Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
December-2019 Volume 44 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2019 Volume 44 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Osteoadherin serves roles in the regulation of apoptosis and growth in MC3T3‑E1 osteoblast cells

  • Authors:
    • Eri Hamaya
    • Toshiaki Fujisawa
    • Masato Tamura
  • View Affiliations / Copyright

    Affiliations: Department of Dental Anesthesiology, Faculty of Dental Medicine and Graduate School of Dental Medicine, Hokkaido University, Sapporo, Hokkaido 060‑8586, Japan, Department of Biochemistry and Molecular Biology, Faculty of Dental Medicine and Graduate School of Dental Medicine, Hokkaido University, Sapporo, Hokkaido 060‑8586, Japan
  • Pages: 2336-2344
    |
    Published online on: October 18, 2019
       https://doi.org/10.3892/ijmm.2019.4376
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Small leucine‑rich proteoglycans (SLRPs) are a class of proteoglycans that are characterized by small protein cores and structures of leucine‑rich repeats. SLRPs are expressed in most extracellular matrices and share numerous biological functions that are associated with binding of collagens and cell surface receptors. Osteoadherin (also termed osteomodulin) is encoded by the Omd gene and is a keratan sulfate proteoglycan of the class II subfamily of SLRPs. Osteoadherin is highly expressed in mineralized tissues, including bone and dentin; however, it's precise roles remain unknown. The present study determined the Omd expression levels and investigated the effects of over‑ and under‑expression of osteoadherin in osteoblastic cells. Omd mRNA expression increased with osteoblast differentiation in MC3T3‑E1 cells. In C2C12 cells, Omd mRNA expression was induced by bone morphogenetic protein (BMP)2. Reporter assays similarly demonstrated activation of the Omd gene promoter following co‑transfection with Smad1 and Smad4, which are intracellular signaling molecules of the BMP2 signaling pathway. Overexpression of Omd increased the viability and decreased caspase 3/7 activity in MC3T3‑E1 cells. By contrast, following transfection with small interfering RNA for Omd, viable cell numbers were decreased and caspase 3/7 activity was increased. Furthermore, overexpression of Omd reduced the expression of CCN family 2 in these cells. These results demonstrate that Omd expression is regulated during osteoblast differentiation, and that the protein product osteoadherin serves roles in the apoptosis and growth of osteoblast cells.

Introduction

Extracellular matrices (ECMs) provide cell microenvironments with several secreted molecules, such as collagens, glycoproteins, glycosaminoglycans (GAGs) and proteoglycans. Proteoglycans regulate cell behaviors by binding GAG chains or through direct protein-protein interactions via the core protein (1). The structure of small leucine-rich proteoglycans (SLRPs) consists of a small protein core with various GAG side chains, and SLRPs are grouped into five classes based on common structural properties (1,2). Osteoadherin, also termed osteomodulin (the Omd gene product), was originally isolated from guanidine extracts of bovine bone, and is a 47-kDa keratan sulfate proteoglycan of the class II subfamily of SLRPs (2,3). Several SLRPs are ECM components; however, osteoadherin is the only member that is restricted to mineralized tissues, such as bones and teeth (4-6). In bone tissues, Omd is expressed by fetal and adult osteoblasts, and its product osteoadherin can reach up to 400 µg/g wet weight in bovine bone (3).

As with numerous SLRPs, osteoadherin binds a number of ECM components; in particular, it binds fibrillar collagens to stabilize fibrillar tissue frameworks (7,8). Leucine-rich repeat (LRR) motifs comprise 6-10 repeats of ~20-29 amino acids with conserved leucine spacing, and are folded into structures with one β-sheet and one α-helix. LRRs participate in a wide range of biological processes, and interact directly with collagen, heparin-binding proteins and cell surface receptors to block ligand binding (9). Osteoadherin contains six closely spaced tyrosine sulfate residues in its N-terminal region and two in its C-terminal region (9,10). Tyrosine sulfate domains bind heparin-binding proteins, such as basic growth factor-2 and thrombospondin I (10). Osteoadherin also contains large numbers of acidic amino acid residues in its N-terminal region (3), which may bind to hydroxyapatite in calcified tissues and basic cluster motifs of heparin-binding proteins and growth factors (9,11). SLRPs also carry GAG chains that are covalently attached to the core protein, and can modulate biological functions depending on the nature of GAG chains. Through these interactions, SLRPs are involved in the initial triggering of multiple cellular responses in various tissues (2). However, it is unclear whether osteoadherin in bone tissues serves roles in the regulation of osteoblast growth, apoptosis, and differentiation.

Bone morphogenetic proteins (BMPs) regulate differentiation and proliferation in various cell types, including osteoblasts (12). BMP2 reportedly triggers osteoblast differentiation and upregulates several genes that encode osteoblast phenotype-related proteins in vitro (13). In the intracellular BMP2 signaling pathway, Smad1 is phosphorylated directly by type I receptors for BMP2 and is transported into the nucleus in complexes with Smad4 (14). This complex interacts with the regulatory elements of target genes and regulates their expression. To date, little is understood of how Omd expression is regulated in response to BMP2 during osteoblast differentiation.

Apoptosis can be initiated by various stimuli and is directed by a family of cysteine proteases known as caspases. At the molecular level, caspase activation plays a central role in the execution of apoptosis. To the best of our knowledge, so far, 14 mammalian caspases have been identified, three of which (caspase-3, -6 and -7) are the effector caspases that coordinate the execution phase of apoptosis by degrading multiple substrates, including the structural and regulatory proteins in the cell nucleus, cytoplasm and cytoskeleton (15).

The present study determined the Omd expression levels during osteoblast differentiation and investigated the effects of overexpression and knockdown of osteoadherin in osteoblast cells. Overexpression of Omd increased the numbers of viable cells and decreased the activity of caspase 3/7 in MC3T3-E1 cells. By contrast, knockdown of Omd decreased viable cell numbers and increased caspase 3/7 activity in these cells. Omd overexpression also reduced the expression of CCN family 2 (CCN2). Thus, it can be concluded that osteoadherin regulates apoptosis and growth in osteoblast cells.

