Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
October-2018 Volume 42 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2018 Volume 42 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Evaluation of intestinal injury, inflammatory response and oxidative stress following intracerebral hemorrhage in mice

  • Authors:
    • Yijun Cheng
    • Jieyu Zan
    • Yaying Song
    • Guoyuan Yang
    • Hanbing Shang
    • Weiguo Zhao
  • View Affiliations / Copyright

    Affiliations: Department of Neurosurgery, Rui Jin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai 200025, P.R. China, Department of Pediatrics, Nantong First People's Hospital, Nantong, Jiangsu 226001, P.R. China, Department of Neurology, Rui Jin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai 200025, P.R. China, Department of Neurosurgery, Rui Jin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai 200025, P.R. China
  • Pages: 2120-2128
    |
    Published online on: July 4, 2018
       https://doi.org/10.3892/ijmm.2018.3755
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Intestinal injury is a common complication following intracerebral hemorrhage (ICH), which leads to malnutrition, impaired immunity and unsatisfactory prognosis. Previous studies have revealed the pathogenesis of intestinal injury following traumatic brain injury using ischemic stroke models. However, the effects of ICH on intestinal injury remain unknown. The present study aimed to investigate the pathological alterations and molecular mechanism, as well as the time course of intestinal injury following ICH in mice. Male C57BL/6 mice were randomly divided into the following seven groups (n=6 mice/group): Control group, which underwent a sham operation, and six ICH groups (2, 6, 12 and 24 h, and days 3 and 7). The ICH model was induced by stereotactically injecting autologous blood in two stages into the brain. Subsequently, intestinal tissue was stained with hematoxylin and eosin for histopathological examination. Small intestinal motility was measured by charcoal meal test, and gut barrier dysfunction was evaluated by detecting the plasma levels of endotoxin. Quantitative polymerase chain reaction (qPCR), immunohistochemistry and ELISA analysis were performed to evaluate the mRNA and protein expression levels of inflammatory cytokines [interleukin (IL)‑1β, IL‑6, tumor necrosis factor‑α, intercellular adhesion molecule 1, monocyte chemotactic protein 1 and chemokine (C‑C motif) ligand‑5] in intestinal tissue and serum. Furthermore, intestinal leukocyte infiltration was detected by measuring myeloperoxidase activity. Oxidative stress was indirectly detected by measuring reactive oxygen species‑associated markers (malondialdehyde content and superoxide dismutase activity assays) and the mRNA and protein expression levels of antioxidant genes [nuclear factor (erythroid‑derived 2)‑like 2, manganese superoxide dismutase and heme oxygenase 1] by qPCR and western blot analysis. The results demonstrated that significant destruction of the gut mucosa, delayed small intestinal motility, intestinal barrier dysfunction, and increased inflammatory responses and oxidative stress occurred rapidly in response to ICH. These symptoms occurred as early as 2 h after ICH and persisted for 7 days. These findings suggested that ICH may induce immediate and persistent damage to gut structure and barrier function, which may be associated with upregulation of inflammation and oxidative stress markers.

Introduction

Intracerebral hemorrhage (ICH) is the most severe stroke subtype, and is a leading cause of morbidity and mortality (1). ICH accounts for 10–15% of all strokes in Europe, USA and Australia, and 20–30% of all strokes in Asia; ~2 million cases of ICH occur annually worldwide (2). Intestinal injury, particularly upper gastrointestinal (GI) bleeding, is a potential complication in patients with ICH, which leads to malnutrition, impaired immunity, longer periods of hospitalization, dependence, poor outcome and even mortality (3–7). Furthermore, compared with other common complications that occur following ICH, including pneumonia, seizures and fever, intestinal injury has received much less attention, and the associated pathophysiological alterations require further discussion and evaluation.

It is generally accepted that the intestine is the core organ of posttraumatic stress, and the initiating organ of multiple organ dysfunction in the development of severe complications under critically stressful events, including burns (8), heat stroke (9), trauma (10), brain events (11,12) and transplantation (13). These stressful events may initiate a cascade of intestinal events, including destruction of the gut mucosa, barrier dysfunction, translocation of intestinal bacteria and endotoxin, and upper GI bleeding, which may lead to systemic inflammatory response syndrome (SIRS) and multiple organ dysfunction syndrome (MODS) (14). ICH is a severe type of pathological stress and a critical brain event, which may induce numerous intestinal events, as aforementioned. Following ICH, not only the general stress state, but also central nervous system damage-induced neural, humoral and endocrine system disorders may disrupt intestinal integrity and function. However, the underlying molecular mechanism remains to be elucidated.

To the best of our knowledge, no previous study has focused on intestinal aspects following ICH in vivo. Due to the important role of intestinal function in the prognosis of patients with ICH, the development of effective therapeutic strategies for the treatment of intestinal complications is required. However, the pathophysiological mechanisms of ICH-induced intestinal complications are currently undefined. The present study aimed to investigate the sequentially pathological alterations and molecular mechanisms underlying ICH-induced intestinal injury.

Materials and methods

Animals and experimental groups

The present study was approved by the Laboratory Animal Ethics Committee of Rui Jin Hospital (Shanghai, China). Animal experiments were conducted in accordance with the US National Institutes of Health Guidelines (15) and followed the guidelines of the National Animal Protection of China. Male C57BL/6 mice (age, 6–8 weeks) were purchased from the Experimental Animal Center of the Chinese Academy of Sciences (Shanghai, China). Mice were maintained under specific pathogen-free conditions at a constant room temperature (18–22°C) and humidity (40–70%), under a 12-h light/dark cycle. Sterilized food and water were provided ad libitum. To evaluate the intestinal damage following ICH, 42 mice were randomly divided into the following seven groups (n=6 mice/group): Control group and six ICH groups (2, 6, 12 and 24 h, and 3 and 7 days). All efforts were made to minimize suffering and to reduce the number of mice used.

