
Role of TXNDC5 in tumorigenesis of colorectal cancer cells: In vivo and in vitro evidence
- Authors:
- Published online on: May 9, 2018 https://doi.org/10.3892/ijmm.2018.3664
- Pages: 935-945
-
Copyright: © Tan et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
Abstract
Introduction
Colorectal cancer (CRC) is the third most common type of cancer in China (1). CRC tumorigenesis occurs when mutations accumulate in critical oncogenes and tumor suppressor genes (2,3). Hypoxia is a common feature in numerous solid tumors and the microenvironment is now recognized as a key factor associated with biologically aggressive phenotypes in cancer (4). Hypoxia can induce formation of reactive oxygen species (ROS), which may induce genotoxic effects or cancer cell apoptosis (5). In addition, hypoxia can induce endoplasmic reticulum (ER) stress and activate the unfolded protein response (UPR), which is an adaptive response that increases cancer cell survival under ER stress (6,7). The main pathways of ER stress include three functional components: i) Transcriptional upregulation of specific genes to tackle unfolded and misfolded proteins, namely, the UPR; ii) inhibition of translation to reduce the load of client proteins; and iii) triggering apoptosis when ER functions are severely impaired (8-10).
Thioredoxin domain containing 5 (TXNDC5), which is a member of the disulfide isomerase family, is predominantly expressed in the ER (11). Accumulating evidence has suggested that TXNDC5 is induced by hypoxia in endothelial cells and tumor endothelium (12). It has been reported that TXNDC5 facilitates proteins to fold correctly by the formation of disulfide bonds through its thioredoxin domains (13); this can protect cells from ER stress-induced apoptosis (12,14). In addition to upregulation in numerous types of cancer, including hepatocellular, breast, cervical, esophageal, liver, lung, stomach and uterine carcinoma (15), TXNDC5 is overexpressed in CRC (16,17) and is considered an oncogene (18). However, the role of TXNDC5 in CRC tumorigenesis remains unclear.
The present study aimed to explore the role of TXNDC5 in CRC tumorigenesis in vitro and in vivo under hypoxic and normoxic conditions.
Materials and methods
Patient samples
Tumor and paired normal mucosal tissues were surgically removed from 102 patients with CRC at the Xiangya Hospital of Central South University (Changsha, China) between January 2009 and December 2010. Fresh tissues underwent reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blot analysis. The sections were fixed with 4% polyformaldehyde phosphate buffer for 12 h at 37°C. In addition, samples were embedded in paraffin for immunohistochemistry. Normal mucosal tissues were excised 5 cm away from the tumor. The histomorphology of tumor and normal mucosa were confirmed by pathologists. The present study was approved by the Medical Ethics Committee of Xiangya Hospital and all patients provided written informed consent.
Cell culture and treatment
The human CRC cell lines RKO and HCT-116 reportedly express high levels of HIF-1α under hypoxia (20). These cell lines were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). All cells were cultured in RPMI-1640 medium (Biological Industries, Beit-Haemek, Israel) supplemented with 10% fetal bovine serum (FBS; Biological Industries). Cells were cultured at 37°C in a humidified atmosphere containing 5% CO2.