Materials and methods

Reagents

Recombinant human BMP2 was kindly supplied by Astellas Pharma Ltd. Dexamethasone and 3-isobutyl-1-meth-ylxanthine (IBMX) were purchased from Sigma-Aldrich; Merck KGaA.

Cell cultures

MC3T3-E1 mouse osteoblast cells and C2C12 myoblast cells were obtained from RIKEN BioResource Center and were cultured in α-minimal essential medium (α-MEM; Sigma-Aldrich; Merck KGaA) containing 100 µg/ml kanamycin (Meiji Seika Kaisha, Ltd.) and 10% fetal bovine serum (FBS; Sigma-Aldrich; Merck KGaA) at 37°C under a humidified atmosphere containing 5% CO2, as described previously (16). MC3T3-E1 cells were cultured and differentiated in α-MEM containing 10% FBS, 10 mM β-glycerophosphate (Tokyo Chemical Industry Co., Ltd.) and 50 µg/ml ascorbic acid (Wako Pure Chemical Industries, Ltd.) for 1-3 weeks. Pre-adipocyte 3T3-L1 cells were purchased from DS Pharma Biomedical Co., Ltd. and grown in Dulbecco's modified Eagle's medium (DMEM; Sigma-Aldrich; Merck KGaA) supplemented with 10% FBS at 37°C until confluence. At 2 days after confluence (day 0), differentiation was induced in adipocyte cultures by adding 500 µM IBMX, 10 µg/ml insulin (Cell Science and Technology Institute, Inc.) and 1 µM dexamethasone to the basal medium. On day 3, media were replaced with adipogenic medium comprising DMEM supplemented with 10% FBS and 10 µg/ml insulin, which was changed every 2 days thereafter until analysis. C2C12 cells were seeded into culture dishes, and then cultured in media containing 50 or 200 ng/ml of BMP2 for 6-24 h. Cells of the mouse stromal cell line ST2 (RIKEN BioResource Center) were obtained and cultured as described previously (17). Similarly, bEnd.3 mouse vascular endothelial cells (American Type Culture Collection) (18) were cultured in DMEM supplemented with 10% FBS as described previously (19) and culture media were changed every 3-4 days.

Reverse transcription (RT)-semi-quantitative PCR (qPCR)

Total RNA was extracted from cells using ISOGEN (Nippon Gene Co., Ltd.) and complementary DNA was synthesized with the Omniscript RT kit (Qiagen GmbH) using an oligo(dT)15 primer (1 µM) at 37°C for 30 min. semi-qPCR analyses were performed with Taq DNA polymerase (Qiagen GmbH) as described previously (20). The specific primer sequences for each gene are listed in Table I. Each reaction consisted of an initial denaturation at 94°C for 3 min followed by three-step cycling: Denaturation at 94°C for 30 sec, annealing at a temperature optimized for each primer pair for 30 sec, and extension at 72°C for 40 sec. After the requisite number of cycles (25-35 cycles), reactions underwent a final extension at 72°C for 5 min. To accommodate the differences in RNA quantities, expression levels were normalized to those of the housekeeping gene GAPDH. Amplification products were separated using electrophoresis on 2% agarose gels and visualized by SYBR Green staining followed by UV light illumination. The relative intensity of the gel bands was measured using ImageJ software (version 1.52a; National Institutes of Health), and results were normalized to the GAPDH mRNA level.

Table I

Primers used for reverse transcription-semi-quantitative PCR.

Table I

Primers used for reverse transcription-semi-quantitative PCR.

SpecificityForward sequence (5′-3′)Reverse sequence (5′-3′)Predicted size, bp
Omd ATGGTGTATTCGCTAAACTTTCAA AAGATGATTATAGCAGAGGTCAAG194
Bgn TGCCACCGCCATTGTTCCATC GTTTGTGGAGGGACTGGCTAGA486
Dcn ATGGCAGTCTGGCCAATGTT GCCGTCTGAGGGTTACTTGT308
Fmod CATGATCTGCACCCCTTCTT AATGCAGAGGAAGCCAGGTC300
Lum CCTGAGGAATAACCAAATCGAC AGACCAGCAGGCAGCTTGCTCA393
GAPDH TCCACCACCCTGTTGCTGTA ACCACAGTCCATGCCATCAC452

[i] Omd, osteoadherin; Dcn, decorin; Bgn, biglycan; Fmod, fibromodulin; Lum, lumican.

RT-qPCR

Total RNA was extracted from cells using ISOGEN (Nippon Gene Co., Ltd.) and complementary DNA was synthesized with High-Capacity cDNA Reverse Transcription kit (Applied Biosystems; Thermo Fisher Scientific, Inc.) at 37°C for 60 min. RT-qPCR analyses were performed using the assay-on-demand TaqMan probes (Mm00449589_m1 for Omd, Mm00650798g1 for Npy1r, Mm00475834_m1 for Alp, Mm03413826_mH for Bglap, Mm01192932_g1 for Ccn2, and Mm99999915_g1 for GAPDH; Applied Biosystems; Thermo Fisher Scientific, Inc.) and the StepOne® real time PCR system, according to the manufacturer's protocol, as described previously (21). The qPCR thermocycling conditions included an initial denaturation of 95°C for 10 min followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min. Relative gene expression levels were quantified using the comparative 2-ΔΔCq method (22) using GAPDH expression as an endogenous control.

Western blot analysis

MC3T3-E1 cells were transfected according to the experimental conditions and then collected at specific time points, washed in ice-cold PBS, and suspended in CelLytic-M Mammalian cell lysis/extraction reagent (Sigma-Aldrich; Merck KGaA) plus a protease inhibitor (Complete mini; Roche Diagnostics). Whole-cell extracts were quantified using a Protein assay reagent (Bio-Rad Laboratories, Inc.) and ~30 µg protein/lane was separated using 10% SDS-PAGE followed by transfer to a polyvinylidene fluoride membrane (EMD Millipore). Blocking was performed with 0.3% skim milk (BD Biosciences) dissolved in TBS with 0.05% Tween-20 (TBST) for 1 h at room temperature. The membrane was probed with antibodies against osteoadherin (rabbit polyclonal anti-human polyclonal antibody; 1:2,000; cat. no. NBP2-19626; Novus Biologicals, LLC) or β-actin (rabbit polyclonal antibody; 1:2,000; cat. no. 20536-1-AP, ProteinTech Group, Inc.) for 1 h at room temperature. The membrane was subsequently washed three times and incubated with anti-mouse horseradish peroxidase-linked antibody (1:20,000; cat. no. NA934; GE Healthcare Life Sciences) in TBST for 1 h at room temperature. Following three additional washes, chemiluminescence detection was performed with ECL Prime Western Blotting Detection Reagent (GE Healthcare Life Sciences) and a LAS 1000 image analyzer, according to the manufacturer's instructions.