ICH mouse model

Mice were anesthetized with a single intraperitoneal dose of 100 mg/kg ketamine/10 mg/kg xylazine (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany). Mice were positioned in a stereotactic frame (RWD Life Science Co., Ltd., Shenzhen, China) and ICH was induced by autologous blood infusion. A 1 mm burr hole was drilled 2.5 mm lateral to the midline and 0.2 mm anterior to the bregma. Autologous blood (25 µl) was collected from a cut in the tail using a Hamilton syringe, which was flushed with heparin prior to blood collection. A needle was advanced 3.0 mm into the right striatum. A total of 25 µl autologous blood was injected via a double injection technique using a microinfusion pump (World Precision Instruments, Sarasota, FL, USA). An initial amount of 5 µl was delivered at a rate of 1.5 µl/min. Following a 10 min interval without injection, the remaining 20 µl was delivered at the same rate (1.5 µl/min). The needle was left in place for a further 10 min to minimize blood backflow. Following withdrawal of the needle, the scalp was sutured. In the sham control mice, only the needle was inserted. After the operation, mice were returned back to their cages.

Small intestinal motility

Mice in each group were sacrificed at the corresponding time point. A total of 30 min before sacrifice, charcoal meal (0.1 ml; 5% activated charcoal suspended in 10% aqueous gum arabic) was injected into the stomach through a gastric tube. After laparotomy, the entire small intestine was harvested. The distance traveled by the charcoal meal from the pylorus to the furthest point of small intestine was recorded. The intestinal impelling force was measured according to the following formula: Impelling force (%) = distance traveled by charcoal meal/total length of the small intestine × 100.

Histopathology

After fixation in 10% formalin for 24 h at room temperature, ileal segments from each group were embedded in paraffin. Subsequently, the samples were cut into 4 µm sections and were mounted onto slides. For histopathological examination, the sections were stained with hematoxylin for 10 min and eosin for 5 min at room temperature. Intestinal morphological alterations were detected by an observer blinded to the experimental group using an inverted microscope (Leica Microsystems GmbH, Wetzlar, Germany). As described by Chiu et al (16) the histological scoring system was used to quantify the degree of intestinal damage following ICH.

Plasma endotoxin

All blood samples were carefully obtained from the hearts of the mice prior to sacrifice and were centrifuged at 6,000 × g for 5 min at 4°C. Endotoxin content in the plasma samples was assessed using the limulus amebocyte lysate kit (TAL, Xiamen, China) with a kinetic modification according to the manufacturer’s protocol. Endotoxin concentrations were expressed as EU/ml.

Immunohistological staining

Segments of the terminal ileum were fixed in 10% neutral formalin for 24 h at room temperature, and 4 µm sections were cut from each paraffin-embedded block. The sections were dewaxed in xylene and rehydrated, after which antigen retrieval was conducted. Briefly, the sections were immersed in citrate buffer and heated using a microwave oven for 15 min at 92–98°C. Subsequently, the sections were incubated in 3% H2O2 in PBS for 10 min, and blocked in PBS containing 3% normal goat serum (Thermo Fisher Scientific, Inc., Waltham, MA, USA), 0.3% (w/v) Triton X-100 and 0.1% bovine serum albumin (Sigma-Aldrich; Merck KGaA) at room temperature for 1 h. The sections were then incubated with a primary antibody against intercellular adhesion molecule 1 (ICAM-1; 1:100 dilution; cat. no. ab171123; Abcam, Cambridge, UK) at 4°C overnight. Subsequently, sections were developed with the ABC kit and detected with diaminobenzidine (both Vector Laboratories, Inc., Burlingame, CA, USA). The sections were then counterstained with hematoxylin, dehydrated and mounted. Histopathological alterations were observed using an inverted microscope (Leica Microsystems GmbH) following a blinded procedure. Images were analyzed by Image-Pro Plus version 6.0 (Media Cybernetics, Inc., Rockville, MD, USA). Staining intensity was evaluated as follows: ‘0’ indicates no detectable positive staining; ‘1’ indicates very low density of positive staining; ‘2’ indicates a moderate density of positive staining; ‘3’ indicates higher, but not maximal, density of positive staining; ‘4’ indicates the highest density of positive staining.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted from intestinal samples using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer’s protocol. RNA quantity was determined according to spectrophotometric analysis (optical density260/280). RT was performed using a PrimeScript RT reagent kit (Takara Bio, Inc., Otsu, Japan). The RT temperature protocol parameters were as follows: 37°C for 15 min and 85°C for 15 sec. Forward and reverse oligonucleotide primers (Table I) were designed to amplify target genes, and were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). qPCR amplification was performed on an ABI 7500 PCR instrument (Applied Biosystems; Thermo Fisher Scientific, Inc.) using SYBR Green (Takara Bio, Inc.) according to the manufacturer’s protocol. PCR thermocycling conditions were as follows: 1 cycle of predenaturation at 95°C for 30 sec, followed by 40 cycles of denaturation at 95°C for 5 sec, annealing at 60°C for 30 sec and extension at 72°C for 30 sec, and a final step at 72°C for 10 min. β-actin mRNA was quantified as an endogenous control to calculate ΔCq using SDS software version 2.4.1 (Applied Biosystems; Thermo Fisher Scientific, Inc.). Results were calculated by using the 2−ΔΔCq method (17).

Table I

Polymerase chain reaction primer sequences.

Table I

Polymerase chain reaction primer sequences.