RT-qPCR analysis
Total RNA was extracted from cells (RKO and HCT-116 cells) and tissues using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA), and equal amounts of RNA underwent RT-qPCR analysis (PCR kit, SYBR-Green/ROX Mastermix; Takara Bio, Inc., Otsu, Japan) according to the manufacturer's protocol. Firstly, Total RNA underwent DNase treatment with gDNA Eraser buffer and gDNA Eraser. The RNA without DNA was then reversed into cDNA according to the manufacturer's protocol (PrimeScript RT reagent kit with gDNA Eraser; Takara Bio, Inc.). Finally, the cDNA, qPCR reagent (SYBR Premix Ex Taq II; Takara Bio, Inc.) and primer were mixed together for thermocycling, and the thermocycling conditions were according to the manufacturer's operation guidelines as follows: cDNA 2 µl, qPCR mix 10 µl, forward primer 0.6 µl, reverse primer 0.6 µl, ROX 0.3 µl, DEPC water, 6.5 µl, STEP1 95°C 30 sec, STEP2 95°C 5 sec, STEP3 60°C 35 min STEP4 Go To STEP2 for 30 cycles, STEP5: Melt Curve Stage, STEP6:4°C end. β-actin was used as an internal control. The primer sequences used are as follows: TXNDC5 (human), sense 5′-GGG TCA AGA TCG CCG AAGTA-3′, antisense 5′-GCC TCC ACT GTG CTC ACTGA-3′; TXNDC5 (mouse), sense 5′-CGC ACT TCG TCA TGT TCT TCG-3′, antisense 5′-CAG AGC ACA CGT CGG AATCA-3′; hypoxia-inducible factor-1α (HIF-1α) (human), sense 5′-ATC GCG GGG ACC GATT-3′, antisense 5′-CGA CGT TCA GAA CTT ATC TTT TTCTT-3′; and β-actin, sense 5′-GCA CCA CAC CTT CTA CAA TGAGC-3′ and antisense 5′-GGA TAG CAC AGC CTG GAT AGC AAC-3′. The 2−ΔΔCq method was used to calculate the relative abundance of mRNA for each gene compared with β-actin expression (19). Each experiment was perfo rmed in triplicate.
Western blot analysis
Tissue samples and cancer cells (RKO and HCT-116 cells) were homogenized and lysed in radioimmunoprecipitation assay buffer (Sigma-Aldrich, St. Louis, MO, USA) supplemented with proteinase inhibitors. Equal amounts of protein (2 µg/µl) were loaded and separated by 10% SDS-PAGE. The protein concentration was determined by BCA. Subsequently, proteins were transferred to a polyvinylidene fluoride membrane (EMD Millipore, Billerica, MA, USA) and the membrane was blocked in 5% (w/v) non-fat milk. The membrane was then incubated with primary antibodies overnight at 4°C, followed by incubation with a secondary antibody (anti-rabbit IgG HRP-linked secondary antibody, 7074S; 1:2,000 dilution; Cell Signaling Technology, Inc., Danvers, MA, USA) for 1 h at room temperature. Bands were visualized using the Enhanced Chemiluminescence Advance Detection system (EMD Millipore). Blots were semi-quantified using Image Lab V4.0 (Bio-Rad, Hercules, CA, USA). The dilution of primary antibodies were as follows: TXNDC5 (ENT2133), 1:2,000; HIF-1α (ENT2133), 1:1,000; glucose-regulated protein 78 (GRP78; ENT2245), 1:1,000; CCAAT-enhancer-binding protein homologous protein (CHOP; ENT0911), 1:1,000; activating transcription factor 4 (ATF4; EAP0008), 1:1,000; B-cell lymphoma 2 (Bcl-2)-associated X protein (Bax; ENT0456), 1:1,000; Bcl-2 (ENT0469), 1:500; cleaved caspase-8 (ENC011), 1:1,000; and β-actin (4970), 1:1,000.
Immunohistochemistry
Tissue slides were prepared as follows: The tissue sections (pruned into 7-10-mm diameter and 5-7 µm thick) were incubated in 3 washes of xylene for 5 min each and then incubated in 2 washes of 100% ethanol for 10 min each and in 2 washes of 95% ethanol for 10 min each. The sections were then washed twice in dH2O for 5 minutes each and the slides were brought to boil in 1 mM EDTA (pH 8.2) followed by 4 min at a sub-boiling temperature. No cooling was necessary. The sections were washed in dH2O 3 times for 5 min each and then incubated in 3% hydrogen peroxide for 15 min. Afterwards, the sections were washed in dH2O twice for 5 min each. Tissue slides were deparaffinized and antigen retrieval was performed by immersing the slides in boiling EDTA-Tris buffer (pH 8.2) for 4 min. Following incubation with 3% H2O2 for 15 min, slides were incubated with primary antibodies against TXNDC5 (ENT2133; 1:100) and HIF-1α (ENT2133; 1:100) (both from Wuhan Elabscience Biotechnology Co., Ltd., Wuhan, China) overnight at 4°C, followed by incubation with the secondary antibody (SA00004-2; 1:500; Proteintech; Nanjing, China) for 30 min at room temperature. 3,3′-Diaminobenzidine (0.05%) was used for 5-10 min at room temperature to visualize a positive immune reaction. Nuclei were counterstained with hematoxylin. The microscope used was from Leica (Wetzlar, Germany). Briefly, HIF-1α and TXNDC5 expression levels were scored according to the percentage of positively stained cells and staining intensity: (−) or 0, no staining (0-10%); (+) or 1, weak staining (10-25%); (++) or 2, moderate staining (25-50%) and (+++) or 3, strong staining (>50%). (−) and (+) were defined as low expression, and (++) and (+++) were defined as high expression. The staining results were independently evaluated by two board-certified clinical pathologists blinded to the clinical parameters. Any discrepancy between the two evaluators was resolved by re-evaluation and careful discussion until agreement was reached.
