Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
June-2019 Volume 43 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
June-2019 Volume 43 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Identification of lncRNA and mRNA expression profiles in rat spinal cords at various time‑points following cardiac ischemia/reperfusion

  • Authors:
    • Qian Wang
    • Zhi‑Xiao Li
    • Yu‑Juan Li
    • Zhi‑Gang He
    • Ying‑Le Chen
    • Mao‑Hui Feng
    • Shun‑Yuan Li
    • Duo‑Zhi Wu
    • Hong‑Bing Xiang
  • View Affiliations / Copyright

    Affiliations: Department of Anesthesiology and Pain Medicine, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Hubei 430030, P.R. China, Department of Emergency Medicine, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Hubei 430030, P.R. China, Department of Anesthesiology, The First Affiliated Quanzhou Hospital of Fujian Medical University, Quanzhou, Fujian 362000, P.R. China, Department of Oncology, Wuhan Peritoneal Cancer Clinical Medical Research Center, Zhongnan Hospital of Wuhan University, Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, Wuhan, Hubei 430071, P.R. China, Department of Anesthesiology, People's Hospital of Hainan Province, Haikou, Hainan 570311, P.R. China
    Copyright: © Wang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 2361-2375
    |
    Published online on: March 29, 2019
       https://doi.org/10.3892/ijmm.2019.4151
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The identification of the expression patterns of long non‑coding RNAs (lncRNAs) and mRNAs in the spinal cord under normal and cardiac ischemia/reperfusion (I/R) conditions is essential for understanding the genetic mechanisms underlying the pathogenesis of cardiac I/R injury. The present study used high‑throughput RNA sequencing to investigate differential gene and lncRNA expression patterns in the spinal cords of rats during I/R‑induced cardiac injury. Male Sprague Dawley rats were assigned to the following groups: i) Control; ii) 2 h (2 h post‑reperfusion); and iii)v0.5 h (0.5 h post‑reperfusion). Further mRNA/lncRNA microarray analysis revealed that the expression profiles of lncRNA and mRNA in the spinal cords differed markedly between the control and 2 h groups, and in total 7,980 differentially expressed (>2‑fold) lncRNAs (234 upregulated, 7,746 downregulated) and 3,428 mRNAs (767 upregulated, 2,661 downregulated) were identified. Reverse transcription‑quantitative polymerase chain reaction analysis was performed to determine the expression patterns of several lncRNAs. The results indicated that the expression levels of lncRNA NONRATT025386 were significantly upregulated in the 2 and 0.5 h groups when compared with those in the control group, whereas the expression levels of NONRATT016113, NONRATT018298 and NONRATT018300 were elevated in the 2 h group compared with those in the control group; however, there was no statistically significant difference between the 0.5 h and control groups. Furthermore, the expression of lncRNA NONRATT002188 was significantly downregulated in the 0.5 and 2 h groups when compared with the control group. The present study determined the expression pattern of lncRNAs and mRNAs in rat spinal cords during cardiac I/R. It was suggested that lncRNAs and mRNAs from spinal cords may be novel therapeutic targets for the treatment of I/R‑induced cardiac injury.

Introduction

Cardiac ischemia/reperfusion (I/R) injury is associated with various etiological factors (1-3), including primary heart conditions, and neuropathic, vascular or systemic disorders. However, the pathological origin of I/R-induced cardiomyocyte death remains poorly understood. The neuropathic accumulation associated with myocardial I/R is thought to directly or indirectly activate sensory or sympathetic fibers that innervate the heart. However, as the underlying heart-specific neuronal pathway and mechanism are unknown, neurogenic therapeutic interventions often only have limited success.

It is well established that the autonomic nervous system serves a crucial physiological role in regulating cardiac function (4-9). Previous studies have demonstrated that some myocardial ischemic events are triggered by the autonomic nervous system, and a sympathetic-parasympathetic imbalance may lead to the pathophysiological development of myocardial ischemia (10,11). Our previous study revealed that an injection of retrograde tracer pseudorabies virus (PRV)-614 into the left ventricle wall in mice resulted in the retrograde infection of neurons in the intermediolateral nucleus of the spinal cord and the rostral ventrolateral medulla of the brainstem via the sympathetic pathway (12). The spinal cord has been implicated in the pathogenesis of cardiac injury caused by I/R (4,13-16). Furthermore, there is convincing evidence that the heart receives dense innervation from sensory afferent fibers, which peripherally release a variety of vasodilator neuropeptides, such as calcitonin gene-related peptide (CGRP) (17) and substance P (SP), in response to local stimuli (18). Despite extensive research in this area, the mechanisms underlying cardiac I/R injury are largely unknown. Therefore, there is an urgent requirement for more information and a genomic approach may prove helpful.

High-throughput RNA sequencing (RNA-seq) is a powerful tool that has been used to identify novel protein-coding and non-coding RNA transcripts involved in the regulation of gene expression (19-24). Recent research has focused on the cardiac long non-coding RNAs (lncRNAs) implicated in cardiac I/R injury (25-29); however, few studies have explored the important role of the spinal cord during focal cardiac I/R. Therefore, the present study was designed to identify the expression patterns of differentially expressed lncRNAs and mRNAs in the spinal cord under normal and cardiac I/R conditions, with the aim to gain a better understanding of the genetic mechanisms underlying the pathogenesis of cardiac I/R injury. The present study also determined the expression levels of various genes in the spinal cord at different time-points during cardiac I/R injury.

Materials and methods

Animals

A total of 24 male Sprague Dawley (SD) rats aged 8-10 weeks (200-240 g; specific pathogen-free grade; no. 42000600010250) were supplied by the Experimental Animal Research Center of Hubei Province (Hubei, China). The present experiment protocol was approved by the Institutional Ethical Committee of Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology (Hubei, China; no. TJ-A20150804). All animals were humanely treated according to the National Institutes of Health Guide for the Care and Use of Laboratory Animals (revised 2011) and the Guide for the Care and Use of Laboratory Animals (National Academic Press, USA; revised 2011) (30). Animals were housed in compliance with the Specific Pathogen-Free Animal Criteria, and maintained at a standard temperature of 21-23°C and 65±5% humidity under a 12-h light/dark cycle condition, with ad libitum access to artificial feed (food and water).

Myocardial I/R injury model

Surgical procedures to establish the myocardial I/R injury model were performed according to previously described methods (31-33).

Experimental protocol
Experiment A

A total of 6 SD rats were randomly allocated into 2 groups. The model group (n=3) received 2 h reperfusion following 30-min occlusion of the left anterior descending coronary artery by pulling the reversible trap (I/R group). The control group (n=3) received the same surgical procedure, without any occlusion of the coronary artery and reperfusion (sham group). T1-T4 spinal cord samples were collected for RNA-seq and reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis.

Experiment B

A total of 18 SD rats were randomly assigned into 3 groups: i) A control group (n=6); ii) a 0.5 h group (0.5 h reperfusion following 30 min ischemia; n=6); and iii) a 2 h group (2 h reperfusion following 30 min ischemia; n=6). T1-T4 spinal cord segments were obtained for RT-qPCR analysis.

Tissue preparation and microarray gene expression analysis

The rats were sacrificed following the completion of the aforementioned experiments. Briefly, upon completion of the experiments, the rats were anesthetized by intraperitoneal injection with 100 mg/kg body weight ketamine and 10 mg/kg body weight xylazine (34). Then the rats were quickly decapitated to limit animal suffering and minimize the effects on the experimental results, and the T1-T4 spinal cord segments were immediately removed and frozen with liquid nitrogen for 1 min, then stored at −80°C until required. Total RNA from each animal was quantified using a mirVana miRNA Isolation kit (Ambion; Thermo Fisher Scientific, Inc., Waltham, MA, USA), and RNA integrity was assessed according to the manufacturer's protocol, which included standard denaturing agarose gel electrophoresis (35-37). For RNA-seq, the micro-array work was performed by CapitalBio Technology Co. Ltd. (Beijing, China), whereby 6 tissue samples (3 model group samples and 3 control group samples) were used for mRNA and lncRNA microarray analysis (38).