Reporter constructs and assays of luciferase activity

Luciferase reporter plasmids for the murine Omd promoter were generated as follows. The 1774-bp Omd promoter fragment (-1,609 to +165) (chromosome 13; MGI: 1350918) was isolated from mouse genomic DNA using PCR and was subcloned into the pGL4.12 vector (Promega Corporation) to generate the luciferase reporter plasmid pOmdluc. The nucleotide sequences of promoter regions were verified by sequencing. The Smad expression plasmids encoding wild-type Smad4 and constitutively active Smad1 (DVD) were provided by Dr Katagiri (Saitama Medical University, Saitama, Japan) (23). For the reporter assay, C2C12 cells were plated 24 h prior to transfection at a density of 1×105 cells/well (24-well plate) and cultured in α-MEM supplemented with 10% FBS. Transfection of plasmid DNA into cells was performed using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). Luciferase reporter assays were performed as described previously (20). Briefly, cells were lysed with a PicaGene cell culture lysis reagent Luc (Wako Pure Chemical Industries, Ltd.; cat. no. 300-04351) and firefly luciferase activities were measured using a Mini Lumat LB 9506 luminometer (Berthold Technologies). Luciferase activity was normalized by comparison with β-galactosidase activity and fold-changes in the luciferase activities of transfected cells were calculated on the basis of those in control MC3T3-E1 cells that were transfected with pcDNA3.

Transfection of small interfering RNAs (siRNAs)

MC3T3-E1 cells were transfected with 2.5 nM Silencer Select pre-designed siRNAs for osteoadherin (siOmd; Thermo Fisher Scientific Inc.; cat. nos. s77492 and s77494), the Y1 receptor (siY1; Thermo Fisher Scientific, Inc.; cat. no. s70765) or Silencer negative control siRNA no. 1 (siCont; Thermo Fisher Scientific, Inc.; cat. no. 4390843) using Lipofectamine RNAiMAX (Invitrogen; Thermo Fisher Scientific, Inc.) as previously described (16). Total RNA was extracted after 2 or 6 days for the determination of mRNA level. Total protein was extracted after 2 days for western blot analysis.

Generation of plasmid construct and overexpression of Omd

Omd overexpression plasmid was generated as follows and was subsequently designated pOmd. Total RNA was extracted from MC3T3-E1 cells using ISOGEN (Nippon Gene Co., Ltd.). Mouse Omd complementary DNA was reverse-transcribed from RNA using Omniscript RT kit (Qiagen), and then amplified using primers that flank the mouse Omd open reading frame (forward, 5′-CCA GCC CGA GGA CAA GAA AA-3′ and reverse, 5′-GGC TTT ATG GAG GCA TAA ATG TGT-3′) and PrimeSTAR Max DNA polymerase (Clontech Laboratories, Inc.), according to the manufacturer's instructions. PCR products were electrophoresed on 1% agarose gels and were purified and subcloned into KpnI and XbaI restriction sites of the pcDNA3 vector (Invitrogen; Thermo Fisher Scientific, Inc.) using In-Fusion HD cloning kit (Clontech Laboratories, Inc.; cat. no. 639648), according to the manufacturer's protocol. Individual clones of transformed Escherichia coli were isolated from agar plates and nucleotide sequences of each plasmid were confirmed by DNA sequencing. MC3T3-E1 cells were transfected in 24-well plates with 0.1 µg pOmd or empty vector (pcDNA3) using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol.

Alkaline phosphatase (ALP) staining analyses

MC3T3-E1 cells were plated onto 24-well plates at a density of 1.7×104/ml. Following 24 h, cells were transfected in 24-well plates with 0.1 µg pOmd or pcDNA3 and were cultured in α-MEM for 14 days. ALP staining was performed as previously described (20). Briefly, cells were rinsed in PBS, fixed in 10% formalin at room temperature for 30 min, rinsed again in PBS, and then incubated at room temperature for 1 h in 300 µl aliquots of solution containing 0.15 mg/ml 5-bromo-4 chloro-3-indolylphosphate, 0.3 mg/ml nitro-blue tetrazolium (Wako Pure Chemical Industries, Ltd.), 0.1 M Tris-HCl (pH 9.0), 0.01 N NaOH and 0.05 mM MgCl2. Images were captured using an iPhone7 smartphone (Apple Corporation). The same settings were applied to all experimental samples.

Quantitation of cell viability

Cell counting kit-8 (Dojindo Molecular Technologies, Inc.; cat no. CK04-01) were used to evaluate cell viability. In these experiments, 10-µl aliquots of the WST-8 substrate [5-mM 2-(2-methoxy-4-nitrophenyl)-3-(4-nitr ophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium, monosodium salt] were added to each well. After incubation for 1 h at 37°C, optical densities were measured at a wavelength of 450 nm using a microplate absorbance reader. Data are expressed as fold changes of transfected samples relative to cell numbers in samples transfected with control siRNA or pcDNA3.

Measurements of caspase 3/7 activity

The enzyme activities of caspase 3/7 were determined using a caspase colorimetric assay (Caspase-Glo 3/7 assay system; Promega Corporation) as described previously (21). Briefly, for each reaction, cells were lysed and incubated with luminogenic substrates containing the Asp-Glu-Val-Asp sequence, which is cleaved by activated caspase 3/7. Following incubation at room temperature for 1 h, luminescence was quantified using a Mini Lumat LB 9506 luminometer (Berthold Technologies). Fold changes in caspase 3/7 activity in transfected cells were calculated on the basis of those in control siRNA or pcDNA3 transfected MC3T3-E1 cells.

