi.org/10.3892/ijmm.2018.3397
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Kawasaki disease (KD) is an acute, self‑limited vasculitis that predominantly affects medium‑sized arteries, particularly the coronary arteries. Recent studies have indicated that microRNAs are involved in many diseases, including KD. However, the detailed mechanism remains unclear. The aim of the present study was to explore the role of miR‑186 in KD and potentially discover a new target for KD treatment. The results demonstrated that miR‑186 was upregulated in serum from patients with KD and KD serum could increase miR‑186 transcript levels in endothelial cells (HUVECs). Overexpression of miR‑186 mimic induced HUVEC apoptosis through mitogen‑activated protein kinase (MAPK) activation by targeting and inhibiting SMAD family member 6 (SMAD6). Furthermore, KD serum induced HUVEC apoptosis through miR‑186. In conclusion, the present results suggested that KD serum‑associated miR‑186 has an essential role in endothelial cell apoptosis by activating the MAPK pathway through targeting the SMAD6 gene.

Introduction

Kawasaki disease (KD) is an acute, systemic vasculitis that is the leading cause of acquired heart disease in children in the developed world (1). Vascular inflammation ultimately leads to coronary artery abnormalities (CAA), including aneurysm, myocardial fibrosis, and aortic root dilatation (2,3). Within the first 10 days after onset of fever, CAA develops in 25% of untreated patients and in 3–5% of patients treated with intravenous immunoglobulin (IVIG) (4). Histological examination of tissues from KD autopsies revealed significant vascular lesions. Regressive changes, such as degeneration, desquamation or necrosis, were observed in the endothelial cells of the damaged artery (5). Endothelial cell injuries appear to cause edematous and inflammatory cell infiltration in the subendothelial space, which eventually leads to coronary artery anomalies (6,7). A follow-up study of KD demonstrated that a subset of patients had persistent endothelial injury many years following KD, both with and without CAA (8). Much effort has been spent on the study of the biological mechanism of KD, and the clinical events of arteritis are well-characterized (9). However, the molecular mechanisms underlying the development of KD remain poorly understood.

MicroRNAs (miRNAs) are a class of endogenous, small, noncoding RNAs that control gene expression either by inducing transcript degradation or by blocking translation (10). Recently, miRNAs have been reported to be present in human plasma in a remarkably stable form, and to be involved in the regulation of diverse developmental and pathological processes (11,12). Previous studies have demonstrated that miRNAs act as new promising diagnostic and prognostic biomarkers for various diseases, including KD. Yun et al (13) and Shimizu et al (14) demonstrated that miRNAs were significantly upregulated in the sera or peripheral blood of patients with KD compared with healthy controls. They concluded that the possible pathways of these miRNAs predominantly involved inflammatory responses and the transforming growth factor (TGF)-β pathway. Rowley et al (15) used a custom quantitative nuclease protection assay to reveal a set of miRNAs that appear to be dysregulated in KD coronary arteries. Rong et al (16) reported that miR-92a had a relatively high degree of sensitivity and specificity in predicting the incidence of coronary artery disease. It is worth mentioning that He et al (17) demonstrated that the Kruppel-like factor 4/miR-483/connective tissue growth factor pathway may be useful in the evaluation of the pro-inflammatory and pro-endothelial-to-mesenchymal transition status of KD patients. Recently, Chu et al (18) determined the role of blood miR-223 in KD and KD-induced injuries in vascular endothelial cells, as well as the mechanisms involved.

In our previous study, differentially expressed miRNAs were profiled in KD serum (18). The results of the previous study demonstrated that miR-186 is among the highly expressed miRNAs in the serum of a patient with KD. Recent studies on miR-186 have focused on its role in carcinogenesis, by regulating cell proliferation, apoptosis and metastasis (19,20). However, very little is known about the role and underlying mechanism of miR-186 in KD. In the present study, miR-186 was demonstrated to be enriched in acute KD serum compared with healthy controls and febrile controls, and its expression was decreased to normal levels in serum from convalescent KD (3 weeks following fever onset). Overexpression of miR-186 mimic promoted apoptosis in human umbilical vein endothelial cells (HUVECs). Furthermore, miR-186 overex-pression promoted mitogen-activated protein kinase (MAPK) activation in HUVECs by targeting and inhibiting SMAD family member 6 (SMAD6). By contrast, miR-186 inhibitor limited the effect of KD serum on HUVEC apoptosis. The present results suggested that miR-186 present in KD serum may act as a treatment target for the disease.

Materials and methods

Subjects

The demographic and clinical characteristics of the subjects involved in the present study are presented in Table I. All patients diagnosed with KD had fever for at least three days and met at least four of the five clinical criteria for KD (rash, conjunctival injection, cervical lymphadenopathy, oral mucosal changes, and changes in the extremities), or three of the five criteria along with coronary artery abnormalities documented by echocardiogram (21). Patients diagnosed with acute upper respiratory infection and herpangina, which mimic many of the clinical and laboratory findings in acute KD, were prospectively enrolled as febrile control subjects. In the present study, the sera of 21 acute KD children, 25 healthy controls, 17 febrile children and 11 convalescent KD children were collected from the second affiliated Hospital of WenZhou Medical University (WenZhou, China) between May 2014 and May 2016. All serum samples were stored at −80°C until usage. The study protocol was approved by The Second Affiliated Hospital of WenZhou Medical University Ethical Committee.

Table I

Characteristics of the clinical index independent validation cohort in different groups.

Table I

Characteristics of the clinical index independent validation cohort in different groups.

GroupsHealthy controlFebrile childrenConvalescent KDAcute KD
Number25171121
Male17 (68%)10 (59%)6 (55%)16 (76%)
Female8 (32%)7 (41%)5 (45%)5 (24%)
Age (months)50.4±28.3549.27±32.7830.68±27.1832.95±16.18
WBC (×109/l)7.98±2.4710.86±6.048.78±3.1816.16±6.33
PLT (×109)331.24±76.75262.4±68.1529.18±212.96378.47±102.88
CRP (mg/l)md20.85±18.043.95±2.9478.61±57.41
ALT (U/l)16.11±9.6215.47±7.95100.1±131.687.13±116.15
AST (U/l)33.33±9.833.4±10.7447.9±21.8337.5±43.4
NT-proBNP (pg/ml)mdmd179.73±133.41,657.2±3,268
D-dimmer (μg/ml)mdmd0.9±0.461.41±0.86

[i] KD, Kawasaki disease; WBC, white blood cell; PLT, platelet; ALT, glutamic pyruvic transaminase; AST, glutamic oxaloacetic transaminase; NT-proBNP, N-terminal pro natriuretic peptide type B; md, missing data.