The present study used an Agilent Array platform for microarray analysis. Tissue preparation and microarray hybridization were performed based on the manufacturer's standard protocols (Agilent Technologies, Inc., Santa Clara, CA, USA) with minor modifications. Briefly, the mRNA was purified from the total RNA once the ribosomal RNA was removed using an mRNA-ONLY Eukaryotic mRNA Isolation kit (Epicentre; Illumina, Inc., San Diego, CA, USA). Each sample was then amplified and transcribed into fluorescent complementary RNA (cRNA) along the entire length of the transcripts using a random priming method (39). The labeled cRNAs were hybridized onto the mouse lncRNA Array v2.0 (8×60 K; Arraystar, Inc., Rockville, MD, USA). Then the arrays were scanned using a G2505C Scanner (Agilent Technologies, Inc.).

Bioinformatics analysis

Gene Ontology (GO) annotations were employed to investigate the differentially expressed mRNAs and lncRNAs in the T1-T4 spinal cord segments, according to the GO database (www.geneontology.org/). For the functions of genes and their products, the GO database describes 3 biological functional groups: Biological process, Cellular compartment, and Molecular function. The present study conducted GO functional enrichment analysis on the differentially expressed mRNAs involved in protein-protein interaction (PPI) networks. In addition, the key regulatory pathways in the spinal cord that respond to I/R-induced cardiac injury were also investigated using Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis (www.genome.jp/kegg) and STRING database (string-db.org).

RT-qPCR analysis

The present study extracted total RNA from the upper thoracic spinal cord segments (T1-T4) (40) using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to our previous research (35-37). The primers for RT-qPCR were designed based on the lncRNA sequences (Table I), and were synthesized and purified at Invitrogen (Thermo Fisher Scientific, Inc.). The RT reactions were performed using a iScript™ cDNA Synthesis kit (Bio-Rad Laboratories, Inc., Hercules, CA, USA). RT-qPCR was performed using a ABI StepOnePlusä Multicolor system with the SsoAdvanced™ Universal SYBR®-Green Supermix (Bio-Rad Laboratories, Hercules, Inc.). The PCR thermocy-cling conditions were as follows: Initial denaturation at 95°C for 1 min followed by 40 cycles of 95°C for 15 sec, 60°C for 15 sec and 72°C for 45 sec. Compared with the averages for the housekeeping gene (GAPDH), the data were quantified using the 2−∆∆Cq method for relative fold-change, as described previously (41).

Table I

Primer sequences for reverse transcriptase-quantitative polymerase chain reaction.

Table I

Primer sequences for reverse transcriptase-quantitative polymerase chain reaction.

A, Upregulated

GeneLength (bp)Forward (5′-3′)Reverse (5′-3′)
NONRATT02538686 GGGTCTGGGGTGGGCTAA GGAGGTTTCTGAGTGGGATGTG
NONRATT01611396 CCACAAGCGTCTCGGGATT AGCGAAAACAGTCATTTTAACCAA
NONRATT018298166 GACAGTCAACGGAACCAAACTAA CGTGAACAAAAGCAAGCAAAC
NONRATT018300178 GCCAACAACCAGTAAGAACCAC CCATACCTTTGCTACTTTGGAGA
NONRATT020994150 GAACGCCACCCCACCAT CCTTGAAGTCTGAGGCAGGAA

B, Downregulated

GeneLength (bp)Forward (5′-3′)(5′-3′)
XR_590210.1128 TTTCAGCCCATCAATGGTTTC TCCTCAGGAGTGCCCTTTCT
NONRATT002188105 TTCCTACATACTGAGCAACGACC CCTACCTGTAGCTGCCACTCC
XR_589980.1115 GGATGCCCACTCAAGGGTC GATGATAAATGCTTGCCCACC
XR_598701.1145 AACAATGGGGACGGTAGTGC GAAATGAACCTGGGAGAAACG
XR_590197.192 ACTTCCCTGGATTCTGCTCTG GGGTCCCCTAACACTATTGCTT

GAPDH68 CGCTAACATCAAATGGGGTG TTGCTGACAATCTTGAGGGAG
Statistical analysis

Data are expressed as the mean ± standard error of the mean. The data and statistical graphs were analyzed using the GraphPad Prism v6.02 package (GraphPad Software, Inc., La Jolla, CA, USA). Between-group counts were compared using a Student's t-test (Mann-Whitney U), and the data from three groups were analyzed by one-way analysis of variance followed by Dunn's post hoc test. P<0.05 was considered to indicate a statistically significant difference.

Results

Characteristics of ischemic myocardial tissues

With regard to the animals in the model group, there were evident cyanotic changes in the myocardium of the occluded area 30 min post-ischemia, and a reactive hyperemic response after refilling of the left anterior descending coronary artery. With regard to the samples in the model group, examination under a dissecting microscope revealed discoloration of the occluded distal myocardium at the early stage of reperfusion in the infarct region (data not shown).

Expression profiling of lncRNAs in the spinal cord 2 h post-cardiac I/R

To select possible targets of lncRNAs in the model and control groups, the present study detected up to 16,987 coding transcripts in the T1-T4 spinal cords 2 h post-reperfusion. A total of 3,621 upregulated and 13,366 downregulated lncRNAs were identified in the spinal cords. On average, 234 lncRNAs were upregulated in the spinal cords of the model group, compared with those in the control group, whereas an average of 7,746 lncRNAs were downregulated (>2.0-fold-change; P<0.05). The distributions of the log2 ratios of the lncRNAs in the model and control samples were nearly identical; Fig. 1 presents the heatmaps of the expression ratios (log2 scale) of the lncRNAs in the spinal cords. The top 20 up- and downregulated mRNAs are listed in Tables II and III.

Figure 1

Differential expression of lncRNA in T1-T4 spinal cord sections in the cardiac I/R injury model. (A) Scatter plot comparing global lncRNA expression profiles in the spinal cords of cardiac I/R and control rats. Red indicates upregulated and green indicates downregulated genes. Black indicates the absence of a statistically significant difference, meaning it failed to pass the cutoff values of 1 and -1 in the log2 scale and P<0.05. (B) Heatmap presenting hierarchical clustering of lncRNAs with expression changes of >2-fold. In the clustering analysis, up- and downregulated genes are represented by red and green, respectively. I/R, ischemia/reperfusion; lncRNA, long non-coding RNA.

Table II

Top 20 upregulated lncRNAs in the spinal cord at 2 h post-reperfusion.

Table II

Top 20 upregulated lncRNAs in the spinal cord at 2 h post-reperfusion.

LncRNAs (sequence name)Fold-change (R/N)RNA lengthChromosome log2
gi|672017878|ref|XR_345533.2|83.013211,727Chr3
NONRATT02538623.99574563Chr6
NONRATT02431823.93667473Chr6
gi|672024701|ref|XR_599241.1|13.07902728Chr10
NONRATT02550910.08656553Chr7
gi|672017768|ref|XR_600487.1|9.916187634Chr3
NONRATT0258399.860808508Chr7
NONRATT0233399.858076706Chr5
NONRATT0001209.325455550Chr1
NONRATT0022608.604115692Chr1
gi|672055933|ref|XR_592974.1|8.3069798,102Chr6
uc.1267.209348271-
gi|672086728|ref|XR_597427.1|6.5024314,903Chr20
NONRATT0084146.458688518Chr13
NONRATT0264706.452916655Chr7
NONRATT0158186.317123255Chr2
gi|672080453|ref|XR_596511.1|6.2864731,683Chr16
gi|672027556|ref|XR_340041.2|6.236808633Chr13
gi|672030740|ref|XR_598338.1|6.1693311,360Chr18
NONRATT0162376.087859817Chr2

[i] Values are presented as fold-changes in the reperfusion groups (reperfusion 2 h) over the control group (N >2.0-fold; P<0.05). lncRNA, long non-coding; Chr, chromosome; R/N, reperfusion/normal.