Statistical analysis

Data are expressed as the mean ± standard deviation of three to six independent experiments. Comparison of two groups was performed with a Student's t-test using Microsoft Excel version 2016 (Microsoft Corporation). Comparisons of multiple groups were performed using one-way analysis of variance using Microsoft Excel version 2016 (Microsoft Corporation) followed by Dunnett's multiple comparison test using software provided by Osaka University, Osaka, Japan (http://www.gen-info.osaka-u.ac.jp/MEPHAS/dunnett-e.html). P<0.05 was considered to indicate a statistically significant difference.

Results

SLRP mRNA expression levels in cultured cells

To evaluate the roles of osteoadherin in mesenchymal cells, Omd mRNA expression levels were determined in various mesenchymal cell cultures and compared with those of other SLRPs, including biglycan, decorin, fibromodulin, and lumican, using RT-semi-qPCR analyses. Omd mRNA was expressed in MC3T3-E1 cells (osteoblasts) but not in C2C12 myoblasts, adipocyte differentiated 3T3-L1 cells, ST2 bone marrow stromal cells or bEnd.3 endothelial cells (Fig. 1A). By contrast, biglycan (Bgn), decorin (Dcn) and fibromodulin (Fmod) mRNA expression was detected in MC3T3-E1, C2C12 and 3T3-L1 cells. Meanwhile, lumican (Lum) mRNA was expressed only in MC3T3-E1 and 3T3-L1 cells. Analysis of the Omd and Bgn mRNA/GAPDH mRNA ratio in various mesenchymal cell cultures is presented in Fig. 1B. These data indicate that Omd expression varies during osteoblast differentiation. To determine whether Omd expression reflects the stages of osteoblast differentiation, MC3T3-E1 cells were cultured in differentiation medium for 1-3 weeks and expression levels of Omd mRNA were determined using RT-qPCR. Omd mRNA expression was significantly increased from 1 week and increased further over the culture period of 3 weeks in differentiating osteoblast cells (Fig. 1C). Protein levels were also assayed using western blot analysis and were identified to be increased during in vitro osteoblastic differentiation in MC3T3-E1 cells (Fig. 1D).

Figure 1

SLRP mRNA expression levels under various culture conditions. (A) Total RNA was extracted from MC3T3-E1, 3T3-L1, C2C12, ST2 and bEnd.3 cells, and mRNA expression levels of the SLRPs Omd, Dcn, Bgn, Fmod and Lum were determined using RT-semi-qPCR analyses. Equal loading of cDNA samples was confirmed by amplification of GAPDH cDNA. The presented data are representative of three experiments with similar results. (B) mRNA expression levels of Omd and Bgn normalized to GAPDH. (C) Confluent MC3T3-E1 cells were incubated in differentiation media for 1-3 weeks. Total RNA was extracted from cells and Omd mRNA expression was determined using RT-qPCR. mRNA expression levels were normalized to those of GAPDH, and are presented as fold changes relative to the expression levels in control cells. (D) Confluent MC3T3-E1 cells were incubated in differentiation media for 2 weeks. Total protein was extracted from MC3T3-E1 cells and the levels of Omd protein were determined by western blot analysis. β-actin was used as an endogenous control. Data are presented as the mean ± standard deviation of separate experiments performed in triplicate. *P<0.05 vs. week 0. SLRP, small leucine-rich proteoglycan; Omd, osteoadherin; Dcn, decorin; Bgn, biglycan; Fmod, fibromodulin; Lum, lumican; RT, reverse transcription; qPCR, quantitative PCR; cDNA, complementary DNA.

BMP2 induces Omd expression in C2C12 cells and regulates Omd promoter activity via Smad signaling

To further investigate the roles of osteoadherin in osteoblast differentiation, experiments were performed with C2C12 cells, which are well-characterized model cells that differentiate into myotubes or osteoblasts by the presence of BMP2 (13). In C2C12 cells, Omd mRNA expression was not detected using RT-semi-qPCR analyses (Fig. 1A). However, in subsequent RT-qPCR analyses, Omd mRNA expression was increased >10-fold after treatment with 50 ng/ml BMP2. A higher BMP2 concentration increased the expression of Omd mRNA to >30-fold at 200 ng/ml (Fig. 2A). In time course analyses of BMP2-induced Omd mRNA expression, Omd mRNA expression increased after 6 h, and a significant time-dependent increase in mRNA level was observed at 24 h (Fig. 2B). These findings indicate that BMP2 induces Omd expression in these cells.

Figure 2

BMP2 signaling induces Omd expression and Omd promoter activity in C2C12 cells. (A) C2C12 cells were seeded into culture dishes at 1.5×106 cells/cm2. On day 1 of culture, cells were cultured in media containing indicated concentrations of BMP2 or vehicle (0), and total RNA was extracted from cells after 2 days. *P<0.05 vs. 0 ng/ml. (B) C2C12 cells were seeded into 100-mm cell culture dishes and, after 24 h, were cultured in fresh media containing 200 ng/ml BMP2 for the indicated times. Omd mRNA expression was determined using reverse transcription-quantitative PCR. *P<0.05 vs. 0 h. (C) C2C12 cells were transiently transfected with the pOmd-luc reporter plasmid in 24-well plates. Subsequently, 200 ng/ml BMP2 (+) or vehicle (-) was added and cells were cultured for a further 24 h prior to determinations of luciferase activity. (D) C2C12 cells were transiently co-transfected in 24-well plates with the reporter plasmid pOmd-luc and expression constructs for Smad1 or Smad4, or an empty expression plasmid (pcDNA3). Luciferase activities were determined after 48 h. Normalized luciferase activities are presented as relative ratios. *P<0.05 vs. pcDNA3. Data are presented as the mean ± standard deviation from separate experiments performed in triplicate. BMP, bone morphogenetic protein; Omd, osteoadherin.