Cell culture and treatment

Human umbilical vein endothelial cells (HUVECs) were purchased from American Type Culture Collection (Manassas, VA, USA) and cultured in Roswell Park Memorial Institute 1640 medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% (vol/vol) fetal bovine serum (FBS; Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). Cells were maintained at 37°C in a humidified atmosphere with 5% CO2. HUVECs were transiently transfected with miR-186 mimics, miR-186 inhibitors or negative control oligonucleotides using Lipofectamine 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's instructions. RNA oligos were chemically synthesized and purified by Ribo Bio Co., Ltd. (Guangzhou, China). The sequence of human miR-186 mimic was 5′-CAAAGAAUUCUCCUUUUGGGC U-3′. The sequence of the human miR-186 inhibitor was 5′-GUUUCUUAAGAGGAAAACCCGA-3′. The negative control oligonucleotide for the miRNA mimic was 5′-UUUGUACUACACAAAAGUACUG-3′. Cells were treated for the indicated time with TGF-β1 (5 ng/ml) after 24 h of transfection with miR-186 mimic (10 ng/ml). In other experiments, cells were treated for 24 h with healthy control serum, KD serum alone, or KD serum with miR-186 inhibitor (30 ng/ml).

RNA isolation and reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was isolated from 200 μl serum specimen or cells using TRIzol reagent (Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. The extracted RNA was reverse transcribed into cDNA using ReverTra Ace qPCR RT kit (Toyobo Co., Ltd., Osaka, Japan). qPCR was performed using Power SYBR-Green PCR Master Mix (Thermo Fisher Scientific, Inc.) on an Bio-Rad CFX 96 Real-Time PCR System (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Briefly, samples were incubated at 95°C for 10 min for an initial denaturation, followed by 40 PCR cycles of at 95°C for 15 sec and then 60°C for 1 min. The specificity of SYBR Green based PCR reaction was validated by post-amplification melting curve analysis. For cell samples, U6 was used as an internal control for miRNA template normalization and GADPH was used for other template normalizations. For serum samples, the internal control was a spiked-in control (cel-miR-39). Fluorescent signals were normalized to the internal reference, and the threshold cycle was set within the exponential phase of the PCR. miRNA and mRNA expression levels were determined using the 2−ΔΔCT method (22). The RT primer and forward and reverse primer pairs for miR-186 were designed by Generay Biotech Co., Ltd. (Shanghai, China). Primer sequences are listed in Table II.

Table II

Primers used in the present study.

Table II

Primers used in the present study.

NamePrimer sequence (5′-3′)
U6 RT AACGCTTCACGAATTTGCGT
U6 F CTCGCTTCGGCAGCACA
U6 R GTGCAGGGTCCGAGGT
GAPDH F AACTCTGGTAAAGTGGATATTG
GAPDH R GGTGGAATCATATTGGAACA
Cel-miR-39 RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAAGCT
Cel-miR-39 F GCCGCTCACCGGGTGTAAATC
Cel-miR-39 R GTGCAGGGTCCGAGGT
SMAD6 F CTGGAGTTGTTGAGCAGCC
SMAD6 R GTGCGTCTTTCTTGTTTTGTCC
SMAD6(Luci)WT F AAACTAGTGCACTTTGGCTTATAATTCTTTCAATACAG
SMAD6(Luci)WT R GGAAGCTTCAAACCCAGGCTTTTCCACC
SMAD6(Luci)Mut F AAACTAGTGCACTTTGGCTTATATAAGAATCAATACAG
SMAD6(Luci)Mut R GGAAGCTTCAAACCCAGGCTTT TCCACC
miR-186 RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGCCCA
miR-186 F GCCGCCAAAGAATTCTCCTTT
miR-186 R GTGCAGGGTCCGAGGT

[i] RT, reverse transcription; F, forward primer; R, reverse primer; SMAD6, SMAD family member 6; Luci, luciferase reporter; WT, wild-type; Mut, mutation; cel-miR-39, Caenorhabditis elegans miR-39.

Western blotting

The cells were lysed with RIPA buffer containing protease and phosphatase inhibitors (complete ULTRA tablets; Roche Molecular Diagnostics, Branchburg, NJ, USA). Following centrifugation (12,000 × g, 4°C, 30 min), the supernatant was collected and quantified. The proteins were quantified using a BCA Kit (Beyotime Institute of Biotechnology, Jiangsu, China). A total of 30 μg of protein was loaded per lane in the 10% gel and separated by SDS-PAGE, then transferred to nitrocellulose membranes. After blocking with 5% non-fat milk at room temperature for 2 h, the membranes were probed with antibodies against SMAD6 (cat. no. sc-7004; Santa Cruz Biotechnology, Dallas, TX, USA), TNF receptor-associated factor 6 (TRAF6; cat. no. ab40675; Abcam, Cambridge, MA, USA), phosphorylated (p-) TGF-β-activated kinase 1 (TAK1)/total TAK1 (cat. no. 5206, cat. no. 9339; Cell Signaling Technology, Danvers, MA, USA), p-P38/total P38 MAPK (cat. no. 4511, cat. no. 8690; Cell Signaling Technology), p-c-Jun N-terminal kinase (JNK)/total JNK (cat. no. 4668, cat. no. 9252; Cell Signaling Technology), BCL2 associated X (cat. no. 2772, Bax; Cell Signaling Technology), BCL2 apoptosis regulator (cat. no. 3498, Bcl-2; Cell Signaling Technology), or cleaved Caspase-3 (cat. no. 9664, Cell Signaling Technology) overnight at 4°C. Membranes were then incubated with a fluorescence-labeled secondary antibody at room temperature for 2 h. GAPDH antibody (cat. no. 5174, Cell Signaling Technology) was used as a loading control. Secondary antibodies included HRP-conjugated against rabbit (cat. no. 7074, Cell Signaling Technology, Inc.) and Rabbit anti-Goat peroxidase conjugated H+L (cat. no. BL004A, Zhihong Biotechnology Co., Ltd., Hefei, China). Immunoblots were visualized using Biorad ChemiDoc XRS+ with Image Lab Software (version 5.2.1, Hangzhou Baocheng Biotechnology Co., Ltd., Hangzhou, China). Densitometry of Western blots was quantified with Image Lab software (version 5.2.1, Hangzhou Baocheng Biotechnology Co., Ltd.).