Table III

Top 20 downregulated lncRNAs in the spinal cord at 2 h post-reperfusion.

Table III

Top 20 downregulated lncRNAs in the spinal cord at 2 h post-reperfusion.

LncRNAs (sequence name)Fold-change (R/N)RNA lengthChromosome log2
NR_130708.1−27.70491,379Chr3
NONRATT028627−25.2873410Chr8
NONRATT021959−22.8492709Chr4
gi|672034655|ref|XR_590005.1|−21.80201,290Chr1
NONRATT023191−19.83451,977Chr5
NONRATT025830−19.4635525Chr7
NONRATT027253−19.44411,233Chr7
NONRATT023189−19.24272,086Chr5
NONRATT014248−18.48731,049Chr19
NONRATT008322−17.5179451Chr13
NONRATT014862−16.4839619Chr2
NONRATT016808−16.4007518Chr2
NONRATT017256−16.2487786Chr20
NONRATT011649−15.8013566Chr16
gi|672021532|ref|XR_347699.2|−15.494537Chr7
NONRATT024978−14.38071,486Chr6
NONRATT012913−13.9501338Chr17
NONRATT004220−13.72162,171Chr10
NONRATT018550−13.4908365Chr3
NONRATT008489−13.42561,076Chr13

[i] Values are present as fold-changes in the reperfusion groups (reperfusion 2 h) over the control group (N >2.0-fold; P<0.05). lncRNA, long non-coding; Chr, chromosome; R/N, reperfusion/normal.

Expression profiling of mRNAs in the spinal cord 2 h post-cardiac I/R

To explore the potential role of mRNAs in the T1-T4 spinal cords 2 h post-cardiac I/R, the present study determined the expression profiles of mRNAs by high-throughput RNA-seq. Of the 26,466 mRNAs that were quantified using reads per kilobase per million mapped reads (RPKM) values, 3,428 mRNAs were deregulated by 2-fold following I/R-induced cardiac injury, of which 767 mRNAs were upregulated and 2,661 mRNAs were downregulated; Fig. 2 presents the heatmaps of the expression ratios (log2 scale) of the mRNAs in the spinal cords. The top 20 up- and downregulated mRNAs are listed in Tables IV and V.

Figure 2

Differential expression of mRNA genes in the T1-T4 spinal cord sections in the cardiac I/R injury model. (A) Scatter plot comparing global mRNA gene expression profiles in the spinal cords of cardiac I/R and control rats. Red indicates upregulated and green indicates downregulated genes. Black indicates the absence of a statistically significant difference, meaning it failed to pass the cutoff values of 1 and -1 in the log2 scale and false discovery rate (corrected P-value) <0.05. (B) Heatmap presenting hierarchical clustering of mRNAs with expression changes of >2-fold. In the clustering analysis, up- and downregulated genes are represented by red and green, respectively. I/R, ischemia/reperfusion.

Table IV

Top 20 upregulated mRNAs in the spinal cord at 2 h post-reperfusion.

Table IV

Top 20 upregulated mRNAs in the spinal cord at 2 h post-reperfusion.

mRNAs (sequence name)Fold-change (R/N)GENE_SYMBOLGENE_NAME
A_64_P00411225.97118--
A_64_P15135325.46518Acsm5Acyl-CoA synthetase medium-chain family member 5
A_64_P18117121.23528--
A_64_P14928021.07919VegfbVascular endothelial growth factor B
A_64_P27377115.23514--
A_64_P26012914.28584GzmcGranzyme C
A_44_P12291213.21478Ces1cCarboxylesterase 1C
A_44_P55334113.01391Lrfn5Leucine rich repeat and fibronectin type III domain containing 5
A_64_P09405510.5432--
A_44_P40111010.10015Prss40'Protease, serine, 40'
A_64_P1477698.814655Gucy1b2'Guanylate cyclase 1, soluble, β2'
A_64_P0820828.515041--
A_64_P0459028.093776--
A_64_P1183678.069224Lrrd1Leucine-rich repeats and death domain containing 1
A_64_P1566057.85615--
A_64_P1352957.737585Cd300cCD300c molecule
A_64_P0421277.403613Akr1c3'Aldo-keto reductase family 1, member C3'
A_44_P4455757.245778Irx2Iroquois homeobox 2
A_64_P1624767.220482Art1 ADP-ribosyltransferase 1
A_64_P1866307.156018Vom2r60'Vomeronasal 2 receptor, 60'

[i] Values are fold-changes in the reperfusion groups (reperfusion 2 h) over the control group (N >2.0-fold; P<0.05). R/N, reperfusion/normal.

Table V

Top 20 downregulated mRNAs in the spinal cord at 2 h post-reperfusion.

Table V

Top 20 downregulated mRNAs in the spinal cord at 2 h post-reperfusion.

mRNAs (sequence name)Fold-change (R/N)GENE_SYMBOLGENE_NAME
A_64_P141763−38.1959Muc16'Mucin 16, cell surface associated'
A_42_P473398−33.0016Cxcl1Chemokine (C-X-C motif) ligand 1
A_44_P550907−29.4102RGD1306750LOC362451
A_44_P702019−23.3124Rfx4'Regulatory factor X, 4 (influences HLA class II expression)'
A_64_P021855−22.6481LOC499643Similar to hypothetical protein FLJ25371
A_44_P367541−21.9947Olr671Olfactory receptor 671
A_64_P036090−20.4897--
A_44_P371339−20.0377IL6Interleukin 6
A_64_P141762−19.8627--
A_64_P018554−19.1504--
A_64_P101228−16.1995Tas2r120'Taste receptor, type 2, member 120'
A_44_P563447−15.8884Wnt10a'Wingless-type MMTV integration site family, member 10A'
A_44_P698466−15.406Lrrtm2Leucine rich repeat transmembrane neuronal 2
A_44_P461456−15.3963Prl4a1'Prolactin family 4, subfamily a, member 1'
A_44_P378749−14.7924LOC100912608Homeobox protein Hox-A10-like
A_44_P547892−14.7229Olr1345Olfactory receptor 1345
A_64_P001947−14.5408--
A_64_P009237−14.3488--
A_64_P029912−13.3859Cldnd2Claudin domain containing 2
A_64_P074460−13.1395--

[i] Values are fold-changes in the reperfusion groups (reperfusion 2 h) over the control group (N >2.0-fold; P<0.05 by analysis of variance). R/N, reperfusion/normal.

Hierarchical clustering analysis of the differentially expressed mRNAs and lncRNAs

Following the determination of the expression values of the differentially expressed genes (DEGs), the present study carried out hierarchical clustering analysis on the DEGs. As shown in Figs. 1 and 2, the differentially expressed mRNAs and lncRNAs clearly distinguished the cardiac I/R tissues from the control samples. In the cardiac I/R tissues, there were more downregulated genes than upregulated genes (Figs. 1 and 2).

Functional and pathway enrichment analyses

The significantly enriched GO terms (top 30) were comprised of 16 biological processes, 6 cellular compartments, and 8 molecular functions (Fig. 3). It was revealed that the differentially expressed biological processes in the spinal cords were primarily involved in the serotonin receptor signaling pathway, regulation of protein kinase B signaling, regulation of keratinocyte migration, and skeletal muscle satellite cell differentiation. The significantly enriched pathway terms (top 30) primarily involved KEGG pathways including 'olfactory transduction', 'arachidonic acid metabolism', the 'phosphoinositide 3-kinase-protein kinase B signaling pathway', 'extracellular matrix-receptor interaction', 'cytokine-cytokine receptor interaction' and 'neuroactive ligand-receptor interaction' (Fig. 4). The DEGs were analyzed with GO background significant enrichment, which demonstrated the number of genes associated with biological processes, cellular compartments and molecular functions (Fig. 5).