Hypoxia treatment [1% O2 or cobalt chloride (CoCl2)]
Cells were cultured in 96-well plates, or 60- or 100-mm petri dishes. For each assay, RKO and HCT-116 cells were cultured in RPMI-1640 containing 10% FBS for 24 h. For hypoxic treatment, cells were exposed to either 1% O2 or to various concentrations of the hypoxia-mimicking agent CoCl2 (PhytoTechnology Laboratories, Lenexa, KS, USA) for various time intervals, as previously described (21).
MTT cell proliferation assay
In vitro cell proliferation was determined using a MTT Cell Proliferation Assay kit (ATCC) according to the manufacturer's protocol. Briefly, cells were plated at 15×103 cells/well in 96-well tissue culture plates. At the end of the culture period, cells were washed with PBS, and the MTT reagents were added according to the manufacturer's protocol. Subsequently, formazan was dissolved using DMSO and the absorbance was then measured at 570 nm using an ELISA plate reader. Each experiment was repeated three times in triplicate.
Colony formation assay
Cells were seeded at a density of 500 cells/6-well plates (Corning Inc., Corning, NY, USA) in triplicate and were cultured for 14 days. During colony growth assays, the culture medium was replaced every 3 days. Colonies with >50 cells were counted when visible to naked eye and stained with GIEMSA under a light microscope.
Cell apoptosis assay
Cells were seeded at 1×105 cells/well in 96-well tissue culture plates. Cell apoptosis was measured at 24 h using a microplate reader-based TiterTACS in situ apoptosis detection kit (R&D Systems, Inc., Minneapolis, MN, USA) according to the manufacturer's protocol. The percentage of apoptotic cells was calculated.
Measurement of ROS
The intracellular total ROS Activity Assay kit (Abnova, Walnut, CA, USA) was used to detect ROS levels, according to the manufacturer's protocol. Briefly, the treated cells were lysed and the amount of intracellular ROS was calculated according to dichlorodihydrofluorescein production, which was measured using a fluorometric plate reader at excitation and emission wavelengths of 490 and 525 nm, respectively.
Transient transfection of small interfering (si)RNA
Cells (3.0×105 per well) were seeded into 24-well plates at a density of 1.5×105 cells/ml, and allowed to reacĥ50% confluence on the day of transfection. Cells were transfected with 100 nmol/l of each siRNA duplex for 6 h at 37°C using Lipofectamine® 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Scrambled control siRNA (siScr), siHIF-1α (AGCCATTTACATAATATAGAA) and siTXNDC5 (ATCGAGCTACTTCCCATAATA) were all purchased from Guangzhou RiboBio Co., Ltd. (Guangzhou, China).
Azoxymethane (AOM)-induced colorectal tumorigenesis model
AOM was used to induce a sporadic colorectal tumorigenesis model, as previously described (22). Briefly, 8 week-old male mice [n=18; A/J strain; divided into 3 groups; weight, >18 g; maintenance conditions: temperature, 18-29°C; relative humidity, 50-60%; free access to clean food and water; lighting for 10-14 h (lights turned on at 8:00 every day and turned off at 18:00)] were intraperitoneally injected with 10 mg/kg body weight AOM (Sigma-Aldrich) six times. The mice were injected with AOM every week from the first to the sixth week. The mice were then provided with regular water and did not undergo any further treatment. Mice were sacrificed at various time-points, after which the colorectum was excised, opened longitudinally, flushed with ice-cold PBS and fixed in 10% formalin/PBS for 24 h at room temperature. Subsequently, macroscopic tumors were counted and morphological evaluation of normal, adenoma and tumor tissues were performed under a light microscope. All mice were divided into 3 groups; the blank control group was treated with normal saline, the adenoma and tumor groups were treated with AOM. The normal tissues were obtained from the blank control group, and the adenoma tissues were obtain from mice treated with AOM at the end of the 12th week. All animals received humane care according to the Institutional Animal Care and Treatment Committee of Central South University, and the proof number of ethics was 201603426.