Luciferase reporter assay

A luciferase reporter construct was generated by cloning the human SMAD6 mRNA sequence into the pMIR-Report vector (Ambion; Thermo Fisher Scientific, Inc.). Wild-type or mutant SMAD6 mRNA fragments were amplified and cloned into the luciferase reporter via SpeI and HindIII sites. All the primers are listed in Table II. HUVECs plated in a 48-well plate were co-transfected with 10 nM miRNA mimics or negative control oligonucleotides, 50 ng of firefly luciferase reporter and 10 ng of pRL-TK (Promega Corporation, Madison, WI, USA) using the JetPRIME reagent (Polyplus-transfection). Cells were collected 36 h after last transfection and analyzed using Dual-Luciferase Reporter Assay System (Promega Corporation).

Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay

TUNEL staining was used to detect DNA fragmentation of individual cells using a TUNEL fluorescence fluorescein isothiocyanate (FITC) kit (Roche Diagnostics, Indianapolis, IN, USA). HUVECs grown on coverslips were fixed with 4% paraformaldehyde at 37°C for 1 h followed by permeabilization with 0.1% Triton X-100. Then, cells were incubated with TUNEL reaction mixture at 37°C for 1 h. The stained cells were examined under a fluorescence microscope.

Statistical analysis

Results are presented as the mean ± standard error of the mean. Differences among groups were analyzed using one-away analysis of variance accompanied with Turkey multiple-comparisons test. Two-tailed Student's t-test was used for comparison between two groups. Statistical analyses were performed with GraphPad Prism version 5.0 (GraphPad Software, Inc., La Jolla, CA, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

miR-186 is upregulated in KD serum and in HUVECs stimulated with KD serum

Although our previous study revealed that miR-186 was differentially expressed in KD serum compared with healthy children (18), the function of miR-186 in KD remained unclear. In the present study, RT-qPCR was used to confirm that miR-186 was significantly upregulated in KD serum compared with serum from healthy children as well as serum from febrile children (Fig. 1A). The results demonstrated that the expression of miR-186 in the KD serum was ~10-fold higher compared with healthy controls and febrile children. In serum sampled from children with convalescence KD, miR-186 exhibited a tendency of decreasing back to normal levels (Fig. 1A).

Figure 1

Serum miR-186 levels are increased in patients with KD. (A) miR-186 levels were determined in serum samples from 21 acute KD patients, 25 healthy control participants, 17 febrile control participants and 11 convalescence KD patients. (B) Expression of miR-186 was measured in HUVECs by reverse transcription-quantitative polymerase chain reaction at 48 h following culture with 20% serum from KD patients or healthy controls (n=3). Data are presented as the mean ± standard error of the mean. *P<0.05, **P<0.01, and ***P<0.001, with comparisons indicated by lines. KD, Kawasaki disease; HUVECs, human umbilical vein endothelial cells; HC, healthy control.

KD is an acute rash autoimmune disease, primarily affecting blood vessels and inducing systemic vasculitis (1). As previously reported, endothelial damage is the first step in the development of coronary artery aneurysm during the course of KD (6,21). Since previous studies of KD have reported that HUVECs can be used to study the vascular endothelium (23,24), these cells were used as the in vitro model in the present study. In order to examine whether KD serum could increase miR-186 in endothelial cells, HUVECs were cultured with 20% KD serum or 20% healthy control (HC) serum. To prevent the immune response of these sera, they were inactivated in a 56°C water bath for 30 min prior to experiments. miR-186 levels were then determined in HUVECs 48 h following HC or KD serum incubation. A significant increase of miR-186 levels was identified in cells cultured with KD serum, but not in cells cultured with HC serum (Fig. 1B). As a result, it was speculated that miR-186 could affect endothelial cells in the pathological process of KD.

Overexpression of miR-186 induces HUVEC apoptosis

Since miR-186 was upregulated in KD serum and KD serum could upregulate miR-186 in HUVECs, gain-of-function studies were performed in HUVECs. miR-186 mimics or negative control oligonucleotides were transiently transfected into HUVECs. Expression of miR-186 was determined by RT-qPCR. The results confirmed that transfection of miR-186 mimic significantly increased its expression in HUVECs (Fig. 2A). The functional role of miR-186 was then examined on HUVECs by performing TUNEL assays. Overexpression of miR-186 in HUVECs resulted in a significant increase of cell apoptosis compared with the negative control oligonucleotide transfection (Fig. 2B and C). These data suggested that miR-186 modulated HUVEC viability and that overexpression of miR-186 promoted HUVEC apoptosis.

Figure 2

miR-186 overexpression induces HUVEC apoptosis. (A) HUVECs were transfected with miR-186 mimics or negative control oligonucleotides. miR-186 expression was quantified by reverse transcription-quantitative polymerase chain reaction (n=3). (B) The effect of miR-186 overexpression on HUVEC apoptosis induced by H2O2 (100 μmol/l) for 3 h was determined by TUNEL assay. Representative micrographs exhibiting cell images are shown at ×100 magnification. (C) The % of TUNEL + cells was calculated in 10 random fields per slide (n=3). Data are presented as the mean ± standard error of the mean. **P<0.01. HUVECs, human umbilical vein endothelial cells; NC, negative control; TUNEL, terminal deoxynucleotidyl transferase dUTP nick end labeling.