Figure 3

Top 30 significantly enriched GO terms as determined by GO annotation analysis. The blue bars represent biological process classification; the yellow bars represent cellular components; and the red bars represent molecular function. GO, Gene Ontology.

Figure 4

Top 30 significantly enriched pathway terms determined by Gene Ontology annotation analysis. Blue bars represent the KEGG pathway and orange bars represent PANTHER. KEGG, Kyoto Encyclopedia of Genes and Genomes.

Figure 5

Differentially expressed genes analyzed by GO background significant enrichment. Solid bars represent the target gene set and slashed bars represent the gene set. GO, Gene Ontology.

The results of the biological process analysis revealed that the DEGs involved in PPI networks were mainly enriched in 'neurological system processes' (P=1.92×10−11), 'sensory perception' (P=1.92×10−11), the 'detection of chemical stimuli' (P=5.10×10−10) and 'cell surface receptor signaling pathways' (P=4.23×10−10; Fig. 6). A total of 7 cellular components from GO terms were significantly enriched for the DEGs involved in PPI networks: 'Extracellular regions' (P=0.02), 'membrane parts' (P=1.54×10−5), 'extracellular spaces' (P=1.52×10−6), 'intrinsic components of the membrane' (P=1.29×10−8), the 'cell periphery' (P=1.76×10−7), 'integral components of the membrane' (P=1.61×10−8) and the 'plasma membrane' (P=3.22×10−7; Fig. 7). A total of 10 molecular functions from GO terms were significantly enriched for the DEGs involved in PPI networks: 'Molecular transducer activity' (P=6.13×10−14), 'signal transducer activity' (P=9.42×10−14), 'receptor activity' (P= 4.77×10−14), 'signal receptor activity' (P=4.77×10−15), 'transmembrane signal receptor activity' (P=1.31×10−15), 'serine-type peptidase activity' (P=9.57×10−5), 'endopeptidase activity' (P=0.02), 'olfactory receptor activity' (P=5.07×10−9), 'G-protein-coupled receptor activity' (P=3.03×10−14) and 'serine-type endopeptidase activity' (P=1.08×10−5) (Fig. 8).

Figure 6

Enrichment GO hierarchy of Biological Process. The GO terms enriched for the differentially expressed genes involved in the protein-protein interaction network constructed from the STRING database. GO, Gene Ontology.

Figure 7

Enrichment GO hierarchy of Cellular Component. A total of 7 Cellular Components from the GO terms were significantly enriched for the differentially expressed genes involved in the protein-protein interaction network. GO, Gene Ontology.

Figure 8

Enrichment GO hierarchy of Molecular Function. A total of 10 molecular functions from GO terms were significantly enriched for the differentially expressed genes involved in the protein-protein interaction network. GO, Gene Ontology.

RT-qPCR validation of lncRNA expression in the spinal cords 2 h post-cardiac I/R injury

To validate the reliability of the RNA sequencing results in the rats, the present study analyzed the differentially expressed lncRNAs, including 5 upregulated lncRNAs and 4 downregulated lncRNAs, by RT-qPCR analysis. T1-T4 spinal cord tissues were collected from the control and I/R groups 2 h post-reperfusion. The expression levels of 4 upregulated lncRNAs (NONRATT025386, NONRATT016113, NONRATT018298 and NONRATT018300) increased significantly in the I/R group when compared with those in the control group, whereas the expression level of one downregulated lncRNA (NONRATT002188) decreased significantly (Fig. 9). The RT-qPCR results for 3 lncRNAs (XR_589980.1, XR_598701.1 and XR_590197.1) were not consistent with the data from the RNA sequencing (XR_589980.1 decreased, and XR_598701.1 and XR_590197.1 increased post-reperfusion when compared with the control; Fig. 10).

Figure 9

Expression levels of 9 lncRNAs in the spinal cord (T1-T4) at different time-points (0.5 and 2 h) following cardiac ischemia/reperfusion injury. The expression levels of NONRATT025386, were upregulated in the 0.5 and 2 h groups. (A) The expression levels of NONRATT016113, NONRATT018298 and NONRATT018300 were only significantly upregulated in the 2 h group. (B) The expression levels of lncRNA NONRATT002188 were significantly downregulated in the 0.5 and 2 h groups. *P<0.05, **P<0.01 and ***P<0.001 vs. control. lncRNA, long non-coding RNA.

Figure 10

Validation of the differential expression of lncRNAs in spinal cord sections at different time-points (0.5 and 2 h) following cardiac isch-emia/reperfusion injury. A total of 7 upregulated lncRNAs and 2 downregulated lncRNAs were confirmed by RT-qPCR. The levels of lncRNAs were normalized to GAPDH and expressed as fold-changes compared with the sham group. RT-qPCR, reverse transcription-quantitative polymerase chain reaction; lncRNA, long non-coding RNA.

Expression levels of 4 lncRNAs in the spinal cord 0.5 h post-cardiac I/R injury

The present results indicated that the expression levels of the lncRNA NONRATT025386 were significantly upregulated in the 0.5 h group when compared with the control group, whereas the expression levels of the lncRNAs NONRATT002188 and XR_590197.1 were signifi-cantly downregulated in the 0.5 h group compared with the control group. Furthermore, the lncRNA NONRATT016113 showed no significant difference between the two groups (Figs. 10 and 11).

Figure 11

Reverse transcription-quantitative polymerase chain reaction confirmation of 3 deregulated lncRNAs in the rat spinal cord sections in the ischemia/reperfusion injury model. The expression levels of the lncRNA (A) NONRATT025386 was significantly upregulated in the 0.5 h group and the (B) lncRNA NONRATT016113 showed no significance between the two groups. The expression levels of the lncRNAs (C) NONRATT002188 and (D) gi|672 036840|ref|XR_590197.1| were significantly downregulated. Mann-Whitney test. *P<0.05 and **P<0.01 vs. control. lncRNA, long non-coding RNA.

Expression levels of 9 lncRNAs in the spinal cord at different time-points (0.5 and 2 h) following cardiac I/R injury

The present study collected samples from spinal cord tissues at 0.5 and 2 h post-cardiac I/R injury for RT-qPCR validation. The results indicated that the expression levels of the lncRNA NONRATT025386 were significantly upregulated in the 0.5 and 2 h groups compared with the control group. In addition, the expression levels of NONRATT016113, NONRATT018298 and NONRATT018300 were also significantly increased in the 2 h group, but not at 0.5 h, compared with the control group (Figs. 9–11). By contrast, the expression levels of the lncRNA NONRATT002188 were significantly downregulated in the 0.5 and 2 h groups when compared with the control group (Figs. 9–11).

Discussion

With regard to ischemic cardiac tissues, previous research has focused on multiple signaling pathways that regulate the critical balance between cell death and survival during cardiac I/R injury (42-47). The present study, to the best of our knowledge, for the first time provides evidence that suggests that many DEGs, pathways and biological processes of the T1-T4 spinal cord are implicated in myocardial I/R. Based on high-throughput RNA seq, 16,987 lncRNAs in the T1-T4 spinal cord tissues were identified, of which 3,621 were upregulated and 13,366 were downregulated (>2.0-fold-change; P<0.05). Among the 26,466 mRNAs that were quantified using RPKM values, 3,428 were deregulated by 2-fold following I/R-induced cardiac injury, of which 767 were upregulated and 2,661 were downregulated. According to these results, some differentially expressed lncRNAs were verified by RT-qPCR analyses.