Statistical analysis
Statistical analysis of the differences in mRNA expression levels of HIF-1α and TXNDC5 between paired tissues were analyzed by paired t-test. The association between target gene expression and clinicopathological factors was estimated by χ2 test. The statistical differences among ≥2 groups were analyzed using one-way analysis of variance followed by post hoc pairwise comparisons (Tukey's post hoc test). The experiments were repeated 3 times. The correlation between HIF-1α and TXNDC5 expression was determined by Spearman's correlation analysis. All data are expressed as the means ± standard error. P<0.05 was considered to indicate a statistically significant difference. The statistical software programs GraphPad Prism 6.0 (GraphPad Software, Inc., La Jolla, CA, USA) and SPSS 13.0 for Windows (SPSS, Inc., Chicago, IL, USA) were used to analyze data.
Results
TXNDC5 upregulation is associated with HIF-1α over-expression in human CRC specimens
The expression levels of HIF-1α and TXNDC5 were detected in CRC tissues from patients. As shown in Fig. 1A, the mRNA expression levels of HIF-1α and TXNDC5 were increased in CRC tissues compared with in paired normal mucosal tissues. In addition, TXNDC5 mRNA expression was positively correlated with HIF-1α mRNA expression in CRC tissues (r=0.435, P<0.0001). The protein expression levels of HIF-1α and TXNDC5 were detected in randomly selected CRC samples by western blot analyses. As shown in Fig. 1B, CRC tissues exhibited higher expression levels of TXNDC5 compared with in paired normal tissues. As presented in Fig. 1C, analyses of the staining intensity in immunohistochemistry images indicated that the expression of TXNDC5 was highly correlated with the expression of HIF-1α in CRC tissues (r=20.508, P<0.0001; data not shown). In addition, strong HIF-1α and TXNDC5 staining was revealed to be associated with advanced TNM stage (Fig. 1D). As shown in Table I, the expression levels of HIF-1α and TXNDC5 were significantly associated with the TNM stage of CRC, whereas no significant association was found with other clinicopathological variables, including age, gender, tumor location, tumor size, tumor differentiation, adjuvant therapy and carcinoembryonic antigen levels.
![]() | Table ICorrelation between clinicopathological features and HIF-1α or TXNDC5 protein expression in 102 patients with CRC. |
Hypoxia induces the expression of TXNDC5 via upregulating HIF-1α in CRC cell lines
To examine whether HIF-1α induced the expression of TXNDC5, RKO and HCT-116 human CRC cells were cultured under hypoxic conditions (1% O2) in a sealed hypoxic chamber (23). As shown in Fig. 2A, the expression levels of HIF-1α and TXNDC5 reached a peak after 24 h under hypoxia. The cells were also treated with various concentrations of CoCl2, which is a HIF prolyl hydroxylase antagonist (24) that was used as a positive control for HIF-1α induction. As shown in Fig. 2B, 1 µM CoCl2 induced the highest expression of TXNDC5; similar results were observed with regards to the expression of HIF-1α. Subsequently, a specific siRNA (siHIF-1α) was used to knockdown HIF-1α by ~65% in RKO cells and ~55% in HCT-116 cells under hypoxic conditions. As shown in Fig. 3, knockdown of HIF-1α abolished the hypoxia-induced expression of TXNDC5 in RKO and HCT-116 cells.