miR-186 directly targets SMAD6

To understand the mechanisms by which miR-186 induces endothelial cell apoptosis, several miRNA target prediction algorithms, including Microcosm (http://www.ebi.ac.uk/enright-srv/microcosm/htdocs/targets/v5/) (25), starBase (http://starbase.sysu.edu.cn/) (26), Pictar (http://pictar.mdcberlin.de/) (27) and TargetScan (http://www.targetscan.org/) (12) were used to identify the potential target genes of miR-186. A total of 14 target genes were predicted by all four prediction algorithms used in the present study (Fig. 3A; Table III). Among these genes, SMAD6 was also demonstrated to be targeted by miR-186 from experimental data in the DIANA-TarBase v7.0 database (http://diana.imis.athena-innovation.gr/DianaTools/index.php?r=tarbase/) (28), and therefore we focused on SMAD6. To determine whether SMAD6 was a genuine target of miR-186, a set of functional experiments was performed. First, miR-186 mimic was transfected into HUVECs, and SMAD6 expression was determined at both the mRNA and protein levels. The expression of SMAD6 was downregulated following miR-186 mimic overexpression in HUVECs (Fig. 3B and C). To further confirm that miR-186 could directly bind to SMAD6 and inhibit its expression, a luciferase reporter plasmid was generated with wild-type or mutant sequence of the SMAD6 predicted mRNA target fragment (Fig. 3D). The reporter constructs were co-transfected with miR-186 mimics or negative control oligonucleotides into HUVECs for 48 h, and then luciferase activity was measured in the transfected cells. The results confirmed that the reporter construct with wild-type targeting sequence of SMAD6 mRNA caused a significant decrease in luciferase activity in cells transfected with miR-186, whereas the reporter construct with mutant sequence of SMAD6 produced no change in luciferase activity (Fig. 3E). These results suggested that miR-186 could bind to SMAD6 directly and inhibit its expression.

Figure 3

miR-186 directly targets SMAD6. (A) Venn diagram of the results from the gene target prediction algorithms. (B) Effect of miR-186 mimic overexpression on the endogenous SMAD6 mRNA levels (n=3). (C) Effect of miR-186 mimic overexpression on the endogenous SMAD6 protein levels (n=3). (D) Schematic of the predicted miR-186 binding sequence on the SMAD6 mRNA 3′-UTR. Luciferase reporter construct was made by cloning the human SMAD6 mRNA sequence into pMIR-Report construct. Wild-type or mutant SMAD6 mRNA fragments (from 2,769 to 2,792) were amplified and cloned into the luciferase reporter via SpeI and HindIII sites. (E) HUVECs were co-transfected with the reporter constructs bearing the wild-type and mutant SMAD6 sequences as indicated in Fig. 3D, and with miR-186 mimics or negative control oligonucleotides. After 36 h, firefly luciferase activity was measured and normalized to Renilla luciferase activity. Data are presented as the mean ± standard error of the mean. **P<0.01, and ***P<0.001, with comparisons indicated by lines. SMAD6, SMAD family member 6; UTR, untranslated region; HUVECs, human umbilical vein endothelial cells; NC, negative control; WT, wild-type; MUT, mutant.

Table III

List of the 14 predicted target genes for miR-186.

Table III

List of the 14 predicted target genes for miR-186.

Gene nameGene Ensembl ID
PSPH ENSG00000146733
YY1 ENSG00000100811
PABPC3 ENSG00000151846
DNM3 ENSG00000197959
CNTNAP1 ENSG00000108797
PNN ENSG00000100941
AHCYL1 ENSG00000168710
EP300 ENSG00000100393
NASP ENSG00000132780
PUM2 ENSG00000055917
SMAD6 ENSG00000137834
RBM26 ENSG00000139746
CETN2 ENSG00000147400
GPBP1 ENSG00000062194
miR-186 enhances apoptosis in HUVECs by targeting SMAD6

The results demonstrated that overexpression of miR-186 induced apoptosis in HUVECs, and that SMAD6 was a direct target of miR-186. Therefore, it was hypothesized that miR-186 may affect the apoptosis of vascular endothelial cells through SMAD6. It has been reported that TGF stimulation induces cell apoptosis through the MAPK signaling pathway, while SMAD6 negatively regulates the TGF/MAPK signaling pathway (29,30). Therefore, in the present study, first TGF-β1 was used to induce cell apoptosis, and then the expression of SMAD6 was suppressed by miR-186. As expected, compared with the TGF-β1-induced group, miR-186 significantly enhanced TGF-β1-mediated cell apoptosis in HUVECs (Fig. 4A and B). In addition, miR-186 overexpression significantly enhanced the activation of the TGF/MAPK signaling pathways in HUVECs (Fig. 4C). Taken together, these results implied that miR-186 promoted the activation of MAPK signaling by targeting the inhibition of SMAD6, thus inducing endothelial cell apoptosis.

Figure 4

miR-186 overexpression enhances TGF-β1-mediated apoptosis in HUVECs. (A) The effect of miR-186 overexpression on HUVEC apoptosis induced by TGF-β1 (5 ng/ml) was measured by TUNEL assay. Representative images are shown at ×100 magnification and quantification of % of TUNEL + cells were calculated in 10 random fields per slide (n=4). (B) miR-186 overexpression increased the TGF-β1-mediated expression of apoptosis-related proteins. Representative blots and quantification is shown. The expression levels of Bax/Bcl-2 in the TGF-β1 group were higher compared with the control group (P=0.02), but in the TGF-β1 + miR-186 mimic transfection group were higher compared with the TGF-β1 alone group (P=0.006). The expression levels of cleaved-caspase-3 (normalized to GAPDH) in the TGF-β1 group were higher compared with the control group (P=0.023), but in the TGF-β1 + miR-186 mimic transfection group were higher compared with the TGF-β1 alone group (P=0.004). (C) Expression levels of MAPK pathway-related proteins were detected by western blotting in HUVECs induced by TGF-β1 with or without miR-186 mimic transfection. Compared with the TGF-β1 alone group, TGF-β1 + miR-186 mimic transfection significantly activated the MAPK pathway (P<0.05). Data are presented as the mean ± standard error of the mean. *P<0.05, **P<0.01, and ***P<0.001, with comparisons indicated by lines. TGF, transforming growth factor; HUVECs, human umbilical vein endothelial cells; TUNEL, terminal deoxynucleotidyl transferase dUTP nick end labeling; Bcl-2, BCL2 apoptosis regulator; Bax, BCL2 associated X; MAPK, mitogen-activated protein kinase; p, phosphorylated; TRAF6, TNF receptor-associated factor 6; TAK1, TGF-β-activated kinase 1; JNK, c-Jun N-terminal kinase.