Target geneSense primer (5′ to 3′)Antisense primer (5′ to 3′)
IL-1β AACCTGCTGGTGTGTGACGTTC CAGCACGAGGCTTTTTTGTTGT
IL-6 ACAACCACGGCCTTCCCTACTT CACGATTTCCCAGAGAACATGTG
TNF-α CAGGCGGTGCCTATGTCTC CGATCACCCCGAAGTTCAGTAG
ICAM-1 CCTGATGGGCAGTCAACAGCTA ACAGCTGGCTCCCGTTTCA
MCP-1 CCACAGCATGGACGAATTCA AGCTTGCTTTGTGGCCTTCA
CCL-5 TCGTGCCCACGTCAAGGAGTATTT TCTTCTCTGGGTTGGCACACACTT
Nrf2 CAGTCTTCACCACCCCTGAT CTAATGGCAGCAGAGGAAGG
MnSOD CGTCATTCACTTCGAGCAGA CACCTTTGCCCAAGTCATCT
HO-1 ATGACACCAAGGACCAGAGC GTGTAAGGACCCATCGGAGA
β-actin GTGACGTTGACATCCGTAAAGA GCCGGACTCATCGTACTCC

[i] CCL-5, chemokine (C-C motif) ligand-5; HO-1, heme oxygenase 1; ICAM-1, intercellular adhesion molecule 1; IL, interleukin; MCP-1, monocyte chemotactic protein 1; MnSOD, manganese superoxide dismutase; Nrf2, nuclear factor (erythroid-derived 2)-like 2; TNF-α, tumor necrosis factor-α.

Western blot analysis

Total protein was extracted from intestinal samples in each group using radioimmunoprecipitation assay lysis buffer (EMD Millipore, Bedford, MA, USA) for 30 min. Following centrifugation at 12,000 × g for 10 min at 4°C, the supernatant was collected. Protein concentrations were quantified using an enhanced bicinchoninic acid (BCA) protein assay kit (Thermo Fisher Scientific, Inc.). All samples were diluted in loading buffer (Nanjing Sunshine Biotechnology Co., Ltd., Nanjing, China) and boiled at 95°C for 5 min. Total protein (20 µg) was separated by 10% SDS-PAGE and the fractionated proteins were electrotransferred to a polyvinylidene fluoride membrane. The membrane was blocked with 5% skim milk for 1 h at room temperature and probed with the following primary antibodies: Anti-nuclear factor (erythroid-derived 2)-like 2 (Nrf2; 1:1,000 dilution; cat. no. ab137550), anti-manganese super-oxide dismutase (MnSOD; 1:5,000 dilution; cat. no. ab13533), anti-heme oxygenase (HO)-1 (1:2,000 dilution; cat. no. ab189491) and anti-β-actin (1:10,000 dilution; cat. no. ab3280) (all Abcam) at 4°C overnight. Subsequently, the membrane was incubated with goat anti-rabbit (cat. no. HA1001-100) or goat anti-mouse (cat. no. HA1006) horseradish peroxidase-conjugated secondary antibodies (1:5,000; Hangzhou Hua’an Medical & Health Instruments Co., Ltd., Hangzhou, China) for 1 h at room temperature. Immunoreactive bands were detected using an enhanced chemiluminescence reagent (Pierce; Thermo Fisher Scientific, Inc.) and were visualized using Gel-Pro Analyzer gel image analysis software version 6.3 (Media Cybernetics, Inc.).

Myeloperoxidase (MPO) activity

The intestinal tissue homogenate was extracted from each group and the protein concentration of each supernatant was assessed as aforementioned. Tissue protein concentrations from different groups were measured using an enhanced BCA protein assay kit (Thermo Fisher Scientific, Inc.). MPO activity in tissue homogenates was analyzed using a detection kit according to the manufacturer’s protocol (cat. no. A044; Nanjing Jiancheng Bioengineering Institute, Nanjing, China). MPO activity was expressed as U/mg tissue, and 1 unit of MPO activity represents the amount of enzyme degrading 1 µmol H2O2/min at 25°C.

ELISA analysis

Blood samples were collected from the hearts of mice prior to sacrifice and were centrifuged at 6,000 × g for 5 min at 4°C. Serum levels of interleukin (IL)-1β were quantified using an ELISA kit (cat. no. ab197742; Abcam) according to the manufacturer’s protocol. Absorbance was measured at 450 nm, and concentration of the target protein was determined according to the standard curve. Protein levels were expressed as pg/mg protein.

Malondialdehyde (MDA) content and superoxide dismutase (SOD) activity

Intestinal tissue levels of oxidative stress (OS) were indirectly assessed using MDA content and SOD activity assays. Intestine samples from each group were homogenized in cold saline, with a weight-to-volume ratio of 1:9, and the homogenate was centrifuged at 12,000 × g for 10 min at 4°C. The protein concentration in the supernatant was determined using the enhanced bicinchoninic acid protein assay kit (Thermo Fisher Scientific, Inc.). Measurements of MDA content and SOD activity in tissue homogenates were determined using detection kits (cat. nos. A003-1 and A001-1-1; Nanjing Jiancheng Biological Engineering Institute) according to the manufacturer’s protocol.

Statistical analyses

Statistical analysis was performed using SPSS 16.0 (SPSS, Inc., Chicago, IL, USA). Data were analyzed by one-way analysis of variance followed by post hoc Tukey’s test. All data are representative of at least three independent experiments. Quantitative data are presented as the mean ± standard deviation. P<0.05 was considered to indicate a statistically significant difference.

Results

Histopathological alterations in the intestinal mucosa

Histopa thological examination indicated that morphology of the intestinal mucosa was intact in the sham group. Conversely, mucosal damage was detected as early as 2 h after ICH; shed ding of epithelial cells from the top of villi, intestinal villi thickening and decurtation were detected. Furthermore, fusion of adjacent villi, inflammatory cell infiltration, exposed lamina propria and damaged villus tip were detected at 24 h and the histopathological alterations persisted for 7 days (Fig. 1).

Figure 1

Hematoxylin and eosin staining of intestinal samples under light microscopy. Images were captured from the sham group and at various time-points post-ICH. Photomicrographs (magnification, ×100) of the ileum of the (A) sham group, and the (B) 2 h, (C) 24 h and (D) 7 day ICH groups. (E) Chiu intestinal injury scores were determined. Scale bar, 100 µm. **P<0.01 vs. the sham group. ICH, intracerebral hemorrhage.