Previous studies have shown that the spinal cord serves an important role in the pathogenesis of cardiac disease (48-51). The present study used a virally mediated trans-synaptic tracing method, by injecting the PRV virus into the rat heart and kidney, and these viruses were subsequently found in the lateral medial column of the spinal cord in the corresponding segment (12,52). This revealed the characteristics of the transcriptome in the T1-T4 spinal cord following cardiac I/R injury and the specific spinal segment that innervates the heart serves a significant role in cardiac I/R injury. Cheng et al (53) reported that melatonin regulation of the transcriptome was associated with the reversal of morphine tolerance by transcriptomic analysis of the L5-S3 segmental spinal cord. Mohrman et al (54) revealed the spinal cord transcriptomic and metabolic patterns in a excitotoxic injection injury model of syringomyelia. Niu et al (55) demonstrated the upregulation of tumor necrosis factor (TNF)-α in spinal cord neurons during coronary artery occlusion in rats, suggesting that TNF-α in the spinal cord may be associated with the nociception initiated by acute myocardial ischemia/infarction. Schulz et al (56) reported that connexin 43 in the spinal cord serves an important role in providing protection from cardiac I/R injuries. It is well known that myocardial ischemia creates an autonomic nervous system imbalance, and can trigger cardiac arrhythmias (57,58). Howard-Quijano et al (59) indicated that neuromodulation by spinal cord stimulation (SCS), in which a 4-pole lead was placed percutaneously in the T1-T4 epidural space, attenuated local cardiac sympathoexcitation from ischemia-induced increases in afferent signaling, reduced ventricular arrhythmias and improved myocardial function during acute ischemia. Liao et al (60) reported that chronic thoracic SCS at the T1-T3 level induced significant remodeling of cardiac sympathetic innervation over the peri-infarct and infarct regions, and was associated with improved left ventricular function and reduced myocardial norepinephrine spillover. The present study revealed that the differential expression of certain mRNAs and lncRNAs in the spinal cord affects the myocardial ischemic regions, suggesting that in the spinal T1-T4 segment these genes are involved in the response to cardiac injury. Although the functions of mRNAs and lncRNAs in the spinal cord are unclear, the present findings provide a novel paradigm for cardioprotection against I/R-induced myocardial injury.

The present results also revealed that some mRNAs in the spinal cord, including chemokine C-X-C motif ligand 1 (CXCL1), regulatory factor X4 (RFX4), WNT10a and interleukin (IL)-6, were differentially expressed following cardiac I/R. Haider et al (61) reported that the angiogenic potential of the mononuclear cell (MNC) secretome is regulated by CXCL-1 upregulation in spinal cord tissue, and factors in the MNC secretome may mitigate the pathophysiological processes of secondary damage following spinal cord injury, and may also improve functional outcomes in rats. Ashique et al (62) reported that the spinal cords of RFX4 mutants were correlated with defects in patterning and cilia formation, suggesting that RFX4 is a regionally specific transcriptional regulator of Sonic hedgehog signaling during the development of the central nervous system. Zhao et al (63) demonstrated that hyperbaric oxygen (HBO) reverses Wnt-10a upregulation induced by chronic constriction (CCI) injury in the dorsal root ganglion (DRG), spinal cord and hippocampus, suggesting that HBO attenuates CCI-induced rat neuropathic pain and inflammatory responses, potentially through regulation of the Kindlin-1/Wnt-10a signaling pathway. Although the detailed functions of many mRNAs from spinal cords are not fully understood, the present results provide novel insight into the molecular mechanisms underlying cardiac I/R injury.

It is well known that regulations of gene expression are varied over the time course (64-66). Our previous research associated with Itchy E3 ubiquitin protein ligase demonstrated that gene expression was significantly different in the C5-C8 spinal cord at 0.5 and 2 h following compound 48/80 injection when compared with the control group (36). Similar to the above method, we also screened key genes in myocardial tissues under 30 min cardiac ischemia following 2 h reperfusion compared with the sham group (67). Li et al (68) also indicated that impairment of sensory nerves with significant reductions in CGRP and SP in the DRG, ventricular myocardium and serum may be associated with an increase in myocardial vulnerability in acute cardiac I/R injury in diabetic rats. It was revealed that the injury was relatively evident at 2 h post-myocardial reperfusion, which may be considered as an acute cardiac I/R injury. Notably, this time point could be equivalent to the patients who received early percutaneous coronary intervention following myocardial infarction (69,70). Therefore, the present study chose 0.5 and 2 h post-reperfusion as the different time points of cardiac reperfusion injury. The present study revealed that there are significant differences in lncRNA and mRNA expression patterns at different time points of myocardial I/R, suggesting that the neural modulation of cardiac I/R injury may be temporal- and spatial-dependent.

In particular, our previous study also demonstrated that proton magnetic resonance spectroscopy was able to simultaneously detect and quantify the absolute concentrations of multiple metabolites within the spinal cord underlying α-Me-5-HT-evoked pruritus (71). Using the above method, we can also detect the changes of various metabolites in the spinal cord following cardiac I/R injury, which may deepen our understandings of the pathophysiology and pharmacological therapies for acute myocardial infarction.

The present study screened several differentially expressed mRNAs under cardiac I/R injury. In the future, whether the proteins encoded by the mRNAs are consistent with these mRNAs will be verified by immunoblotting. If so, the effects on cardiac I/R injury may be observed by activating or silencing the expression of one specific mRNA. Li et al (68) revealed that the regulation of the spinal cord served a significant role under cardiac I/R injury in diabetic neuropathic rats. Thus, it can be hypothesized that intervention on the spinal cord may have an important influence on cardioprotection in the future.

The present study used high-throughput RNA seq, coupled with RT-qPCR analysis, to demonstrate that the expression profiles of lncRNAs and mRNAs in spinal cords differed markedly between the control and 2 h groups, and ultimately identified 7,980 differentially expressed (>2-fold) lncRNAs (234 upregulated and 7,746 downregulated) and 3,428 mRNAs (767 upregulated and 2,661 downregulated). The expression patterns of several lncRNAs were confirmed by RT-qPCR. The results also indicated that the expression levels of the lncRNA NONRATT025386 were significantly upregulated in the 0.5 and 2 h groups compared with the control group, whereas the expression levels of NONRATT016113, NONRATT018298 and NONRATT018300 were significantly increased in the 2 h group when compared with the control group, although there was no statistically significant difference between the expression levels in the 0.5 h and control groups. Furthermore, the expression levels of the lncRNA NONRATT002188 were significantly downregulated in the 0.5 and 2 h groups compared with the control group.

In conclusion, this study revealed that high-throughput RNA seq can facilitate the systematic exploration of gene expression on a genome-wide scale, and can be used to investigate DEGs and lncRNA expression patterns in the spinal cords of rats during I/R-induced cardiac injury. In the search for better treatments for cardiac I/R injury, expanded sets of differentially expressed mRNAs and lncRNAs may prove very useful for identifying novel therapeutic targets.

Funding

The present study was supported by grants from National Natural Science Foundation of P.R. China (grant nos. 81670240, 81873467 and 81770283), National Natural Science Foundation of Hubei Province (grant no. 2016CFB625), Key Research and Development Project of Hainan Province of China (grant no. ZDYF2018115) and Medical Innovation Project in Fujian Province (grant no. 2017-CX-48).

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Authors' contributions

HX and DW conceived and designed the study. QW and ZL performed the surgical procedures. YL and ZH participated in the experimental design. ZL and YC performed the experiments. MF and SL analyzed the data. HX and DW wrote the manuscript and all authors contributed to the final manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The present study was approved by the Institutional Ethical Committee of Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology (Hubei, China; no. TJ-A20150804).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Acknowledgments

The authors would like to thank CapitalBio Technology Co., Ltd. (Beijing, China) for their technical advice and Dr Taotao Liu (Department of Anesthesiology, Peking University Third Hospital, Peking University, Beijing, China) for his contribution to image acquisition.