To elucidate the mechanisms by which BMP2 signaling activates Omd transcription, the present study cloned an ~1.7 kb-pair mouse genomic DNA fragment corresponding to the 5'-flanking promoter region of the mouse Omd gene. To determine responsiveness to BMP2 signaling, this Omd promoter region was ligated into a luciferase reporter expression vector (pOmd-luc), and luciferase activity was observed in BMP2-treated C2C12 cells (Fig. 2C). Transient transfection of these cells with pOmd-luc and co-transfection with Smad1 (DVD) and Smad4 expression plasmids resulted in a significant increase in luciferase activity (Fig. 2D). However, co-transfection with Smad1 (DVD) and Smad4 expression plasmids did not alter pOmd-luc activity in MC3T3-E1 cells (data not shown).

Knockdown of Y1 receptor upregulates Omd mRNA expression in MC3T3-E1 cells

Several studies have reported that neuropeptide Y and its Y1 receptor are directly involved in osteoblast regulation (24-26). Previously, we demonstrated that knockdown of the Y1 receptor using siRNA promotes osteoblast differentiation (16). Therefore, the present study examined the effects of Y1 receptor inhibition on Omd mRNA expression. Following transfection of MC3T3-E1 cells with siRNA for the Y1 receptor, Y1 receptor (Npy1r) mRNA expression level was decreased to undetectable levels, confirming that the siRNA was effective at silencing endogenous Y1 receptor expression (Fig. 3A). Under these conditions, Omd mRNA expression was significantly increased (Fig. 3B), indicating that Omd expression is Y1 receptor dependent and that the NPY signaling pathway regulates Omd expression in MC3T3-E1 cells.

Figure 3

Knockdown of the Y1 receptor upregulates Omd mRNA expression in MC3T3-E1 cells. (A) MC3T3-E1 cells were plated at 1.7×104 cells/cm2 and were cultured for 24 h. Cells were then transfected with siY1 or siCont (both at 5 nM) and were incubated again for 2-6 days. Total RNA was extracted, and (A) after 2 days Npy1r, and (B) after 2 and 6 days Omd mRNA expression levels were determined using reverse transcription-quantitative PCR analyses. Expression levels were normalized to those of GAPDH and fold changes were calculated relative to the control. Data are presented as the mean ± standard deviation of separate experiments performed in triplicate. *P<0.05. siY1, Y1 receptor small interfering RNA; siCont, scramble small interfering RNA; Omd, osteoadherin; Npy1r, Y1 receptor.

Effects of overexpression or knockdown of Omd on viability and apoptosis in MC3T3-E1 cells

To determine the biological relevance of Omd regulation in osteoblast differentiation, Omd was significantly overexpressed in MC3T3-E1 cells by transfecting cells with the pOmd expression plasmid (Fig. 4A). Western blot analysis demonstrated that osteoadherin protein was overexpressed in pOmd-transfected MC3T3-E1 cells (Fig. 4B). Viability was significantly increased in these cells compared with those transfected with control plasmid (Fig. 4C). Caspase 3/7 activity, which is associated with apoptosis (15), was also significantly decreased following transfection with pOmd (Fig. 4D), which further indicates that Omd is involved in the regulation of apoptosis in MC3T3-E1 cells.

Figure 4

Effects of overexpression and knockdown of Omd on cell proliferation and apoptosis in MC3T3-E1 cells. MC3T3-E1 cells were plated at 1.0×105 cells/cm2. Following culture for 24 h, cells were transfected with pOmd or pcDNA3. (A) Total RNA was extracted after 2 days and Omd mRNA expression levels were determined using RT-qPCR. (B) Total protein was extracted from MC3T3-E1 cells and the levels of osteoadherin protein were determined by western blot analysis. (C) Viable cell numbers were quantified. (D) The activity of caspase 3/7 was measured. (E) MC3T3-E1 cells were plated at 1.7×104 cells/cm2. Following culture for 24 h, cells were transfected with siOmd or siCont (both at 5 nM). Total RNA was extracted after 1 day and Omd mRNA expression levels were determined using RT-qPCR. (F) Total protein was extracted from MC3T3-E1 cells and the levels of osteoadherin protein were determined by western blot analysis. (G) Viable cell numbers were quantified. (H) The activity of caspase 3/7 was measured. (A and E) Expression levels were normalized to those of GAPDH and are presented as fold changes relative to the control. (B and F) β-actin was used as an endogenous control. Fold changes in viable cell numbers and activities were calculated on the basis of those in control cells (those transfected with siCont or pcDNA3). Data are presented as the mean ± standard deviation of separate experiments performed in triplicate. *P<0.05 vs. pcDNA3 or siCont. Omd, osteoadherin; siOmd, Omd small interfering RNA; siCont, scramble small interfering RNA; pOmd, Omd overexpression plasmid; RT-qPCR, reverse transcription-quantitative PCR.

In further experiments, the effects of Omd-knockdown was examined using RNA interference in MC3T3-E1 cells. Following transfection with Omd siRNA, Omd mRNA expression was significantly decreased (Fig. 4E). As presented in Fig. 4F, cells transfected with Omd siRNA exhibited a reduction in osteoadherin expression compared with cells transfected with siCont. Viable cell numbers were decreased compared with those in control siRNA-transfected cells, although statistical significance between control siRNA- and Omd siRNA-transfected cells was not confirmed (Fig. 4G). By contrast, caspase 3/7 activity was significantly increased following exposure to Omd siRNA (Fig. 4H). These results indicate that cell survival/death is Omd-dependent and that osteoadherin may regulate cell growth and apoptosis in osteoblast cells.

Effects of Omd overexpression on the mRNA expression of specific osteoblast differentiation genes in MC3T3-E1 cells

To investigate the effects of osteoadherin in osteoblast differentiation, the present study examined the effects on genes with characterized roles in osteoblast differentiation. Following transfection with Omd siRNA, Alp mRNA expression level and ALP activities were not affected in MC3T3-E1 cells (data not shown). Although Alp and Bglap mRNA expression levels were not significantly altered by Omd overexpression, Ccn2 expression was significantly reduced (Fig. 5A). However, as ALP activity was not affected by Omd overexpression on day 14 (Fig. 5B), it can be concluded that osteoblast-related gene expression is not dependent on Omd in MC3T3-E1 cells.