TXNDC5 is critical for CRC tumorigenesis under hypoxia
To determine the function of TXNDC5, a specific siRNA (siTXNDC5) was used to knockdown TXNDC5 expression by ~60% in RKO and HCT-116 cells under hypoxic conditions (Fig. 4). To determine the effects of TXNDC5 on cell proliferation, the MTT assay was performed on cells transfected with siTXNDC5 or siScr. As shown in Fig. 5A, TXNDC5 knockdown resulted in a significant reduction in the proliferation of both cell lines under hypoxia, but not under normoxia. Furthermore, cells transfected with siTXNDC5 exhibited a ~75% reduction in colony-forming capacity compared with in those transfected with siScr under hypoxic conditions, but not normoxic conditions (Fig. 5B and C). These findings suggested that TXNDC5 was critical for CRC cell proliferation under hypoxia. Furthermore, the role of siTXNDC5 was determined in hypoxia-induced CRC cell apoptosis. As shown in Fig. 5D, knockdown of TXNDC5 significantly increased cell apoptosis under hypoxia, but not under normoxia, thus suggesting a protective role of TXNDC5 in hypoxia-induced CRC cell apoptosis. The present study also examined the expression levels of TXNDC5 in an AOM-induced mouse model of CRC tumorigenesis, which reportedly exhibits similar pathological and pathophysiological manifestations to human sporadic colorectal tumorigenesis (22). As shown in Fig. 6, the mRNA and protein expression levels of TXNDC5 were significantly increased in tumor tissues compared with in adenoma and normal tissues, confirming the important role of TXNDC5 in CRC tumorigenesis.
Knockdown of TXNDC5 aggravates ER stress and induces apoptosis in CRC cell lines
Hypoxia can induce the formation of ROS, which are critical inducers of ER stress (5-7). Therefore, the present study examined the effects of TXNDC5 knockdown on the production of ROS in RKO and HCT-116 cells. As shown in Fig. 7A, cells transfected with siTXNDC5 exhibited signi ficantly increased ROS production compared with those transfected with siScr under hypoxic, but not normoxic conditions. As shown in Fig. 7B, hypoxia significantly induced the expression of ER stress (CHOP, GRP78 and ATF4), apoptosis (Bax and cleaved caspase-8) and survival (Bcl-2) markers in RKO and HCT-116 cells, whereas knockdown of TXNDC5 further increased the expression of ER stress (CHOP, GRP78 and ATF4) and apoptosis (Bax and cleaved caspase-8) markers under hypoxic, but not normoxic conditions. Conversely, knockdown of TXNDC5 significantly decreased hypoxia-induced expression of the survival marker Bcl-2 under hypoxia, but not under normoxia.
Discussion
Numerous studies, including our previous comparative proteomic study, demonstrated that TXNDC5 is overexpressed in CRC (15-17). The present study provided in vivo and in vitro evidence to sugge st that TXNDC5 serves an important role in the tumorigenesis of CRC, particularly under hypoxia. The present in vivo data indicated a positive association between TXNDC5 and the TNM stage of CRC in human samples; this was corroborated by the sporadic CRC animal model, which exhibited an ascending tendency in the expression levels of TXNDC5 from normal to CRC tissues. The in vitro data indicated that TXNDC5 could promote proliferation and survival of CRC cells under hypoxia, likely by regulating ER stress.
It has previously been reported that TXNDC5 promotes cell proliferation under hypoxic conditions, including in fibroblast-like cells, synovial fluid and blood (25). In addition, hypoxia-induced TXNDC5 has been demonstrated to protect endothelial cells and tumor endothelium from hypoxia-induced apoptosis (12); however, these previous studies did not indicate whether TXNDC5 was regulated by hypoxia. In the present study, in CRC cells, hypoxia induced the expression of TXNDC5 via HIF-1α; HIF-1α knockdown abolished hypoxia-induced expression of TXNDC5. A previous study reported that hypoxia exerted no detectable effects on TXNDC5 expression in non-small cell lung cancer cell lines under hypoxia, whereas HIF-1α was upregulated (26). This discrepancy may be attributed to the fact that the cells were obtained from different organs with varying genetic backgrounds.
Previous studies have demonstrated that hypoxia regulates the expression of genes involved in angiogenesis, anaerobic glycolysis, cell proliferation and survival (27,28). The present study revealed that TXNDC5 knockdown decreased CRC cell proliferation and colony formation, and augmented apoptosis under hypoxia, thus suggesting that TXNDC5 is critical for CRC cell proliferation and survival under hypoxic conditions. Previous studies have also demonstrated that TXNDC5 regulates proliferation and survival of gastric and pancreatic cancer cells under normoxia (29,30). However, in the present study, knockdown of TXNDC5 only affected CRC cell proliferation and survival under hypoxia, not normoxia. These findings suggested that TXNDC5 is more likely a hypoxia-induced stress survival factor rather than a common oncogene in CRC.