miR-186 has a role in KD-induced endothelial cell injury

The present study demonstrated that miR-186 was increased in HUVECs following culture with KD serum. It was also confirmed that miR-186 could promote HUVEC apoptosis. To demonstrate whether KD serum mediates endothelial cell apoptosis through miR-186, HUVECs were cultured with 20% serum either from patients with KD or healthy controls (the sera were from the patients listed in Table I). The results demonstrated that KD serum induced HUVEC apoptosis (Fig. 5A and B). However, KD serum-induced apoptosis was significantly inhibited by addition of the miR-186 inhibitor (30 nmol/l; Fig. 5A and B). In addition, in KD serum-treated HUVECs, the SMAD6 protein levels were decreased, and this effect was significantly reversed by addition of the miR-186 inhibitor (Fig. 5C). Similarly, that the results demonstrated that KD serum could induce activation of the TGF-β/MAPK pathway in HUVECs, whereas addition of the miR-186 inhibitor significantly reversed the TGF-β/MAPK pathway activation (Fig. 5D). The present results suggested that miR-186 in the serum of patients with KD may have an essential role in endothelial apoptosis by activating MAPK signaling through targeting of the SMAD6 gene.

Figure 5

miR-186 promotes cell apoptosis induced by KD serum. (A) HUVEC apoptosis was induced by culture with KD serum and the effect of miR-186 was examined by the addition of the miR-186 inhibitor (30 nmol/l; n=3). Representative TUNEL images (magnification, ×100) are shown. (B) Representative images and quantification from western blot analysis of the expression levels of apoptosis-related proteins. KD serum promoted the expression of apoptosis proteins, such as Bax/Bcl-2 (P=0.000013) and cleaved-caspase-3 (P=0.00221), while these effects were significantly blocked by the miR-186 inhibitor (P<0.05). (C) Representative images and quantification from western blot analysis of the SMAD6 protein expression levels in HUVECs induced by KD serum with (P=0.005023) or without (P=0.000079) miR-186 inhibitor. (D) KD serum alone activated the MAPK pathway, while KD serum with miR-186 inhibitor transfection significantly prevented this effect (P<0.05). Data are presented as the mean ± standard error of the mean. *P<0.05, **P<0.01, and ***P<0.001, with comparisons indicated by lines. KD, Kawasaki disease; HUVECs, human umbilical vein endothelial cells; TUNEL, terminal deoxynucleotidyl transferase dUTP nick end labeling; Bcl-2, BCL2 apoptosis regulator; Bax, BCL2 associated X; SMAD6, SMAD family member 6; MAPK, mitogen-activated protein kinase; HC, healthy control; p, phosphorylated; TRAF6, TNF receptor associated factor 6; TAK1, TGF-β-activated kinase 1; JNK, c-Jun N-terminal kinase.

Discussion

The present study demonstrated that overexpression of miR-186 may be a promoting factor for endothelial injury in KD. The results revealed that miR-186 was upregulated in KD serum and KD serum could increase miR-186 levels in HUVECs. Overexpression of miR-186 in HUVECs induced apoptosis, and the underlying mechanism likely involved the repression of SMAD6 and the subsequent activation of the TGF/MAPK pathway. In addition, the results demonstrated that KD serum induced HUVEC apoptosis through miR-186. The present study provides evidence that miR-186 may be a therapeutic target for KD.

miR-186 has an important role in a variety of diseases, especially in cancer. Hua et al (31) reported that miR-186 inhibited cell proliferation through targeting the oncogene GOLPH3 in prostate cancer. Liu et al (32) demonstrated that ectopic expression of miR-186 significantly inhibited cell growth in multiple myeloma. Notably, Wang et al (33) reported that circulating miR-186 could be considered a promising novel diagnostic biomarkers for the early phase of acute myocardial infarction. In the present study, miR-186 was demonstrated to inhibit expression of SMAD6 and activate MAPK signaling in HUVECs. In summary, the present results determined a new mechanism for miR-186 participating in the pathological process of KD.

KD is an important febrile illness causing multi-system vasculitis in childhood. The mechanisms involved in the pathogenesis of KD are not clearly understood and confirmatory diagnosis has not been established. Endothelial injury, an early risk marker of cardiovascular diseases, refers to loss of normal homeostatic function in blood vessels, and is charac-terized by inflammatory activity (34,35). In KD, the long-term cardiovascular outcome for pediatric survivors is of important concern. Accelerated coronary atherosclerosis in KD-related lesions occurring in young adults has been reported and results in acute coronary syndrome or sudden death (36). Multiple studies exist on KD-associated endothelial injury; for example, the levels of blood cell-derived miR-223 in endothelial cells may act as a novel endocrine genetic signal and may participate in vascular injury of KD (18), while miR-125a-5p has been demonstrated to induce apoptosis in HUVECs through direct inhibition of MAP kinase kinase 7 levels resulting in Caspase-3 activation (37). However, the specific mechanisms of KD-induced endothelial injury remain unclear. The present study revealed that aberrantly expressed miR-186 in KD serum could induce endothelial cell apoptosis, which suggested that miR-186 could be the effector for impaired endothelium in KD and may be a new target for KD treatment.

TGF-β is a multifunctional peptide that regulates proliferation, differentiation, apoptosis, and migration in many cell types (38). TGF-β-associated signal transduction involves SMAD-dependent and SMAD-independent pathways. The MAPK family of proteins consists of extracellular signal-regulated kinase (ERK), JNK/stress-activated protein kinase (SAPK) and p38 MAPK. The TGF-β/MAPK pathway has been demonstrated to be involved in many processes in various diseases, including epithelial-myofibroblast trans-differentiation (39,40), inflammatory (41) and apoptotic processes (42,43). In endothelial cells, TGF-β1 inhibits endothelial cell proliferation and migration (44), and induces endothelial cell apoptosis by inhibiting expression of the anti-apoptotic protein Bcl-2 and activating p38 MAPK (45). In KD, a genetic association study has established that polymorphisms in the TGF-β pathway influence disease susceptibility and coronary artery aneurysm formation (46). In addition, the TGF-β related genes SMAD3, TGFB2, and TGFBR2 were observed to have a significant effect on KD susceptibility, severity, or treatment response. A later study provided more evidence on the role of the TGF-β/SMAD3 signaling pathway in the arteritis of KD (47). In the present study, miR-186 was determined to directly target SMAD6 which then negatively regulated the TGF-β/MAPK signaling pathway.