Small intestinal motility

Intestinal impelling force was significantly lower in all ICH groups compared with in the sham group (P<0.05). The lowest level was detected 12 h after ICH and the impelling force remained significantly reduced until day 7 following ICH (Fig. 2).

Figure 2

Effects of ICH on gastrointestinal transit in mice. Alterations in gastrointestinal transit were determined in the sham group, and in the ICH group at various time-points, by charcoal meal test. *P<0.05, **P<0.01 vs. the sham group. ICH, intracerebral hemorrhage.

Intestinal barrier dysfunction

Plasma levels of endotoxin are considered the hallmark of intestinal permeability and barrier function. Plasma endotoxin levels were markedly increased 2 h following ICH, and the levels peaked at 24 h. Notably, plasma endotoxin levels declined on day 7; however, they were still significantly higher compared with in the sham group (Fig. 3; P<0.05).

Figure 3

Determination of gut barrier dysfunction following ICH. Gut barrier function was evaluated by detecting plasma levels of endotoxin in the sham group, and in the ICH group at various time-points. Data are representative of three independent experiments.*P<0.05, **P<0.01 vs. the sham group. ICH, intracerebral hemorrhage.

mRNA expression levels of inflammatory cytokines

The mRNA profile of intestinal inflammatory cytokines was significantly altered post-ICH. IL-1β, IL-6 and tumor necrosis factor (TNF)-α are important proinflammatory cytokines, which are considered molecular markers of inflammatory responses (18,19). The mRNA expression levels of IL-6 and TNF-α were significantly elevated after ICH at each time-point (P<0.05). However, the mRNA expression levels of IL-1β were not significantly increased 2 h and 7 days post-ICH (P>0.05). ICAM-1 is a member of the immunoglobulin superfamily, which may initiate adhesion and infiltration of leukocytes into the lesion site, leading to damage. In the present study, ICAM-1 expression was elevated as early as 2 h post-ICH and was increased for 7 days (P<0.05). Chemokines, including monocyte chemotactic protein (MCP)-1 and chemokine (C-C motif) ligand (CCL)-5, participate in the inflammatory process by promoting the infiltration and chemotactic activation of inflammatory cells in lesions. In the present study, MCP-1 and CCL-5 in the ICH groups were also significantly elevated compared with in the sham group (P<0.05); however, CCL-5 mRNA expression was not significantly increased on day 7 post-ICH (Fig. 4). These results indicated that ICH may induce rapid and persistent upregulation of inflammatory cytokines in the intestine.

Figure 4

Analysis of inflammatory cytokine expression in intestinal tissue following ICH. (A) IL-1β, (B) IL-6, (C) TNF-α, (D) ICAM-1, (E) MCP-1 and (F) CCL-5 mRNA expression was detected in the sham group, and in the ICH group at various time-points, by quantitative polymerase chain reaction. β-actin served as a loading control. Data are representative of three independent experiments. *P<0.05, **P<0.01 vs. the sham group. CCL-5, chemokine (C-C motif) ligand-5; ICAM-1, intercellular adhesion molecule 1; ICH, intracerebral hemorrhage; IL, interleukin; MCP-1, monocyte chemotactic protein 1; TNF-α, tumor necrosis factor-α.

Expression of ICAM-1 in intestinal tissue

ICAM-1 immunoreactivity was almost undetectable in the sham group. However, strong ICAM-1 immunoreactivity was observed in the intestine 12 or 24 h after ICH (P<0.05). Furthermore, ICAM-1 immunoreactivity remained increased on day 7 post-ICH compared with in the sham group (Fig. 5).

Figure 5

Detection of ICAM-1 at selected time-points by immunohistochemistry. Intestinal tissue sections from the (A) sham group, and the (B) 12h, (C) 24 h and (D) 7 day ICH groups were immunostained with anti-ICAM-1. ICAM-1 staining (brown) is visible in clusters in the intestine. (E) Staining intensity was determined. Scale bar, 100 µm. *P<0.05, **P<0.01 vs. the sham group. ICAM-1, intercellular adhesion molecule 1; ICH, intracerebral hemorrhage.

MPO activity

MPO is an enzyme that is abundantly stored in azurophilic granules of neutrophils. MPO activity is a prognostic hallmark of inflammatory response in various acute and chronic inflammatory conditions (20,21). In the present study, MPO activity was significantly increased in ICH mice compared with in the sham mice at each time-point. In addition, MPO activity on day 7 was still higher than that in the sham group (Fig. 6).

Figure 6

Effects of ICH on MPO activity in intestinal tissue. Intestinal MPO activity was detected at indicated time-points following ICH and was compared with the sham group. Data are representative of three independent experiments. **P<0.01 vs. the sham group. ICH, intracerebral hemorrhage; MPO, myeloperoxidase.

Circulating IL-1β levels

ICH significantly altered the circulating levels of the cytokine, IL-1β. Following ICH, serum IL-1β levels were significantly elevated compared with in the sham group; however, this difference was not statistically significant at 2 h (P>0.05). On day 7 post-ICH, serum IL-1β levels were still significantly elevated compared with in the sham mice (Fig. 7).

Figure 7

Alterations in circulating IL-1β levels at 2, 6, 12 and 24 h, and 3 and 7 days after ICH compared with in the sham group. Serum IL-1β levels were significantly increased from 6 h, peaked at 24 h, and persisted for 7 days post-ICH. Data are representative of three independent experiments. **P<0.01 vs. the sham group. ICH, intracerebral hemorrhage; IL-1β, interleukin-1β.

Intestinal reactive oxygen species (ROS) levels

To analyze whether ICH induces intestinal OS in mice, ROS levels were measured indirectly, by determining MDA content and SOD activity. MDA levels were significantly elevated following ICH; elevation was detected as early as 2 h post-ICH and remained higher on day 7 compared with in the sham group. Conversely, SOD activity was significantly reduced by ICH (Fig. 8). These results indicated that ICH may markedly increase intestinal ROS levels in mice.