Hypoxia induces ROS production and ER stress (10,31,32). ROS directly or indirectly affects ER homeostasis and protein folding, which triggers ER stress and may induce cell apoptosis in the case of excessive ER stress (32,33). Accumulating evidence has suggested that TXNDC5 is involved in ROS production and ER stress (30,34). It has previously been reported that inhibiting the expression of TXNDC5 via knockdown of the orphan nuclear receptor, nuclear receptor subfamily 4 group A member 1, induces ROS and ER stress in pancreatic cancer cells (30); conversely, increasing the expression of TXNDC5 in lipid endothelial cells effectively decreases ROS production and protects cells (34). The present study demonstrated that, in CRC cells, knockdown of TXNDC5 markedly increased hypoxia-induced ROS production, and the expression of hypoxia-induced ER stress and apoptotic markers. This finding is in agreement with a previous study, which indicated that hypoxia-induced TXNDC5 was involved in helping proteins to fold correctly via its disulfide isomerase activity (13). Taken together, these findings suggested that TXNDC5 functions as a hypoxia-induced survival factor to regulate hypoxia-induced ROS/ER stress signaling, thereby maintaining the tumorigenesis of CRC cells under hypoxia and oxidative stress.
In conclusion, the present in vivo data demonstrated that TXNDC5 is overexpressed in CRC tissues, and this overexpression is associated with unfavorable clinicopathological features. Furthermore, the in vitro results indicated that hypoxia induces TXNDC5 expression via upregulating HIF-1α; this effect may promote CRC cell proliferation and survival under hypoxia, likely through inhibiting hypoxia-induced ROS/ER stress signaling. These findings suggested that TXNDC5 functions as an important stress survival factor to maintain the tumorigenesis of CRC cells under hypoxia by regulating hypoxia-induced ROS/ER stress signaling. The present study provided novel insights into the role of TXNDC5 in the tumorigenesis of CRC.
Acknowledgments
Not applicable.
Funding
The present study was funded by the Science and Technology Plan Fund of Hunan Province, P.R. China (grant nos. 2015WK3011; 2015SK20201) and the Beijing CSCO Fund (grant no. Y-MX2014-002).
Availability of data and materials
The datasets used or analyzed during the current study are available from the corresponding author on reasonable request.
Authors' contributions
FT and HP conceived and designed the experiments. FT and HZ wrote the article. XH and NY prepared the patient samples. FT and NY performed the experiments. HX, XZ and XH collected and analyzed the data. All authors read and approved the final manuscript.
Ethics approval and consent to participate
The present study was approved by the Medical Ethics Committee of Xiangya Hospital (Changsha, China) and all patients provided written informed consent. All experimental procedures were conducted in conformity with institutional guidelines for the care and use of laboratory animals, and protocols were approved by the Institutional Animal Care and Treatment Committee of Central South University.