References

1 

Shi J, Bei Y, Kong X, Liu X, Lei Z, Xu T, Wang H, Xuan Q, Chen P, Xu J, et al: miR-17-3p contributes to exercise-induced cardiac growth and protects against myocardial ischemia-reperfusion injury. Theranostics. 7:664–676. 2017. View Article : Google Scholar : PubMed/NCBI

2 

Liu X, Xiao J, Zhu H, Wei X, Platt C, Damilano F, Xiao C, Bezzerides V, Boström P, Che L, et al: miR-222 is necessary for exercise-induced cardiac growth and protects against pathological cardiac remodeling. Cell Metab. 21:584–595. 2015. View Article : Google Scholar : PubMed/NCBI

3 

Burley DS, Ferdinandy P and Baxter GF: Cyclic GMP and protein kinase-G in myocardial ischaemia-reperfusion: Opportunities and obstacles for survival signaling. Br J Pharmacol. 152:855–869. 2007. View Article : Google Scholar : PubMed/NCBI

4 

Wong GT, Yao L, Xia Z and Irwin MG: Intrathecal morphine remotely preconditions the heart via a neural pathway. J Cardiovasc Pharmacol. 60:172–178. 2012. View Article : Google Scholar : PubMed/NCBI

5 

Ding X, Ardell JL, Hua F, McAuley RJ, Sutherly K, Daniel JJ and Williams CA: Modulation of cardiac ischemia-sensitive afferent neuron signaling by preemptive C2 spinal cord stimulation: Effect on substance P release from rat spinal cord. Am J Physiol Regul Integr Comp Physiol. 294:R93–R101. 2008. View Article : Google Scholar

6 

Sroka K: On the genesis of myocardial ischemia. Z Kardiol. 93:768–783. 2004. View Article : Google Scholar : PubMed/NCBI

7 

Zipes DP: Heart-brain interactions in cardiac arrhythmias: Role of the autonomic nervous system. Cleve Clin J Med. 75(Suppl 2): S94–S96. 2008. View Article : Google Scholar : PubMed/NCBI

8 

Armour JA: Cardiac neuronal hierarchy in health and disease. Am J Physiol Regul Integr Comp Physiol. 287:R262–R271. 2004. View Article : Google Scholar : PubMed/NCBI

9 

Armour JA, Linderoth B, Arora RC, DeJongste MJ, Ardell JL, Kingma JG Jr, Hill M and Foreman RD: Long-term modulation of the intrinsic cardiac nervous system by spinal cord neurons in normal and ischaemic hearts. Auton Neurosci. 95:71–79. 2002. View Article : Google Scholar : PubMed/NCBI

10 

Pozzati A, Pancaldi LG, Di Pasquale G, Pinelli G and Bugiardini R: Transient sympathovagal imbalance triggers 'ischemic' sudden death in patients undergoing electrocardio-graphic Holter monitoring. J Am Coll Cardiol. 27:847–852. 1996. View Article : Google Scholar : PubMed/NCBI

11 

Airaksinen KE: Autonomic mechanisms and sudden death after abrupt coronary occlusion. Ann Med. 31:240–245. 1999. View Article : Google Scholar : PubMed/NCBI

12 

Xu LJ, Liu TT, He ZG, Hong QX and Xiang HB: Hypothesis: CeM-RVLM circuits may be implicated in sudden unexpected death in epilepsy by melanocortinergic-Sympathetic signaling. Epilepsy Behav. 45:124–127. 2015. View Article : Google Scholar : PubMed/NCBI

13 

Li R, Wong GT, Wong TM, Zhang Y, Xia Z and Irwin MG: Intrathecal morphine preconditioning induces cardioprotection via activation of delta, kappa, and mu opioid receptors in rats. Anesth Analg. 108:23–29. 2009. View Article : Google Scholar

14 

Lu Y, Hu J, Zhang Y, Dong CS and Wong GT: Remote intra-thecal morphine preconditioning confers cardioprotection via spinal cord nitric oxide/cyclic guanosine monophosphate/protein kinase G pathway. J Surg Res. 193:43–51. 2015. View Article : Google Scholar

15 

Jiang L, Hu J, He S, Zhang L and Zhang Y: Spinal neuronal NOS signaling contributes to morphine cardioprotection in ischemia reperfusion injury in rats. J Pharmacol Exp Ther. 358:450–456. 2016. View Article : Google Scholar : PubMed/NCBI

16 

Mei B, Li W, Cheng X, Liu X, Gu E and Zhang Y: Activating mu-opioid receptors in the spinal cord mediates the cardioprotective effect of remote preconditioning of trauma. Cardiol J. 24:314–323. 2017. View Article : Google Scholar

17 

Wimalawansa SJ: Calcitonin gene-related peptide and its receptors: Molecular genetics, physiology, pathophysiology, and therapeutic potentials. Endocr Rev. 17:533–585. 1996. View Article : Google Scholar : PubMed/NCBI

18 

Wang Y, Chen AF and Wang DH: ET(A) receptor blockade prevents renal dysfunction in salt-sensitive hypertension induced by sensory denervation. Am J Physiol Heart Circ Physiol. 289:H2005–H2011. 2005. View Article : Google Scholar : PubMed/NCBI

19 

Wu S, Marie Lutz B, Miao X, Liang L, Mo K, Chang YJ, Du P, Soteropoulos P, Tian B, Kaufman AG, et al: Dorsal root ganglion transcriptome analysis following peripheral nerve injury in mice. Mol Pain. 12:2016. View Article : Google Scholar

20 

Wang S, Xu H, Zou L, Xie J, Wu H, Wu B, Yi Z, Lv Q, Zhang X, Ying M, et al: LncRNA uc.48+ is involved in diabetic neuro-pathic pain mediated by the P2X receptor in the dorsal root ganglia. Purinergic Signal. 12:138–148. 2015.

21 

Boon RA, Jae N, Holdt L and Dimmeler S: Long noncoding RNAs: From clinical genetics to therapeutic targets. J Am Coll Cardiol. 67:1214–1226. 2016. View Article : Google Scholar : PubMed/NCBI

22 

Zhao X, Tang Z, Zhang H, Atianjoh FE, Zhao JY, Liang L, Wang W, Guan X, Kao SC, Tiwari V, et al: A long noncoding RNA contributes to neuropathic pain by silencing Kcna2 in primary afferent neurons. Nat Neurosci. 16:1024–1031. 2013. View Article : Google Scholar : PubMed/NCBI

23 

Jiang BC, Sun WX, He LN, Cao DL, Zhang ZJ and Gao YJ: Identification of lncRNA expression profile in the spinal cord of mice following spinal nerve ligation-induced neuropathic pain. Mol Pain. 11:432015. View Article : Google Scholar : PubMed/NCBI

24 

Wang Q, Li ZX, Liu BW, He ZG, Liu C, Chen M, Liu SG, Wu WZ and Xiang HB: Altered expression of differential gene and lncRNA in the lower thoracic spinal cord on different time courses of experimental obstructive jaundice model accompanied with altered peripheral nociception in rats. Oncotarget. 8:106098–106112. 2017.PubMed/NCBI

25 

Liu Y, Li G, Lu H, Li W, Li X, Liu H, Li X, Li T and Yu B: Expression profiling and ontology analysis of long noncoding RNAs in post-ischemic heart and their implied roles in ischemia/reperfusion injury. Gene. 543:15–21. 2014. View Article : Google Scholar : PubMed/NCBI

26 

Liu Y, Zhou D, Li G, Ming X, Tu YF, Tian J, Lu H and Yu B: Long non coding RNA-UCA1 contributes to cardiomyocyte apoptosis by suppression of p27 expression. Cell Physiol Biochem. 35:1986–1998. 2015. View Article : Google Scholar : PubMed/NCBI

27 

Vausort M, Wagner DR and Devaux Y: Long noncoding RNAs in patients with acute myocardial infarction. Circ Res. 115:668–677. 2014. View Article : Google Scholar : PubMed/NCBI

28 

Grote P, Wittler L, Hendrix D, Koch F, Währisch S, Beisaw A, Macura K, Bläss G, Kellis M, Werber M and Herrmann BG: The tissue-specific lncRNA Fendrr is an essential regulator of heart and body wall development in the mouse. Dev Cell. 24:206–214. 2013. View Article : Google Scholar : PubMed/NCBI

29 

Klattenhoff CA, Scheuermann JC, Surface LE, Bradley RK, Fields PA, Steinhauser ML, Ding H, Butty VL, Torrey L, Haas S, et al: Braveheart, a long noncoding RNA required for cardiovascular lineage commitment. Cell. 152:570–583. 2013. View Article : Google Scholar : PubMed/NCBI

30 

National Research Council (US) Committee for the Update of the Guide for the Care and Use of Laboratory Animals: Guide for the Care and Use of Laboratory Animals. 8th edition. National Academies Press (US); Washington, DC: 2011

31 

Murry CE, Jennings RB and Reimer KA: Preconditioning with ischemia: A delay of lethal cell injury in ischemic myocardium. Circulation. 74:1124–1136. 1986. View Article : Google Scholar : PubMed/NCBI

32 

Huang CH, Lai CC, Yang AH and Chiang SC: Myocardial preconditioning reduces kidney injury and apoptosis induced by myocardial ischaemia and reperfusion. Eur J Cardthorac Surg. 48:382–391. 2015. View Article : Google Scholar

33 

Li ZX, Lin Q, He ZG, Wang Q, Chen YL, Feng MH, Li SY and Xiang HB: Altered myocardial gene expression profiling in the ischemic tissues at different time points after cardiac ischemia/reperfusion in rats. Oncotarget. 9:2018.