Figure 5

Effects of Omd overexpression on the mRNA expression levels of genes related to osteoblast differentiation in MC3T3-E1 cells. MC3T3-E1 cells were plated at 1.7×104 cells/cm2 and were cultured. After 24 h, cells were transfected with pOmd or pcDNA3 plasmids and were incubated. (A) Total RNA was then extracted after 2 days and Alp, Bglap and Ccn2 mRNA expression levels were determined using reverse transcription-quantitative PCR. Fold changes in mRNA expression levels were calculated relative to expression levels in control cells transfected with pcDNA3. Data are presented as the mean ± standard deviation from separate experiments performed in triplicate. *P<0.05 vs. pcDNA3. (B) After transfection with pOmd or pcDNA3, cells were cultured for 14 days and ALP activities were investigated using staining analyses. Bglap, osteocalcin; Alp, alkaline phosphatase; Ccn2, CCN family 2; Omd, osteoadherin; pOmd, Omd overexpression plasmid.

Discussion

SLRP family members are secreted into the ECM after synthesis by the cells of connective tissues. These proteoglycans have core proteins with LRRs and are important structural components of the ECM. Accordingly, numerous SLRPs have been reported to bind multiple ECM constituents, particularly fibrillar collagens, and thereby stabilize tissue frameworks (7,8). SLRPs include five classes of structurally related proteoglycans. Among them, osteoadherin, fibromodulin, keratocan and lumican are class II SLRPs (2), and osteoadherin has highly restricted expression in cells of mineralized tissues (4,6). In the present study, BMP2 enhanced Omd expression in C2C12 cells. Y1R inhibition also enhanced Omd expression, suggesting specific functions of osteoadherin in bone homeostasis and osteoblast differentiation. The class I SLPRs biglycan and decorin are also expressed in osteoblasts and are present in bone ECM (2,27), and their affinity for bone apatite has been demonstrated by chromatographic purification with hydroxyapatite columns (28). These observations suggest significant roles of these SLPRs in the regulation of mineralization (28). Osteoadherin also interacts with calcium phosphate mineral (29), suggesting that osteoadherin contributes to biomineralization and the control of mineral crystal nucleation, growth, and maturation.

Although few previous reports show regulation of Omd expression by growth factors and signaling molecules, Rehn et al (30) reported that transforming growth factor-β (TGF-β) down-regulates Omd expression in osteoblasts. The present study demonstrated that BMP2 enhances Omd gene expression and activates the Omd gene promoter. Upon activation by BMP2, Smad1/Smad4 complexes regulate the transcription of various target genes, and among these Id1, Tlx-2 and Mix.2 reportedly respond to BMP signaling via the Smad-binding motifs on their promoters (23,31,32). Several DNA binding motifs for Smads, including GTCT, have been identified (33). The present analyses indicate the presence of transcriptional machinery that is sensitive to BMP2 signaling and regulates transcription through interactions with the Omd promoter.

SLRPs have multiple complex roles. Class II SLRPs contain charged KS chains in their LRRs and N termini with multiple sulfated tyrosine residues that contribute to the anionic properties of these proteoglycans. The GAG KS is reportedly present in several tissues, including bone, cartilage, reproductive and neural tissues (1,2). KS binds the growth factors fibroblast growth factor 2, TGF-β and sonic hedgehog with high affinity (34,35), suggesting roles of KS proteoglycans in the regulation of growth factor activities and morphogen gradient formation. Decorin has been characterized as a proteoglycan with roles in the control of cell growth (2), as indicated by binding and inhibition of TGF-β. Biglycan also interacts with TGF-β and modulates its activities (2). In addition, decorin was reported to interact with epidermal growth factor receptor and vascular endothelial growth factor receptor, and consequently regulate the cell cycle (2,9,36). The KS of osteoadherin interacts with fibronectin to promote osteoblast attachment in vitro (3). Furthermore, the tyrosine sulfate-rich domains of osteoadherin have been shown to bind motifs of basic clusters in a variety of heparin-binding proteins, including some with bioactive properties (10). These studies suggest that osteoadherin binds various growth factors, growth factor receptors and matrix proteins that regulate apoptosis and cell growth via cell cycle- and proliferation-related mechanisms.

CCN2, which is widely considered a connective tissue growth factor, is a cysteine-rich ECM protein that acts as an anabolic growth factor to regulate cell functions (37,38). Ccn2 mRNA expression also induces apoptosis in human aortic smooth muscle cells (39), breast cancer cells (40) and mouse osteocytes (41) by down-regulating anti-apoptotic genes. In accordance with these observations, Omd overexpression reduced Ccn2 expression in MC3T3-E1 cells in the present study, suggesting an apoptotic mechanism involving CCN2 that is regulated by osteoadherin expression in osteoblasts.

In conclusion, the present study, to the best of our knowledge, is the first to show that osteoadherin regulates apoptosis and proliferation in osteoblast cells, and thus established a molecular relationship between osteoblast-derived SLRP osteoadherin and caspase 3/7 activity in osteoblasts. However, the mechanism of regulation on caspase 3/7 activity by osteoadherin remains unclear. Further investigations are required to identify molecular mechanisms of osteoadherin and associated signaling molecules.

Acknowledgments

Not applicable.

Funding

The present study was supported in part by a research grant from the Japan Society for the Promotion of Science Grants-in-aid for Scientific Research (grant no. 17K1163707).

Availability of data and materials

The datasets generated and/or analyzed during the present study are available from the corresponding author on reasonable request.