Figure 8

Measurement of oxidative stress markers following ICH. (A) MDA content and (B) SOD activity were measured in the sham group, and in the ICH group at various time-points. Data are representative of three independent experiments. **P<0.01 vs. the sham group. ICH, intracerebral hemorrhage; MDA, malondialdehyde; SOD, superoxide dismutase.

mRNA and protein expression levels of antioxidants

The mRNA expression levels of the antioxidant enzymes, Nrf2, MnSOD and HO-1, were significantly increased in the intestinal samples from ICH mice compared with in the sham group, particularly at 12 and 24 h post-ICH. To analyze the protein levels of these antioxidant enzymes in the intestine, the protein expression levels of Nrf2, MnSOD and HO-1 were detected in the intestinal tissue of the various groups by western blot analysis. The protein expression levels of Nrf2, MnSOD and HO-1 were also markedly increased in the ICH mice compared with in the sham mice. Nrf2 and HO-1, but not MnSOD, levels remained higher in the ICH group at day 7 compared with in the sham group (P<0.05; Fig. 9).

Figure 9

Analysis of antioxidant levels in intestinal tissues following ICH. (A) Quantitative polymerase chain reaction and (B) western blotting were used to detect the mRNA and protein expression levels of the following antioxidants: Nrf2, MnSOD, and HO-1. mRNA and protein expression were detected in the sham group, and in the ICH group at various time-points. β-actin served as a loading control. Data are representative of three independent experiments. *P<0.05, **P<0.01 vs. the sham group. HO-1, heme oxygenase 1; ICH, intracerebral hemorrhage; MnSOD, manganese superoxide dismutase; Nrf2, nuclear factor (erythroid-derived 2)-like 2.

Discussion

Compared with intestinal injury following ischemic stroke or traumatic brain injury (TBI), few studies have focused on intestinal injury post-ICH, particularly in experimental research. Clinically, Misra et al (4) reported that the frequency of GI bleeding post-ICH in India was 30%, and Yang et al (5) revealed that the prevalence of GI bleeding after ICH was 26.7% in a retrospective review of 808 cases in China. Furthermore, Yang et al (5) indicated that patients with GI bleeding had significantly longer hospital stays and increased in-hospital mortality compared with patients without GI bleeding. However, the pathophysiological intestinal alterations following ICH and the molecular mechanism involved in triggering the inflammatory response and OS are unclear. On the basis of experiments in mice, the present study systematically indicated that ICH could induce significant intestinal damage, which occurred as early as 2 h post-ICH and lasted for 7 days. In the present study, ICH induced significant gut mucosal damage, barrier dysfunction, delayed small intestinal motility, inflammatory responses characterized by leukocyte infiltration into the intestinal tissue, elevated levels of inflammatory cytokines in intestinal tissue and serum, and OS characterized by indirect ROS levels and antioxidant gene levels.

Stressful events can induce alterations in gut mucosa, barrier function and small intestinal motility. To the best of our knowledge, no previous studies regarding intestinal mucosa structure and barrier function post-ICH have been conducted. The present study demonstrated that damage to the intestinal mucosa occurred rapidly, as early as 2 h post-ICH, and persisted for 7 days. The observed morphological alterations in the gut mucosa included intestinal villi engorgement, thickening, decurtation, fusion of adjacent villi, inflammatory cell infiltration, exposed lamina propria and damaged villus tip. Recovery of small intestinal motility is considered a vital hallmark of clinical outcome following ICH. In a previous study, gastrointestinal motility alterations were investigated in a model of middle cerebral artery occlusion (MCAO)-induced intestinal injury; decreased small intestinal motility was confirmed within 48 h of MCAO (12). In the present study, the intestinal impelling ratio was significantly lower in the ICH groups compared with in the sham group. The results indicated that ICH may induce weakening in the tension of the lower esophageal sphincter, descent of gastric contraction and emptying function, and depression of gastrointestinal motility. In addition, gastrointestinal motility, both 2 h and 7 days post-ICH, was significantly lower than in the sham group, thus suggesting that intestinal dyskinesis occurs in the early stage of ICH and persists for a long period.

Impaired gut barrier function can increase intestinal permeability and translocation of endotoxin. The present study detected significantly increased plasma levels of endotoxin, with peaks detected at 2 and 12 h post-ICH. Hang et al (11) hypothesized the reason for this phenomenon in a TBI-induced gastrointestinal dysfunction study; it was suggested that the first peak may be due to excited sympathetic nerve-induced acute gut mucosal damage. Subsequently, the plasma levels of endotoxin may slightly decline due to recovery of liver antitoxic function and lipopolysaccharide antibodies. Finally, the second peak may be associated with severe mucosal damage, which usually occurs at later stages following a brain event. In addition, previous studies (22,23) have reported that endotoxin may not only ultimately induce breakdown of the intestinal mucosal barrier, potentially resulting in lethal SIRS and MODS, but may also lead to inflammatory cell infiltration in the brain and breakdown of the blood-brain barrier via inducing production and release of proinflammatory cytokines by tissue macrophages and circulating monocytes.