34 

Flecknell PA: Anaesthesia of animals for biomedical research. Br J Anaesth. 71:885–894. 1993. View Article : Google Scholar : PubMed/NCBI

35 

Liu QQ, Liu H, He ZG, Zhang SJ, Liu BW, Wang L, Qiu WH, Xu Q, Xiang HB and Lv YM: Differential gene and lncRNA expression in the lower thoracic spinal cord following isch-emia/reperfusion-induced acute kidney injury in rats. Oncotarget. 8:53465–53481. 2017.PubMed/NCBI

36 

Liu BW, Li ZX, He ZG, Liu C, Xiong J and Xiang HB: Altered expression of target genes of spinal cord in different itch models compared with capsaicin assessed by RT-qPCR validation. Oncotarget. 8:74423–74433. 2017.PubMed/NCBI

37 

He ZG, Liu BW, Li ZX, Liu C and Xiang HB: Altered expression profiling of spinal genes modulated by compound 48/80 in a mouse itch model. J Anesth Perioper Med. 4:220–224. 2017. View Article : Google Scholar

38 

Orom UA, Derrien T, Beringer M, Gumireddy K, Gardini A, Bussotti G, Lai F, Zytnicki M, Notredame C, Huang Q, et al: Long noncoding RNAs with enhancer-like function in human cells. Cell. 143:46–58. 2010. View Article : Google Scholar : PubMed/NCBI

39 

Bottomly D, Walter NA, Hunter JE, Darakjian P, Kawane S, Buck KJ, Searles RP, Mooney M, McWeeney SK and Hitzemann R: Evaluating gene expression in C57BL/6J and DBA/2J mouse striatum using RNA-Seq and microarrays. PLoS One. 6:e178202011. View Article : Google Scholar : PubMed/NCBI

40 

Xu Y, Zhang XH and Pang YZ: Association of tyrosinase (TYR) and tyrosinase-related protein 1 (TYRP1) with melanic plumage color in korean quails (Coturnix coturnix). Asian-Australas J Anim Sci. 26:1518–1522. 2013. View Article : Google Scholar

41 

Schmittgen TD and Livak KJ: Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc. 3:1101–1108. 2008. View Article : Google Scholar : PubMed/NCBI

42 

Peng J, Lu R, Ye F, Deng HW and Li YJ: The heme oxygenase-1 pathway is involved in calcitonin gene-related peptide-mediated delayed cardioprotection induced by monophosphoryl lipid A in rats. Regul Pept. 103:1–7. 2002. View Article : Google Scholar

43 

Kawai S, Yamada T, Matsuura T, Funao T and Nishikawa K: Neuropathic pain attenuates ischemia reperfusion injury through beta2-adrenergic pathway. Life Sci. 187:9–16. 2017. View Article : Google Scholar : PubMed/NCBI

44 

Redington KL, Disenhouse T, Strantzas SC, Gladstone R, Wei C, Tropak MB, Dai X, Manlhiot C, Li J and Redington AN: Remote cardioprotection by direct peripheral nerve stimulation and topical capsaicin is mediated by circulating humoral factors. Basic Res Cardiol. 107:2412012. View Article : Google Scholar : PubMed/NCBI

45 

Chiu JH, Cheng YF, Wang JY and Hsu CF: Remote pharmacological preconditioning on median nerve territory increases Hsp32 expression and attenuates ischemia-reperfusion injury in rat heart. Life Sci. 90:629–636. 2012. View Article : Google Scholar : PubMed/NCBI

46 

Polhemus DJ, Gao J, Scarborough AL, Trivedi R, McDonough KH, Goodchild TT, Smart F, Kapusta DR and Lefer DJ: Radiofrequency renal denervation protects the isch-emic heart via inhibition of GRK2 and increased nitric oxide signaling. Circ Res. 119:470–480. 2016. View Article : Google Scholar : PubMed/NCBI

47 

Miura T, Kawamura S, Tatsuno H, Ikeda Y, Mikami S, Iwamoto H, Okamura T, Iwatate M, Kimura M, Dairaku Y, et al: Ischemic preconditioning attenuates cardiac sympathetic nerve injury via ATP-sensitive potassium channels during myocardial ischemia. Circulation. 104:1053–1058. 2001. View Article : Google Scholar : PubMed/NCBI

48 

Foreman RD, Garrett KM and Blair RW: Mechanisms of cardiac pain. Compr Physiol. 5:929–960. 2015. View Article : Google Scholar : PubMed/NCBI

49 

Santos SF, Rebelo S, Derkach VA and Safronov BV: Excitatory interneurons dominate sensory processing in the spinal substantia gelatinosa of rat. J Physiol. 581:241–254. 2007. View Article : Google Scholar : PubMed/NCBI

50 

Franco-Cereceda A, Kallner G and Lundberg JM: Capsazepine-sensitive release of calcitonin gene-related peptide from C-fibre afferents in the guinea-pig heart by low pH and lactic acid. Eur J Pharmacol. 238:311–316. 1993. View Article : Google Scholar : PubMed/NCBI

51 

Steagall RJ, Sipe AL, Williams CA, Joyner WL and Singh K: Substance P release in response to cardiac ischemia from rat thoracic spinal dorsal horn is mediated by TRPV1. Neuroscience. 214:106–119. 2012. View Article : Google Scholar : PubMed/NCBI

52 

Ye DW, Li RC, Wu W, Liu C, Ni D, Huang QB, Ma X, Li HZ, Yang H, Xiang HB and Zhang X: Role of spinal cord in regulating mouse kidney: A virally mediated trans-synaptic tracing study. Urology. 79:745e741–744. 2012. View Article : Google Scholar

53 

Cheng YC, Tsai RY, Sung YT, Chen IJ, Tu TY, Mao YY and Wong CS: Melatonin regulation of transcription in the reversal of morphine tolerance: Microarray analysis of differential gene expression. Int J Mol Med. 43:791–806. 2019.