Authors' contributions

EH and MT conceived and designed the experiments. EH performed the experiments. EH and TF analyzed the data. EH and MT wrote the manuscript. All authors read and approved the final manuscript for publication.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Heinegård D: Fell-Muir Lecture: Proteoglycans and more-from molecules to biology. Int J Exp Pathol. 90:575–586. 2009. View Article : Google Scholar

2 

Iozzo RV and Schaefer L: Proteoglycan form and function: A comprehensive nomenclature of proteoglycans. Matrix Biol. 42:11–55. 2015. View Article : Google Scholar : PubMed/NCBI

3 

Wendel M, Sommarin Y and Heinegård D: Bone matrix proteins: Isolation and characterization of a novel cell-binding keratan sulfate proteoglycan (osteoadherin) from bovine bone. J Cell Biol. 141:839–847. 1998. View Article : Google Scholar : PubMed/NCBI

4 

Sommarin Y, Wendel M, Shen Z, Hellman U and Heinegârd D: Osteoadherin, a cell-binding keratan sulfate proteoglycan in bone, belongs to the family of leucine-rich repeat proteins of the extracellular matrix. J Biol Chem. 273:16723–16729. 1998. View Article : Google Scholar : PubMed/NCBI

5 

Buchaille R, Couble ML, Magloire H and Bleicher F: Expression of the small leucine-rich proteoglycan osteoadherin/osteo-modulin in human dental pulp and developing rat teeth. Bone. 27:265–270. 2000. View Article : Google Scholar : PubMed/NCBI

6 

Nikdin H, Olsson ML, Hultenby K and Sugars RV: Osteoadherin accumulates in the predentin towards the mineralization front in the developing tooth. PLoS One. 7:e315252012. View Article : Google Scholar : PubMed/NCBI

7 

Sjöberg AP, Manderson GA, Mörgelin M, Day AJ, Heinegård D and Blom AM: Short leucine-rich glycoproteins of the extracellular matrix display diverse patterns of complement interaction and activation. Mol Immunol. 46:830–839. 2009. View Article : Google Scholar :

8 

Kalamajski S and Oldberg A: The role of small leucine-rich proteoglycans in collagen fibrillogenesis. Matrix Biol. 29:248–253. 2010. View Article : Google Scholar : PubMed/NCBI

9 

Schaefer L and Iozzo RV: Biological functions of the small leucine-rich proteoglycans: From genetics to signal transduction. J Biol Chem. 283:21305–21309. 2008. View Article : Google Scholar : PubMed/NCBI

10 

Tillgren V, Onnerfjord P, Haglund L and Heinegård D: The tyrosine sulfate-rich domains of the LRR proteins fibromodulin and osteoadherin bind motifs of basic clusters in a variety of heparin-binding proteins, including bioactive factors. J Biol Chem. 284:28543–28553. 2009. View Article : Google Scholar : PubMed/NCBI

11 

Rehn AP, Cerny R, Sugars RV, Kaukua N and Wendel M: Osteoadherin is upregulated by mature osteoblasts and enhances their in vitro differentiation and mineralization. Calcif Tissue Int. 82:454–464. 2008. View Article : Google Scholar : PubMed/NCBI

12 

Canalis E, Economides AN and Gazzerro E: Bone morphogenetic proteins, their antagonists, and the skeleton. Endocr Rev. 24:218–235. 2003. View Article : Google Scholar : PubMed/NCBI

13 

Chen G, Deng C and Li YP: TGF-β and BMP signaling in osteoblast differentiation and bone formation. Int J Biol Sci. 8:272–288. 2012. View Article : Google Scholar :

14 

Katagiri T and Tsukamoto S: The unique activity of bone morphogenetic proteins in bone: A critical role of the Smad signaling pathway. Biol Chem. 394:703–714. 2013. View Article : Google Scholar : PubMed/NCBI

15 

Van Opdenbosch N and Lamkanfi M: Caspases in cell death, inflammation, and disease. Immunity. 50:1352–1364. 2019. View Article : Google Scholar : PubMed/NCBI

16 

Yahara M, Tei K and Tamura M: Inhibition of neuropeptide Y Y1 receptor induces osteoblast differentiation in MC3T3-E1 cells. Mol Med Rep. 16:2779–2784. 2017. View Article : Google Scholar : PubMed/NCBI

17 

Tamura M, Sato MM and Nashimoto M: Regulation of CXCL12 expression by canonical Wnt signaling in bone marrow stromal cells. Int J Biochem Cell Biol. 43:760–767. 2011. View Article : Google Scholar : PubMed/NCBI

18 

Montesano R, Pepper MS, Möhle-Steinlein U, Risau W, Wagner EF and Orci L: Increased proteolytic activity is responsible for the aberrant morphogenetic behavior of endothelial cells expressing the middle T oncogene. Cell. 62:435–445. 1990. View Article : Google Scholar : PubMed/NCBI

19 

Tsuji-Tamura K and Ogawa M: Dual inhibition of mTORC1 and mTORC2 perturbs cytoskeletal organization and impairs endothelial cell elongation. Biochem Biophys Res Commun. 497:326–331. 2018. View Article : Google Scholar : PubMed/NCBI

20 

Nakashima A, Katagiri T and Tamura M: Cross-talk between Wnt and bone morphogenetic protein 2 (BMP-2) signaling in differentiation pathway of C2C12 myoblasts. J Biol Chem. 280:37660–37668. 2005. View Article : Google Scholar : PubMed/NCBI

21 

Iizuka S, Oridate N, Nashimoto M, Fukuda S and Tamura M: Growth inhibition of head and neck squamous cell carcinoma cells by sgRNA targeting the cyclin D1 mRNA based on TRUE gene silencing. PLoS One. 9:e1141212014. View Article : Google Scholar : PubMed/NCBI

22 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar

23 

Nojima J, Kanomata K, Takada Y, Fukuda T, Kokabu S, Ohte S, Takada T, Tsukui T, Yamamoto TS, Sasanuma H, et al: Dual roles of smad proteins in the conversion from myoblasts to osteoblastic cells by bone morphogenetic proteins. J Biol Chem. 285:15577–15586. 2010. View Article : Google Scholar : PubMed/NCBI

24 

Teixeira L, Sousa DM, Nunes AF, Sousa MM, Herzog H and Lamghari M: NPY revealed as a critical modulator of osteoblast function in vitro: New insights into the role of Y1 and Y2 receptors. J Cell Biochem. 107:908–916. 2009. View Article : Google Scholar : PubMed/NCBI

25 

Khor EC and Baldock P: The NPY system and its neural and neuroendocrine regulation of bone. Curr Osteoporos Rep. 10:160–168. 2012. View Article : Google Scholar : PubMed/NCBI

26 

Kurebayashi N, Sato M, Fujisawa T, Fukushima K and Tamura M: Regulation of neuropeptide Y Y1 receptor expression by bone morphogenetic protein 2 in C2C12 myoblasts. Biochem Biophys Res Commun. 439:506–510. 2013. View Article : Google Scholar : PubMed/NCBI