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
References
Zheng R, Zeng H, Zhang S, Chen T and Chen W: National estimates of cancer prevalence in China, 2011. Cancer Lett. 370:33–38. 2016. View Article : Google Scholar | |
Pesson M, Volant A, Uguen A, Trillet K, De La Grange P, Aubry M, Daoulas M, Robaszkiewicz M, Le Gac G, Morel A, et al: A gene expression and pre-mRNA splicing signature that marks the adenoma-adenocarcinoma progression in colorectal cancer. PLoS One. 9:e877612014. View Article : Google Scholar : | |
Schell MJ, Yang M, Missiaglia E, Delorenzi M, Soneson C, Yue B, Nebozhyn MV, Loboda A, Bloom G and Yeatman TJ: A composite gene expression signature optimizes prediction of colorectal cancer metastasis and outcome. Clin Cancer Res. 22:734–745. 2016. View Article : Google Scholar : | |
Keith B and Simon MC: Hypoxia-inducible factors, stem cells, and cancer. Cell. 129:465–472. 2007. View Article : Google Scholar | |
Saito S, Lin YC, Tsai MH, Lin CS, Murayama Y, Sato R and Yokoyama KK: Emerging roles of hypoxia-inducible factors and reactive oxygen species in cancer and pluripotent stem cells. Kaohsiung J Med Sci. 31:279–286. 2015. View Article : Google Scholar | |
Hotokezaka Y, van Leyen K, Lo EH, Beatrix B, Katayama I, Jin G and Nakamura T: AlphaNAC depletion as an initiator of ER stress-induced apoptosis in hypoxia. Cell Death Differ. 16:1505–1514. 2009. View Article : Google Scholar | |
Pereira ER, Frudd K, Awad W and Hendershot LM: Endoplasmic reticulum (ER) stress and hypoxia response pathways interact to potentiate hypoxia-inducible factor 1 (HIF-1) transcriptional activity on targets like vascular endothelial growth factor (VEGF). J Biol Chem. 289:3352–3364. 2014. View Article : Google Scholar : | |
Chevet E, Hetz C and Samali A: Endoplasmic reticulum stress-activated cell reprogramming in oncogenesis. Cancer Discov. 5:586–597. 2015. View Article : Google Scholar | |
Yadav RK, Chae SW, Kim HR and Chae HJ: Endoplasmic reticulum stress and cancer. J Cancer Prev. 19:75–88. 2014. View Article : Google Scholar : PubMed/NCBI | |
Clarke HJ, Chambers JE, Liniker E and Marciniak SJ: Endoplasmic reticulum stress in malignancy. Cancer Cell. 25:563–573. 2014. View Article : Google Scholar : PubMed/NCBI | |
Horna-Terrón E, Pradilla-Dieste A, Sánchez-de-Diego C and Osada J: TXNDC5, a newly discovered disulfide isomerase with a key role in cell physiology and pathology. Int J Mol Sci. 15:23501–23518. 2014. View Article : Google Scholar | |
Sullivan DC, Huminiecki L, Moore JW, Boyle JJ, Poulsom R, Creamer D, Barker J and Bicknell R: EndoPDI, a novel protein-disulfide isomerase-like protein that is preferentially expressed in endothelial cells acts as a stress survival factor. J Biol Chem. 278:47079–47088. 2003. View Article : Google Scholar : PubMed/NCBI | |
Kojima R, Okumura M, Masui S, Kanemura S, Inoue M, Saiki M, Yamaguchi H, Hikima T, Suzuki M, Akiyama S, et al: Radically different thioredoxin domain arrangement of ERp46, an efficient disulfide bond introducer of the mammalian PDI family. Structure. 22:431–443. 2014. View Article : Google Scholar : PubMed/NCBI | |
Funkner A, Parthier C, Schutkowski M, Zerweck J, Lilie H, Gyrych N, Fischer G, Stubbs MT and Ferrari DM: Peptide binding by catalytic domains of the protein disulfide isomerase-related protein ERp46. J Mol Biol. 425:1340–1362. 2013. View Article : Google Scholar : PubMed/NCBI | |
Chang X, Xu B, Wang L, Wang Y, Wang Y and Yan S: Investigating a pathogenic role for TXNDC5 in tumors. Int J Oncol. 43:1871–1884. 2013. View Article : Google Scholar : PubMed/NCBI | |
Wang Y, Ma Y, Lü B, Xu E, Huang Q and Lai M: Differential expression of mimecan and thioredoxin domain-containing protein 5 in colorectal adenoma and cancer: a proteomic study. Exp Biol Med (Maywood). 232:1152–1159. 2007. View Article : Google Scholar | |