54 

Mohrman AE, Farrag M, Huang H, Ossowski S, Haft S, Shriver LP and Leipzig ND: Spinal cord transcriptomic and metabolomic analysis after excitotoxic injection injury model of syringomyelia. J Neurotrauma. 34:720–733. 2017. View Article : Google Scholar

55 

Niu YL, Guo Z and Zhou RH: Up-regulation of TNF-alpha in neurons of dorsal root ganglia and spinal cord during coronary artery occlusion in rats. Cytokine. 47:23–29. 2009. View Article : Google Scholar : PubMed/NCBI

56 

Schulz R, Gorge PM, Gorbe A, Ferdinandy P, Lampe PD and Leybaert L: Connexin 43 is an emerging therapeutic target in ischemia/reperfusion injury, cardioprotection and neuroprotection. Pharmacol Ther. 153:90–106. 2015. View Article : Google Scholar : PubMed/NCBI

57 

Ding X, Hua F, Sutherly K, Ardell JL and Williams CA: C2 spinal cord stimulation induces dynorphin release from rat T4 spinal cord: Potential modulation of myocardial ischemia-sensitive neurons. Am J Physiol Regul Integr Comp Physiol. 295:R1519–R1528. 2008. View Article : Google Scholar : PubMed/NCBI

58 

Hua F, Ardell JL and Williams CA: Left vagal stimulation induces dynorphin release and suppresses substance P release from the rat thoracic spinal cord during cardiac ischemia. Am J Physiol Regul Integr Comp Physiol. 287:R1468–R1477. 2004. View Article : Google Scholar : PubMed/NCBI

59 

Howard-Quijano K, Takamiya T, Dale EA, Kipke J, Kubo Y, Grogan T, Afyouni A, Shivkumar K and Mahajan A: Spinal cord stimulation reduces ventricular arrhythmias during acute ischemia by attenuation of regional myocardial excitability. Am J Physiol Heart Circ Physiol. 313:H421–H431. 2017. View Article : Google Scholar : PubMed/NCBI

60 

Liao SY, Liu Y, Zuo M, Zhang Y, Yue W, Au KW, Lai WH, Wu Y, Shuto C, Chen P, et al: Remodelling of cardiac sympathetic re-innervation with thoracic spinal cord stimulation improves left ventricular function in a porcine model of heart failure. Europace. 17:1875–1883. 2015. View Article : Google Scholar : PubMed/NCBI

61 

Haider T, Hoftberger R, Ruger B, Mildner M, Blumer R, Mitterbauer A, Buchacher T, Sherif C, Altmann P, Redl H, et al: The secretome of apoptotic human peripheral blood mononuclear cells attenuates secondary damage following spinal cord injury in rats. Exp Neurol. 267:230–242. 2015. View Article : Google Scholar : PubMed/NCBI

62 

Ashique AM, Choe Y, Karlen M, May SR, Phamluong K, Solloway MJ, Ericson J and Peterson AS: The Rfx4 transcription factor modulates Shh signaling by regional control of ciliogen-esis. Sci Signal. 2:ra702009. View Article : Google Scholar

63 

Zhao B, Pan Y, Xu H and Song X: Hyperbaric oxygen attenuates neuropathic pain and reverses inflammatory signaling likely via the Kindlin-1/Wnt-10a signaling pathway in the chronic pain injury model in rats. J Headache Pain. 18:12017. View Article : Google Scholar : PubMed/NCBI

64 

Harrison BJ, Venkat G, Hutson T, Rau KK, Bunge MB, Mendell LM, Gage FH, Johnson RD, Hill C, Rouchka EC, et al: Transcriptional changes in sensory ganglia associated with primary afferent axon collateral sprouting in spared dermatome model. Genom Data. 6:249–252. 2015. View Article : Google Scholar : PubMed/NCBI

65 

Ke C, Gao F, Tian X, Li C, Shi D, He W and Tian Y: Slit2/Robo1 mediation of synaptic plasticity contributes to bone cancer pain. Mol Neurobiol. 54:295–307. 2017. View Article : Google Scholar

66 

Knowlton WM, Palkar R, Lippoldt EK, McCoy DD, Baluch F, Chen J and McKemy DD: A sensory-labeled line for cold: TRPM8-expressing sensory neurons define the cellular basis for cold, cold pain, and cooling-mediated analgesia. J Neurosci. 33:2837–2848. 2013. View Article : Google Scholar : PubMed/NCBI

67 

Wang Q, He ZG, Li ZX, Li SY, Chen YL, Feng MH, Hong QX and Xiang HB: Bioinformatics analysis of gene expression profile data to screen key genes involved in cardiac ischemia-reperfusion injury. Int J Clin Exp Med. 11:4955–4966. 2018.

68 

Li TP, Guo Z, Liu CJ, Sun T, Chen L and Zhao X: Association of down-regulation of calcitonin gene-related peptide and substance P with increase of myocardial vulnerability in diabetic neuropathic rats. Peptides. 96:1–7. 2017. View Article : Google Scholar : PubMed/NCBI

69 

Cheng YF, Chang YT, Chen WH, Shih HC, Chen YH, Shyu BC and Chen CC: Cardioprotection induced in a mouse model of neuropathic pain via anterior nucleus of paraventricular thalamus. Nat Commun. 8:8262017. View Article : Google Scholar : PubMed/NCBI

70 

Hausenloy DJ and Yellon DM: Myocardial ischemia-reperfusion injury: A neglected therapeutic target. J Clin Invest. 123:92–100. 2013. View Article : Google Scholar : PubMed/NCBI

71 

Liu T, He Z, Tian X, Kamal GM, Li Z, Liu Z, Liu H, Xu F, Wang J and Xiang H: Specific patterns of spinal metabolites underlying alpha-Me-5-HT-evoked pruritus compared with histamine and capsaicin assessed by proton nuclear magnetic resonance spectroscopy. Biochim Biophys Acta Mol Basis Dis. 1863:1222–1230. 2017. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang Q, Li ZX, Li YJ, He ZG, Chen YL, Feng MH, Li SY, Wu DZ and Xiang HB: Identification of lncRNA and mRNA expression profiles in rat spinal cords at various time‑points following cardiac ischemia/reperfusion . Int J Mol Med 43: 2361-2375, 2019.
APA
Wang, Q., Li, Z., Li, Y., He, Z., Chen, Y., Feng, M. ... Xiang, H. (2019). Identification of lncRNA and mRNA expression profiles in rat spinal cords at various time‑points following cardiac ischemia/reperfusion . International Journal of Molecular Medicine, 43, 2361-2375. https://doi.org/10.3892/ijmm.2019.4151
MLA
Wang, Q., Li, Z., Li, Y., He, Z., Chen, Y., Feng, M., Li, S., Wu, D., Xiang, H."Identification of lncRNA and mRNA expression profiles in rat spinal cords at various time‑points following cardiac ischemia/reperfusion ". International Journal of Molecular Medicine 43.6 (2019): 2361-2375.
Chicago
Wang, Q., Li, Z., Li, Y., He, Z., Chen, Y., Feng, M., Li, S., Wu, D., Xiang, H."Identification of lncRNA and mRNA expression profiles in rat spinal cords at various time‑points following cardiac ischemia/reperfusion ". International Journal of Molecular Medicine 43, no. 6 (2019): 2361-2375. https://doi.org/10.3892/ijmm.2019.4151
Copy and paste a formatted citation
x
Spandidos Publications style
Wang Q, Li ZX, Li YJ, He ZG, Chen YL, Feng MH, Li SY, Wu DZ and Xiang HB: Identification of lncRNA and mRNA expression profiles in rat spinal cords at various time‑points following cardiac ischemia/reperfusion . Int J Mol Med 43: 2361-2375, 2019.
APA
Wang, Q., Li, Z., Li, Y., He, Z., Chen, Y., Feng, M. ... Xiang, H. (2019). Identification of lncRNA and mRNA expression profiles in rat spinal cords at various time‑points following cardiac ischemia/reperfusion . International Journal of Molecular Medicine, 43, 2361-2375. https://doi.org/10.3892/ijmm.2019.4151
MLA
Wang, Q., Li, Z., Li, Y., He, Z., Chen, Y., Feng, M., Li, S., Wu, D., Xiang, H."Identification of lncRNA and mRNA expression profiles in rat spinal cords at various time‑points following cardiac ischemia/reperfusion ". International Journal of Molecular Medicine 43.6 (2019): 2361-2375.
Chicago
Wang, Q., Li, Z., Li, Y., He, Z., Chen, Y., Feng, M., Li, S., Wu, D., Xiang, H."Identification of lncRNA and mRNA expression profiles in rat spinal cords at various time‑points following cardiac ischemia/reperfusion ". International Journal of Molecular Medicine 43, no. 6 (2019): 2361-2375. https://doi.org/10.3892/ijmm.2019.4151
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team