In conclusion, the present study confirmed that miR-186 was upregulated in serum from patients with acute KD and miR-186 upregulation appeared to be highly specific to the acute phase of KD. Furthermore, miR-186 was demonstrated to regulate the expression of SMAD6, which then negatively regulated TGF-β signaling, resulting in feedback activation of the MAPK pathway to induce endothelial cell injury. These results suggest that miR-186 might be used as a target of KD treatment.

Acknowledgments

This study was supported by grants from the Zhejiang Provincial Medical and Health Science and Technology plan (grant no. WKJ-ZJ-1725), the Zhejiang Provincial Medical and Health Science and Technology plan (grant no. 2016KYB197), the Scientific Research Foundation of Wenzhou (grant no. Y20150015), and the Zhejiang Provincial Natural Science Foundation of China (grant no. Q15H020015).

Notes

[1] Competing interests

The authors declare that they have no competing interests.

References

1 

Newburger JW, Takahashi M and Burns JC: Kawasaki Disease. J Am Coll Cardiol. 67:1738–1749. 2016. View Article : Google Scholar : PubMed/NCBI

2 

Gordon JB, Kahn AM and Burns JC: When children with Kawasaki disease grow up: Myocardial and vascular complications in adulthood. J Am Coll Cardiol. 54:1911–1920. 2009. View Article : Google Scholar : PubMed/NCBI

3 

Kato H, Sugimura T, Akagi T, Sato N, Hashino K, Maeno Y, Kazue T, Eto G and Yamakawa R: Long-term consequences of Kawasaki disease. A 10- to 21-year follow-up study of 594 patients. Circulation. 94:1379–1385. 1996. View Article : Google Scholar : PubMed/NCBI

4 

Newburger JW, Takahashi M, Beiser AS, Burns JC, Bastian J, Chung KJ, Colan SD, Duffy CE, Fulton DR, Glode MP, et al: A single intravenous infusion of gamma globulin as compared with four infusions in the treatment of acute Kawasaki syndrome. N Engl J Med. 324:1633–1639. 1991. View Article : Google Scholar : PubMed/NCBI

5 

Leung DY, Cotran RS, Kurt-Jones E, Burns JC, Newburger JW and Pober JS: Endothelial cell activation and high interleukin-1 secretion in the pathogenesis of acute Kawasaki disease. Lancet. 2:1298–1302. 1989. View Article : Google Scholar : PubMed/NCBI

6 

Amano S, Hazama F and Hamashima Y: Pathology of Kawasaki disease: I. Pathology and morphogenesis of the vascular changes. Jpn Circ J. 43:633–643. 1979. View Article : Google Scholar : PubMed/NCBI

7 

Arkin A: A Clinical and pathological study of periarteritis nodosa: A report of five cases, one histologically healed. Am J Pathol. 6:401–426.5. 1930.PubMed/NCBI

8 

Shah V, Christov G, Mukasa T, Brogan KS, Wade A, Eleftheriou D, Levin M, Tulloh RM, Almeida B, Dillon MJ, et al: Cardiovascular status after Kawasaki disease in the UK. Heart. 101:1646–1655. 2015. View Article : Google Scholar : PubMed/NCBI

9 

Tsuda E, Hamaoka K, Suzuki H, Sakazaki H, Murakami Y, Nakagawa M, Takasugi H and Yoshibayashi M: A survey of the 3-decade outcome for patients with giant aneurysms caused by Kawasaki disease. Am Heart J. 167:249–258. 2014. View Article : Google Scholar : PubMed/NCBI

10 

Liang M: MicroRNA: A new entrance to the broad paradigm of systems molecular medicine. Physiol Genomics. 38:113–115. 2009. View Article : Google Scholar : PubMed/NCBI

11 

Lagos-Quintana M, Rauhut R, Lendeckel W and Tuschl T: Identification of novel genes coding for small expressed RNAs. Science. 294:853–858. 2001. View Article : Google Scholar : PubMed/NCBI

12 

Lewis BP, Burge CB and Bartel DP: Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell. 120:15–20. 2005. View Article : Google Scholar : PubMed/NCBI

13 

Yun KW, Lee JY, Yun SW, Lim IS and Choi ES: Elevated serum level of microRNA (miRNA)-200c and miRNA-371-5p in children with Kawasaki disease. Pediatr Cardiol. 35:745–752. 2014. View Article : Google Scholar

14 

Shimizu C, Kim J, Stepanowsky P, Trinh C, Lau HD, Akers JC, Chen C, Kanegaye JT, Tremoulet A, Ohno-Machado L and Burns JC: Differential expression of miR-145 in children with Kawasaki disease. PLoS One. 8:e581592013. View Article : Google Scholar : PubMed/NCBI

15 

Rowley AH, Pink AJ, Reindel R, Innocentini N, Baker SC, Shulman ST and Kim KY: A study of cardiovascular miRNA biomarkers for Kawasaki disease. Pediatr Infect Dis J. 33:1296–1299. 2014. View Article : Google Scholar : PubMed/NCBI

16 

Rong X, Jia L, Hong L, Pan L, Xue X, Zhang C, Lu J, Jin Z, Qiu H, Wu R and Chu M: Serum miR-92a-3p as a new potential biomarker for diagnosis of Kawasaki disease with coronary artery lesions. J Cardiovasc Transl Res. 10:1–8. 2017. View Article : Google Scholar

17 

He M, Chen Z, Martin M, Zhang J, Sangwung P, Woo B, Tremoulet AH, Shimizu C, Jain MK, Burns JC and Shyy JY: miR-483 targeting of CTGF suppresses endothelial-to-mesenchymal transition: Therapeutic implications in Kawasaki disease. Circ Res. 120:354–365. 2017. View Article : Google Scholar :