To understand the molecular mechanism underlying ICH-induced intestinal injury, the present study focused on two potential mechanisms. Firstly, the inflammatory response was analyzed by detecting the expression levels of IL-1β, IL-6, TNF-α, ICAM-1, MCP-1 and CCL-5, MPO activity in intestinal tissue, and serum levels of IL-1β. The gut is a core organ where the inflammatory response occurs with the release of various inflammatory cytokines under stressful conditions, which has a potent impact on the small intestine. Notably, the inflammatory response may not only affect the gut itself, but may also influence the function and integrity of remote organs and tissues, including the brain, thus inducing SIRS and MODS. The gut has been labeled the ‘trigger’ of inflammatory responses under severe stress, which are mainly mediated by various inflammatory cytokines. Previous studies (24,25) indicated that TBI could induce a rapid and persistent inflammatory response, which was associated with the upregulation of proinflammatory cyto-kines in the gut, including nuclear factor-κB, TNF-α, IL-6 and ICAM-1. Consistent with these findings, a significant increase in the mRNA and protein expression levels of proinflammatory cytokines (IL-1β, IL-6, TNF-α, ICAM-1, MCP-1 and CCL-5) was detected using RT-qPCR, immunohistochemistry and ELISA at various time-points in the intestine and serum of ICH mice in the present study. Furthermore, detection of MPO activity confirmed that an inflammatory response had been induced. The majority of these inflammatory cytokines rapidly increased as early as 2 h post-ICH and persisted for 7 days. Notably, among these cytokines, IL-1β, IL-6 and TNF-α can initiate the infiltration of inflammatory cells into the intestine by activating ICAM-1 and other chemokines, including MCP-1 and CCL-5, and vice versa (26). Numerous studies have demonstrated that the release of inflammatory cytokines induces a delay in small intestinal motility, and intestinal obstruction (27–30). In addition, inflammatory cytokines exert cytotoxic effects that induce damage to microvilli, resulting in destruction of intercellular tight junctions and increased intestinal barrier dysfunction (31,32). Taken together, the present study suggested that ICH could significantly increase the inflammatory response in the intestine through increased release of inflammatory cytokines, MPO activity, and peripheral circulating concentrations of IL-1β. Therefore, the intestinal inflammatory response may be responsible for intestinal injury, and may serve an important role in the pathogenesis of gut mucosal damage, small intestinal motility and barrier dysfunction.

Secondly, the present study revealed that ICH triggered a pathological intestinal imbalance between oxidant and antioxidant systems. OS mediators, including ROS, which cause lipid peroxidation, protein oxidation, inhibition of mitochondrial activity, and increased membrane permeability of the cell and lysosome, lead to cell swelling/rupture. As a product of lipid peroxidation induced by ROS, MDA content can indirectly reflect the degree of OS. Under normal conditions, ROS may be cleared by antioxidants, including SOD. Redundant oxygen free radicals are generated during periods of ischemia followed by reperfusion in the ICH-induced intestine, leading to excessive MDA accumulation and SOD consumption. In the present study, MDA levels were significantly increased in the ICH group compared with in the sham group. Conversely, SOD activity was markedly reduced. Nrf2, which is a key endogenous regulator of cellular defense against OS, is a positive regulator of the antioxidant response element that modulates the expression of numerous genes and mobilizes the internal antioxidant system, including antioxidant genes (MnSOD and HO-1) (33,34). Consistent with the aforementioned results regarding MDA and SOD, the mRNA and protein expression levels of Nrf2, MnSOD and HO-1 were increased following ICH in the intestine, further indicating that OS was activated and served a critical role in ICH-induced intestinal damage. Notably, Jin et al (35,36) reported that Nrf2-deficient mice were more susceptible to TBI-induced acute intestinal mucosal injury than wild-type Nrf2+/+ mice, as characterized by decreased intestinal mRNA expression and antioxidant enzyme activities. These findings indicated that an oxidant-antioxidant imbalance participates in the pathogenesis of ICH-induced intestinal injury.

It should be noted that OS is not a secondary event that results from the inflammatory response. OS is now thought to contribute to, rather than result from, the inflammatory response. Previous studies have reported that antioxidant genes, particularly the key upstream transcription factor Nrf2, serve a critical role in counteracting inflammation during tissue injury in various experimental models (35–38). These studies have indicated that increased Nrf2 activity has an important protective role in limiting tissue inflammatory response and injury. Notably, our previous study demonstrated that Nrf2, and its downstream antioxidant genes, were significantly increased in the ICH rat brain, and activation of Nrf2 may represent a potential target for treatment of brain injury following ICH (39). Therefore, it is hypothesized that Nrf2 may be considered a novel therapeutic target for the systematic treatment of not only ICH-induced brain damage but also intestinal injury. Further studies using Nrf2 overexpression or Nrf2 knockout mice are required to examine the exact role of Nrf2 in animal models of ICH-induced intestinal injury.

In conclusion, the results of the present study systematically demonstrated that ICH may markedly induce gut mucosal damage, barrier dysfunction, delayed small intestinal motility, inflammatory response and OS in the intestine. To the best of our knowledge, the present study is the first to elucidate the pathophysiological intestinal alterations that occur following ICH. Ultimately, based on a better understanding of the physiological and pathological processes of ICH-induced intestinal injury, strategies that attenuate the severe complication of intestinal injury-induced SIRS and MODS following severe ICH will be a vital therapeutic target for future ICH research.

Acknowledgments

The present study was supported by the Natural Science Fund (grant nos. 14ZR1426000 and 16ZR14212000) from the Science and Technology Commission of Shanghai Municipality.

Competing interests

The authors declare that they have no competing interests to disclose.

References

1 

Keep RF, Hua Y and Xi G: Intracerebral haemorrhage: Mechanisms of injury and therapeutic targets. Lancet Neurol. 11:720–731. 2012. View Article : Google Scholar : PubMed/NCBI

2 

Adeoye O and Broderick JP: Advances in the management of intracerebral hemorrhage. Nat Rev Neurol. 6:593–601. 2010. View Article : Google Scholar : PubMed/NCBI

3 

Lu WY, Rhoney DH, Boling WB, Johnson JD and Smith TC: A review of stress ulcer prophylaxis in the neurosurgical intensive care unit. Neurosurgery. 41:416–425; discussion 425–426. 1997. View Article : Google Scholar : PubMed/NCBI

4 

Misra UK, Kalita J, Pandey S and Mandal SK: Predictors of gastrointestinal bleeding in acute intracerebral haemorrhage. J Neurol Sci. 208:25–29. 2003. View Article : Google Scholar : PubMed/NCBI

5 

Yang TC, Li JG, Shi HM, Yu DM, Shan K, Li LX, Dong XY and Ren TH: Gastrointestinal bleeding after intracerebral hemorrhage: A retrospective review of 808 cases. Am J Med Sci. 346:279–282. 2013. View Article : Google Scholar