Shen H, Huang J, Pei H, Zeng S, Tao Y, Shen L, Zeng L and Zhu H: Comparative proteomic study for profiling differentially expressed proteins between Chinese left- and right-sided colon cancers. Cancer Sci. 104:135–141. 2013. View Article : Google Scholar | |
Affer M, Chesi M, Chen WD, Keats JJ, Demchenko YN, Tamizhmani K, Garbitt VM, Riggs DL, Brents LA, Roschke AV, et al: Promiscuous MYC locus rearrangements hijack enhancers but mostly super-enhancers to dysregulate MYC expression in multiple myeloma. Leukemia. 28:1725–1735. 2014. View Article : Google Scholar : | |
Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-ΔΔC(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar | |
Dang DT, Chen F, Gardner LB, Cummins JM, Rago C, Bunz F, Kantsevoy SV and Dang LH: Hypoxia-inducible factor-1alpha promotes nonhypoxia-mediated proliferation in colon cancer cells and xenografts. Cancer Res. 66:1684–1936. 2006. View Article : Google Scholar | |
Shweta, Mishra KP, Chanda S, Singh SB and Ganju L: A comparative immunological analysis of CoCl2 treated cells with in vitro hypoxic exposure. Biometals. 28:175–185. 2015. View Article : Google Scholar | |
Neufert C, Becker C and Neurath MF: An inducible mouse model of colon carcinogenesis for the analysis of sporadic and inflammation-driven tumor progression. Nat Protoc. 2:1998–2004. 2007. View Article : Google Scholar : PubMed/NCBI | |
George AL, Rajoria S, Suriano R, Mittleman A and Tiwari RK: Hypoxia and estrogen are functionally equivalent in breast cancer-endothelial cell interdependence. Mol Cancer. 11:802012. View Article : Google Scholar : PubMed/NCBI | |
Wang L, Zheng Y, Xu H, Yan X and Chang X: Investigate pathogenic mechanism of TXNDC5 in rheumatoid arthritis. PLoS One. 8:e533012013. View Article : Google Scholar : PubMed/NCBI | |
Chang X, Cui Y, Zong M, Zhao Y, Yan X, Chen Y and Han J: Identification of proteins with increased expression in rheumatoid arthritis synovial tissues. J Rheumatol. 36:872–880. 2009. View Article : Google Scholar | |
Vincent EE, Elder DJ, Phillips L, Heesom KJ, Pawade J, Luckett M, Sohail M, May MT, Hetzel MR and Tavaré JM: Overexpression of the TXNDC5 protein in non-small cell lung carcinoma. Anticancer Res. 31:1577–1582. 2011.PubMed/NCBI | |
Mizukami Y, Kohgo Y and Chung DC: Hypoxia inducible factor-1 independent pathways in tumor angiogenesis. Clin Cancer Res. 13:5670–5674. 2007. View Article : Google Scholar : PubMed/NCBI | |
Nagaraju GP, Bramhachari PV, Raghu G and El-Rayes BF: Hypoxia inducible factor-1α: its role in colorectal carcinogenesis and metastasis. Cancer Lett. 366:11–18. 2015. View Article : Google Scholar | |
Zhang L, Hou Y, Li N, Wu K and Zhai J: The influence of TXNDC5 gene on gastric cancer cell. J Cancer Res Clin Oncol. 136:1497–1505. 2010. View Article : Google Scholar : PubMed/NCBI | |
Lee SO, Jin UH, Kang JH, Kim SB, Guthrie AS, Sreevalsan S, Lee JS and Safe S: The orphan nuclear receptor NR4A1 (Nur77) regulates oxidative and endoplasmic reticulum stress in pancreatic cancer cells. Mol Cancer Res. 12:527–538. 2014. View Article : Google Scholar : PubMed/NCBI | |
Malhotra JD and Kaufman RJ: Endoplasmic reticulum stress and oxidative stress: a vicious cycle or a double-edged sword. Antioxid Redox Signal. 9:2277–2293. 2007. View Article : Google Scholar | |
Clarke R, Cook KL, Hu R, Facey CO, Tavassoly I, Schwartz JL, Baumann WT, Tyson JJ, Xuan J, Wang Y, et al: Endoplasmic reticulum stress, the unfolded protein response, autophagy, and the integrated regulation of breast cancer cell fate. Cancer Res. 72:1321–1331. 2012. | |
Wang WA, Groenendyk J and Michalak M: Endoplasmic reticulum stress associated responses in cancer. Biochim Biophys Acta. 1843:2143–2149. 2014. View Article : Google Scholar : PubMed/NCBI | |
Gu MX, Fu Y, Sun XL, Ding YZ, Li CH, Pang W, Pan S and Zhu Y: Proteomic analysis of endothelial lipid rafts reveals a novel role of statins in antioxidation. J Proteome Res. 11:2365–2373. 2012. View Article : Google Scholar |