18 

Chu M, Wu R, Qin S, Hua W, Shan Z, Rong X, Zeng J, Hong L, Sun Y, Liu Y, et al: Bone marrow-derived microRNA-223 works as an endocrine genetic signal in vascular endothelial cells and participates in vascular injury from Kawasaki disease. J Am Heart Assoc. 6:pii: e0048782017. View Article : Google Scholar

19 

Cao C, Sun D, Zhang L and Song L: miR-186 affects the proliferation, invasion and migration of human gastric cancer by inhibition of Twist1. Oncotarget. 7:79956–79963. 2016. View Article : Google Scholar : PubMed/NCBI

20 

Dong Y, Jin X, Sun Z, Zhao Y and Song X: MiR-186 inhibited migration of NSCLC via targeting cdc42 and effecting EMT process. Mol Cells. 40:195–201. 2017.PubMed/NCBI

21 

McCrindle BW, Rowley AH, Newburger JW, Burns JC, Bolger AF, Gewitz M, Baker AL, Jackson MA, Takahashi M, Shah PB, et al: Diagnosis, treatment, and long-term management of Kawasaki disease: A scientific statement for health professionals from the American heart association. Circulation. 135:e927–e999. 2017. View Article : Google Scholar : PubMed/NCBI

22 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔC T method. Methods. 25:402–408. 2001. View Article : Google Scholar

23 

Higashi K, Terai M, Hamada H, Honda T, Kanazawa M and Kohno Y: Impairment of angiogenic activity in the serum from patients with coronary aneurysms due to Kawasaki disease. Circ J. 71:1052–1059. 2007. View Article : Google Scholar : PubMed/NCBI

24 

Tian J, Lv HT, An XJ, Ling N and Xu F: Endothelial microparticles induce vascular endothelial cell injury in children with Kawasaki disease. Eur Rev Med Pharmacol Sci. 20:1814–1818. 2016.PubMed/NCBI

25 

He JH, Han ZP, Zou MX, Wang L, Lv YB, Zhou JB, Cao MR and Li YG: Analyzing the LncRNA, miRNA, and mRNA regulatory network in prostate cancer with bioinformatics software. J Comput Biol. 2017.Epub ahead of print. PubMed/NCBI

26 

Yang JH, Li JH, Shao P, Zhou H, Chen YQ and Qu LH: starBase: A database for exploring microRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data. Nucleic Acids Res. 39:D202–D209. 2011. View Article : Google Scholar

27 

Krek A, Grün D, Poy MN, Wolf R, Rosenberg L, Epstein EJ, MacMenamin P, da Piedade I, Gunsalus KC, Stoffel M and Rajewsky N: Combinatorial microRNA target predictions. Nat Genet. 37:495–500. 2005. View Article : Google Scholar : PubMed/NCBI

28 

Vlachos IS, Paraskevopoulou MD, Karagkouni D, Georgakilas G, Vergoulis T, Kanellos I, Anastasopoulos IL, Maniou S, Karathanou K, Kalfakakou D, et al: DIANA-TarBase v7.0: Indexing more than half a million experimentally supported miRNA: mRNA interactions. Nucleic Acids Res. 43:D153–D159. 2015. View Article : Google Scholar

29 

Jung SM, Lee JH, Park J, Oh YS, Lee SK, Park JS, Lee YS, Kim JH, Lee JY, Bae YS, et al: Smad6 inhibits non-canonical TGF-β1 signalling by recruiting the deubiquitinase A20 to TRAF6. Nat Commun. 4:25622013. View Article : Google Scholar

30 

Lee MK, Pardoux C, Hall MC, Lee PS, Warburton D, Qing J, Smith SM and Derynck R: TGF-beta activates Erk MAP kinase signalling through direct phosphorylation of ShcA. EMBO J. 26:3957–3967. 2007. View Article : Google Scholar : PubMed/NCBI

31 

Hua X, Xiao Y, Pan W, Li M, Huang X, Liao Z, Xian Q and Yu L: miR-186 inhibits cell proliferation of prostate cancer by targeting GOLPH3. Am J Cancer Res. 6:1650–1660. 2016.PubMed/NCBI

32 

Liu Z, Zhang G, Yu W, Gao N and Peng J: miR-186 inhibits cell proliferation in multiple myeloma by repressing Jagged1. Biochem Biophys Res Commun. 469:692–697. 2016. View Article : Google Scholar

33 

Wang KJ, Zhao X, Liu YZ, Zeng QT, Mao XB, Li SN, Zhang M, Jiang C, Zhou Y, Qian C, et al: Circulating miR-19b-3p, miR-134-5p and miR-186-5p are promising novel biomarkers for early diagnosis of acute myocardial infarction. Cell Physiol Biochem. 38:1015–1029. 2016. View Article : Google Scholar : PubMed/NCBI

34 

Davignon J and Ganz P: Role of endothelial dysfunction in atherosclerosis. Circulation. 109(Suppl 1): III27–III32. 2004. View Article : Google Scholar : PubMed/NCBI

35 

Horio E, Kadomatsu T, Miyata K, Arai Y, Hosokawa K, Doi Y, Ninomiya T, Horiguchi H, Endo M, Tabata M, et al: Role of endothelial cell-derived angptl2 in vascular inflammation leading to endothelial dysfunction and atherosclerosis progression. Arterioscler Thromb Vasc Biol. 34:790–800. 2014. View Article : Google Scholar : PubMed/NCBI

36 

Hartopo AB and Setianto BY: Coronary artery sequel of Kawasaki disease in adulthood, a concern for internists and cardiologists. Acta Med Indones. 45:69–75. 2013.PubMed/NCBI

37 

Li Z, Jiang J, Tian L, Li X, Chen J, Li S, Li C and Yang Z: A plasma mir-125a-5p as a novel biomarker for Kawasaki disease and induces apoptosis in HUVECs. PLoS One. 12:e01754072017. View Article : Google Scholar : PubMed/NCBI

38 

Ruiz-Ortega M, Rodriguez-Vita J, Sanchez-Lopez E, Carvajal G and Egido J: TGF-beta signaling in vascular fibrosis. Cardiovasc Res. 74:196–206. 2007. View Article : Google Scholar : PubMed/NCBI

39 

Liu C, Chen F, Han X, Xu H and Wang Y: Role of TGF-β1/p38 MAPK pathway in hepatitis B virus-induced tubular epithelial-myofibroblast transdifferentiation. Int J Clin Exp Pathol. 7:7923–7930. 2014.