6 

Shinohara Y, Yanagihara T, Abe K, Yoshimine T, Fujinaka T, Chuma T, Ochi F, Nagayama M, Ogawa A, Suzuki N, et al: III. Intracerebral hemorrhage. J Stroke Cerebrovasc Dis. 20(Suppl 4): S74–S99. 2011. View Article : Google Scholar : PubMed/NCBI

7 

Wang WJ, Lu JJ, Wang YJ, Wang CX, Wang YL, Hoff K, Yang ZH, Liu LP, Wang AX and Zhao XQ; China National Stroke Registry (CNSR): Clinical characteristics, management, and functional outcomes in Chinese patients within the first year after intracerebral hemorrhage: Analysis from China National Stroke Registry. CNS Neurosci Ther. 18:773–780. 2012. View Article : Google Scholar : PubMed/NCBI

8 

Li X, Hammer AM, Rendon JL and Choudhry MA: Intestine immune homeostasis after alcohol and burn injury. Shock. 43:540–548. 2015. View Article : Google Scholar : PubMed/NCBI

9 

Phillips NA, Welc SS, Wallet SM, King MA and Clanton TL: Protection of intestinal injury during heat stroke in mice by interleukin-6 pretreatment. J Physiol. 593:739–753. 2015. View Article : Google Scholar :

10 

Timmermans K, Sir Ö, Kox M, Vaneker M, de Jong C, Gerretsen J, Edwards M, Scheffer GJ and Pickkers P: Circulating iFABP Levels as a marker of intestinal damage in trauma patients. Shock. 43:117–120. 2015. View Article : Google Scholar

11 

Hang CH, Shi JX, Li JS, Wu W and Yin HX: Alterations of intestinal mucosa structure and barrier function following traumatic brain injury in rats. World J Gastroenterol. 9:2776–2781. 2003. View Article : Google Scholar : PubMed/NCBI

12 

Xu X, Zhu Y and Chuai J: Changes in serum ghrelin and small intestinal motility in rats with ischemic stroke. Anat Rec (Hoboken). 295:307–312. 2012. View Article : Google Scholar

13 

Low G, Jaremko JL and Lomas DJ: Extravascular complications following abdominal organ transplantation. Clin Radiol. 70:898–908. 2015. View Article : Google Scholar : PubMed/NCBI

14 

Doig CJ, Sutherland LR, Sandham JD, Fick GH, Verhoef M and Meddings JB: Increased intestinal permeability is associated with the development of multiple organ dysfunction syndrome in critically ill ICU patients. Am J Respir Crit Care Med. 158:444–451. 1998. View Article : Google Scholar : PubMed/NCBI

15 

National Research Council: Guide for the care and use of laboratory animals. 8th edition. National Academies Press; Washington DC: pp. 1–246. 2011

16 

Chiu CJ, McArdle AH, Brown R, Scott HJ and Gurd FN: Intestinal mucosal lesion in low-flow states. I. A morphological, hemodynamic, and metabolic reappraisal. Arch Surg. 101:478–483. 1970. View Article : Google Scholar : PubMed/NCBI

17 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods. 25:402–408. 2001. View Article : Google Scholar

18 

Molmenti EP, Ziambaras T and Perlmutter DH: Evidence for an acute phase response in human intestinal epithelial cells. J Biol Chem. 268:14116–14124. 1993.PubMed/NCBI

19 

Liu XH, Yang YW, Dai HT, Cai SW, Chen RH and Ye ZQ: Protective role of adiponectin in a rat model of intestinal ischemia reperfusion injury. World J Gastroenterol. 21:13250–13258. 2015. View Article : Google Scholar : PubMed/NCBI

20 

Arndt H, Kubes P, Grisham MB, Gonzalez E and Granger DN: Granulocyte turnover in the feline intestine. Inflammation. 16:549–559. 1992. View Article : Google Scholar : PubMed/NCBI

21 

Nussbaum C, Klinke A, Adam M, Baldus S and Sperandio M: Myeloperoxidase: A leukocyte-derived protagonist of inflammation and cardiovascular disease. Antioxid Redox Signal. 18:692–713. 2013. View Article : Google Scholar

22 

Xue B, Kasparek MS, Müller MH and Kreis ME: Modulation of intestinal afferent nerve sensitivity to inflammatory mediators following systemic endotoxin in mice. Neurogastroenterol Motil. 27:550–558. 2015. View Article : Google Scholar : PubMed/NCBI

23 

Bohatschek M, Werner A and Raivich G: Systemic LPS injection leads to granulocyte influx into normal and injured brain: Effects of ICAM-1 deficiency. Exp Neurol. 172:137–152. 2001. View Article : Google Scholar : PubMed/NCBI

24 

Hang CH, Shi JX, Li JS, Li WQ and Wu W: Expressions of intestinal NF-kappaB, TNF-α, and IL-6 following traumatic brain injury in rats. J Surg Res. 123:188–193. 2005. View Article : Google Scholar : PubMed/NCBI

25 

Hang CH, Shi JX, Li JS, Li WQ and Yin HX: Upregulation of intestinal nuclear factor kappa B and intercellular adhesion molecule-1 following traumatic brain injury in rats. World J Gastroenterol. 11:1149–1154. 2005. View Article : Google Scholar : PubMed/NCBI

26 

Hang CH, Shi JX, Tian J, Li JS, Wu W and Yin HX: Effect of systemic LPS injection on cortical NF-kappaB activity and inflammatory response following traumatic brain injury in rats. Brain Res. 1026:23–32. 2004. View Article : Google Scholar : PubMed/NCBI

27 

Kalff JC, Schraut WH, Billiar TR, Simmons RL and Bauer AJ: Role of inducible nitric oxide synthase in postoperative intestinal smooth muscle dysfunction in rodents. Gastroenterology. 118:316–327. 2000. View Article : Google Scholar : PubMed/NCBI

28 

Wehner S, Vilz TO, Stoffels B and Kalff JC: Immune mediators of postoperative ileus. Langenbecks Arch Surg. 397:591–601. 2012. View Article : Google Scholar : PubMed/NCBI

29 

The FO, de Jonge WJ, Bennink RJ, van den Wijngaard RM and Boeckxstaens GE: The ICAM-1 antisense oligonucleotide ISIS-3082 prevents the development of postoperative ileus in mice. Br J Pharmacol. 146:252–258. 2005. View Article : Google Scholar : PubMed/NCBI

30 

Wehner S, Schwarz NT, Hundsdoerfer R, Hierholzer C, Tweardy DJ, Billiar TR, Bauer AJ and Kalff JC: Induction of IL-6 within the rodent intestinal muscularis after intestinal surgical stress. Surgery. 137:436–446. 2005. View Article : Google Scholar : PubMed/NCBI

31 

Marchiando AM, Shen L, Graham WV, Weber CR, Schwarz BT, Austin JR II, Raleigh DR, Guan Y, Watson AJ, Montrose MH, et al: Caveolin-1-dependent occludin endocytosis is required for TNF-induced tight junction regulation in vivo. J Cell Biol. 189:111–126. 2010. View Article : Google Scholar : PubMed/NCBI

32 

Turner JR: ‘Putting the squeeze’ on the tight junction: Understanding cytoskeletal regulation. Semin Cell Dev Biol. 11:301–308. 2000. View Article : Google Scholar : PubMed/NCBI

33 

Giudice A, Arra C and Turco MC: Review of molecular mechanisms involved in the activation of the Nrf2-ARE signaling pathway by chemopreventive agents. Methods Mol Biol. 647:37–74. 2010. View Article : Google Scholar : PubMed/NCBI

34 

Nguyen T, Nioi P and Pickett CB: The Nrf2-antioxidant response element signaling pathway and its activation by oxidative stress. J Biol Chem. 284:13291–13295. 2009. View Article : Google Scholar : PubMed/NCBI

35 

Jin W, Wang H, Ji Y, Hu Q, Yan W, Chen G and Yin H: Increased intestinal inflammatory response and gut barrier dysfunction in Nrf2-deficient mice after traumatic brain injury. Cytokine. 44:135–140. 2008. View Article : Google Scholar : PubMed/NCBI

36 

Jin W, Wang HD, Hu ZG, Yan W, Chen G and Yin HX and Yin HX: Transcription factor Nrf2 plays a pivotal role in protection against traumatic brain injury-induced acute intestinal mucosal injury in mice. J Surg Res. 157:251–260. 2009. View Article : Google Scholar : PubMed/NCBI

37 

Rangasamy T, Guo J, Mitzner WA, Roman J, Singh A, Fryer AD, Yamamoto M, Kensler TW, Tuder RM, Georas SN, et al: Disruption of Nrf2 enhances susceptibility to severe airway inflammation and asthma in mice. J Exp Med. 202:47–59. 2005. View Article : Google Scholar : PubMed/NCBI

38 

Lee JM and Johnson JA: An important role of Nrf2-ARE pathway in the cellular defense mechanism. J Biochem Mol Biol. 37:139–143. 2004.PubMed/NCBI

39 

Shang H, Yang D, Zhang W, Li T, Ren X, Wang X and Zhao W: Time course of Keap1-Nrf2 pathway expression after experimental intracerebral haemorrhage: Correlation with brain oedema and neurological deficit. Free Radic Res. 47:368–375. 2013. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Cheng Y, Zan J, Song Y, Yang G, Shang H and Zhao W: Evaluation of intestinal injury, inflammatory response and oxidative stress following intracerebral hemorrhage in mice. Int J Mol Med 42: 2120-2128, 2018.
APA
Cheng, Y., Zan, J., Song, Y., Yang, G., Shang, H., & Zhao, W. (2018). Evaluation of intestinal injury, inflammatory response and oxidative stress following intracerebral hemorrhage in mice. International Journal of Molecular Medicine, 42, 2120-2128. https://doi.org/10.3892/ijmm.2018.3755
MLA
Cheng, Y., Zan, J., Song, Y., Yang, G., Shang, H., Zhao, W."Evaluation of intestinal injury, inflammatory response and oxidative stress following intracerebral hemorrhage in mice". International Journal of Molecular Medicine 42.4 (2018): 2120-2128.
Chicago
Cheng, Y., Zan, J., Song, Y., Yang, G., Shang, H., Zhao, W."Evaluation of intestinal injury, inflammatory response and oxidative stress following intracerebral hemorrhage in mice". International Journal of Molecular Medicine 42, no. 4 (2018): 2120-2128. https://doi.org/10.3892/ijmm.2018.3755
Copy and paste a formatted citation
x
Spandidos Publications style
Cheng Y, Zan J, Song Y, Yang G, Shang H and Zhao W: Evaluation of intestinal injury, inflammatory response and oxidative stress following intracerebral hemorrhage in mice. Int J Mol Med 42: 2120-2128, 2018.
APA
Cheng, Y., Zan, J., Song, Y., Yang, G., Shang, H., & Zhao, W. (2018). Evaluation of intestinal injury, inflammatory response and oxidative stress following intracerebral hemorrhage in mice. International Journal of Molecular Medicine, 42, 2120-2128. https://doi.org/10.3892/ijmm.2018.3755
MLA
Cheng, Y., Zan, J., Song, Y., Yang, G., Shang, H., Zhao, W."Evaluation of intestinal injury, inflammatory response and oxidative stress following intracerebral hemorrhage in mice". International Journal of Molecular Medicine 42.4 (2018): 2120-2128.
Chicago
Cheng, Y., Zan, J., Song, Y., Yang, G., Shang, H., Zhao, W."Evaluation of intestinal injury, inflammatory response and oxidative stress following intracerebral hemorrhage in mice". International Journal of Molecular Medicine 42, no. 4 (2018): 2120-2128. https://doi.org/10.3892/ijmm.2018.3755
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team