40 

Wei J, Li Z, Chen W, Ma C, Zhan F, Wu W and Peng Y: AEG-1 participates in TGF-beta1-induced EMT through p38 MAPK activation. Cell Biol Int. 37:1016–1021. 2013. View Article : Google Scholar : PubMed/NCBI

41 

Malik S, Suchal K, Khan SI, Bhatia J, Kishore K, Dinda AK and Arya DS: Apigenin ameliorates streptozotocin-induced diabetic nephropathy in rats via MAPK/NF-κB/TNF-α and TGF-β1/MAPK/fibronectin pathways. Am J Physiol Renal Physiol. 2:F414–F422. 2017. View Article : Google Scholar

42 

Hyman KM, Seghezzi G, Pintucci G, Stellari G, Kim JH, Grossi EA, Galloway AC and Mignatti P: Transforming growth factor-beta1 induces apoptosis in vascular endothelial cells by activation of mitogen-activated protein kinase. Surgery. 132:173–179. 2002. View Article : Google Scholar : PubMed/NCBI

43 

Ferrari G, Terushkin V, Wolff MJ, Zhang X, Valacca C, Poggio P, Pintucci G and Mignatti P: TGF-β1 induces endothelial cell apoptosis by shifting VEGF activation of p38 (MAPK) from the prosurvival p38β to proapoptotic p38α. Mol Cancer Res. 10:605–614. 2012. View Article : Google Scholar : PubMed/NCBI

44 

Pollman MJ, Naumovski L and Gibbons GH: Vascular cell apoptosis: Cell type-specific modulation by transforming growth factor-beta1 in endothelial cells versus smooth muscle cells. Circulation. 99:2019–2026. 1999. View Article : Google Scholar : PubMed/NCBI

45 

Tsukada T, Eguchi K, Migita K, Kawabe Y, Kawakami A, Matsuoka N, Takashima H, Mizokami A and Nagataki S: Transforming growth factor beta 1 induces apoptotic cell death in cultured human umbilical vein endothelial cells with down-regulated expression of bcl-2. Biochem Biophys Res Commun. 210:1076–1082. 1995. View Article : Google Scholar : PubMed/NCBI

46 

Shimizu C, Jain S, Davila S, Hibberd ML, Lin KO, Molkara D, Frazer JR, Sun S, Baker AL, Newburger JW, et al: Transforming growth factor-beta signaling pathway in patients with Kawasaki disease. Circ Cardiovasc Genet. 4:16–25. 2011. View Article : Google Scholar

47 

Shimizu C, Oharaseki T, Takahashi K, Kottek A, Franco A and Burns JC: The role of TGF-β and myofibroblasts in the arteritis of Kawasaki disease. Hum Pathol. 44:189–198. 2013. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wu R, Shen D, Sohun H, Ge D, Chen X, Wang X, Chen R, Wu Y, Zeng J, Rong X, Rong X, et al: miR‑186, a serum microRNA, induces endothelial cell apoptosis by targeting SMAD6 in Kawasaki disease. Int J Mol Med 41: 1899-1908, 2018.
APA
Wu, R., Shen, D., Sohun, H., Ge, D., Chen, X., Wang, X. ... Chu, M. (2018). miR‑186, a serum microRNA, induces endothelial cell apoptosis by targeting SMAD6 in Kawasaki disease. International Journal of Molecular Medicine, 41, 1899-1908. https://doi.org/10.3892/ijmm.2018.3397
MLA
Wu, R., Shen, D., Sohun, H., Ge, D., Chen, X., Wang, X., Chen, R., Wu, Y., Zeng, J., Rong, X., Su, X., Chu, M."miR‑186, a serum microRNA, induces endothelial cell apoptosis by targeting SMAD6 in Kawasaki disease". International Journal of Molecular Medicine 41.4 (2018): 1899-1908.
Chicago
Wu, R., Shen, D., Sohun, H., Ge, D., Chen, X., Wang, X., Chen, R., Wu, Y., Zeng, J., Rong, X., Su, X., Chu, M."miR‑186, a serum microRNA, induces endothelial cell apoptosis by targeting SMAD6 in Kawasaki disease". International Journal of Molecular Medicine 41, no. 4 (2018): 1899-1908. https://doi.org/10.3892/ijmm.2018.3397
Copy and paste a formatted citation
x
Spandidos Publications style
Wu R, Shen D, Sohun H, Ge D, Chen X, Wang X, Chen R, Wu Y, Zeng J, Rong X, Rong X, et al: miR‑186, a serum microRNA, induces endothelial cell apoptosis by targeting SMAD6 in Kawasaki disease. Int J Mol Med 41: 1899-1908, 2018.
APA
Wu, R., Shen, D., Sohun, H., Ge, D., Chen, X., Wang, X. ... Chu, M. (2018). miR‑186, a serum microRNA, induces endothelial cell apoptosis by targeting SMAD6 in Kawasaki disease. International Journal of Molecular Medicine, 41, 1899-1908. https://doi.org/10.3892/ijmm.2018.3397
MLA
Wu, R., Shen, D., Sohun, H., Ge, D., Chen, X., Wang, X., Chen, R., Wu, Y., Zeng, J., Rong, X., Su, X., Chu, M."miR‑186, a serum microRNA, induces endothelial cell apoptosis by targeting SMAD6 in Kawasaki disease". International Journal of Molecular Medicine 41.4 (2018): 1899-1908.
Chicago
Wu, R., Shen, D., Sohun, H., Ge, D., Chen, X., Wang, X., Chen, R., Wu, Y., Zeng, J., Rong, X., Su, X., Chu, M."miR‑186, a serum microRNA, induces endothelial cell apoptosis by targeting SMAD6 in Kawasaki disease". International Journal of Molecular Medicine 41, no. 4 (2018): 1899-1908. https://doi.org/10.3892/ijmm.2018.3397
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team