27 

Nikitovic D, Aggelidakis J, Young MF, Iozzo RV, Karamanos NK and Tzanakakis GN: The biology of small leucine-rich proteogly-cans in bone pathophysiology. J Biol Chem. 287:33926–33933. 2012. View Article : Google Scholar : PubMed/NCBI

28 

Boskey AL, Spevak L, Doty SB and Rosenberg L: Effects of bone CS-proteoglycans, DS-decorin, and DS-biglycan on hydroxyapatite formation in a gelatin gel. Calcif Tissue Int. 61:298–305. 1997. View Article : Google Scholar : PubMed/NCBI

29 

Zhou HY: Proteomic analysis of hydroxyapatite interaction proteins in bone. Ann N Y Acad Sci. 1116:323–326. 2007. View Article : Google Scholar : PubMed/NCBI

30 

Rehn AP, Chalk AM and Wendel M: Differential regulation of osteoadherin (OSAD) by TGF-beta1 and BMP-2. Biochem Biophys Res Commun. 349:1057–1064. 2006. View Article : Google Scholar : PubMed/NCBI

31 

Tang SJ, Hoodless PA, Lu Z, Breitman ML, McInnes RR, Wrana JL and Buchwald M: The Tlx-2 homeobox gene is a downstream target of BMP signalling and is required for mouse mesoderm development. Development. 125:1877–1887. 1998.PubMed/NCBI

32 

Dennler S, Itoh S, Vivien D, ten Dijke P, Huet S and Gauthier JM: Direct binding of Smad3 and Smad4 to critical TGF beta-inducible elements in the promoter of human plasminogen activator inhibitor-type 1 gene. EMBO J. 17:3091–3100. 1998. View Article : Google Scholar : PubMed/NCBI

33 

Zawel L, Dai JL, Buckhaults P, Zhou S, Kinzler KW, Vogelstein B and Kern SE: Human Smad3 and Smad4 are sequence-specific transcription activators. Mol Cell. 1:611–617. 1998. View Article : Google Scholar : PubMed/NCBI

34 

Schaefer L and Schaefer RM: Proteoglycans: From structural compounds to signaling molecules. Cell Tissue Res. 339:237–246. 2010. View Article : Google Scholar

35 

Weyers A, Yang B, Solakyildirim K, Yee V, Li L, Zhang F and Linhardt RJ: Isolation of bovine corneal keratan sulfate and its growth factor and morphogen binding. FEBS J. 280:2285–2293. 2013. View Article : Google Scholar : PubMed/NCBI

36 

Buraschi S, Neill T, Goyal A, Poluzzi C, Smythies J, Owens RT, Schaefer L, Torres A and Iozzo RV: Decorin causes autophagy in endothelial cells via Peg3. Proc Natl Acad Sci USA. 110:E2582–E2591. 2013. View Article : Google Scholar : PubMed/NCBI

37 

Chen CC and Lau LF: Functions and mechanisms of action of CCN matricellular proteins. Int J Biochem Cell Biol. 41:771–783. 2009. View Article : Google Scholar :

38 

Kubota S and Takigawa M: Cellular and molecular actions of CCN2/CTGF and its role under physiological and pathological conditions. Clin Sci (Lond). 128:181–196. 2015. View Article : Google Scholar

39 

Hishikawa K, Oemar BS, Tanner FC, Nakaki T, Fujii T and Lüscher TF: Overexpression of connective tissue growth factor gene induces apoptosis in human aortic smooth muscle cells. Circulation. 100:2108–2112. 1999. View Article : Google Scholar : PubMed/NCBI

40 

Hishikawa K, Oemar BS, Tanner FC, Nakaki T, Lüscher TF and Fujii T: Connective tissue growth factor induces apoptosis in human breast cancer cell line MCF-7. J Biol Chem. 274:37461–37466. 1999. View Article : Google Scholar : PubMed/NCBI

41 

Sakai Y, Balam TA, Kuroda S, Tamamura N, Fukunaga T, Takigawa M and Takano-Yamamoto T: CTGF and apoptosis in mouse osteocytes induced by tooth movement. J Dent Res. 88:345–350. 2009. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Hamaya E, Fujisawa T and Tamura M: Osteoadherin serves roles in the regulation of apoptosis and growth in MC3T3‑E1 osteoblast cells. Int J Mol Med 44: 2336-2344, 2019.
APA
Hamaya, E., Fujisawa, T., & Tamura, M. (2019). Osteoadherin serves roles in the regulation of apoptosis and growth in MC3T3‑E1 osteoblast cells. International Journal of Molecular Medicine, 44, 2336-2344. https://doi.org/10.3892/ijmm.2019.4376
MLA
Hamaya, E., Fujisawa, T., Tamura, M."Osteoadherin serves roles in the regulation of apoptosis and growth in MC3T3‑E1 osteoblast cells". International Journal of Molecular Medicine 44.6 (2019): 2336-2344.
Chicago
Hamaya, E., Fujisawa, T., Tamura, M."Osteoadherin serves roles in the regulation of apoptosis and growth in MC3T3‑E1 osteoblast cells". International Journal of Molecular Medicine 44, no. 6 (2019): 2336-2344. https://doi.org/10.3892/ijmm.2019.4376
Copy and paste a formatted citation
x
Spandidos Publications style
Hamaya E, Fujisawa T and Tamura M: Osteoadherin serves roles in the regulation of apoptosis and growth in MC3T3‑E1 osteoblast cells. Int J Mol Med 44: 2336-2344, 2019.
APA
Hamaya, E., Fujisawa, T., & Tamura, M. (2019). Osteoadherin serves roles in the regulation of apoptosis and growth in MC3T3‑E1 osteoblast cells. International Journal of Molecular Medicine, 44, 2336-2344. https://doi.org/10.3892/ijmm.2019.4376
MLA
Hamaya, E., Fujisawa, T., Tamura, M."Osteoadherin serves roles in the regulation of apoptosis and growth in MC3T3‑E1 osteoblast cells". International Journal of Molecular Medicine 44.6 (2019): 2336-2344.
Chicago
Hamaya, E., Fujisawa, T., Tamura, M."Osteoadherin serves roles in the regulation of apoptosis and growth in MC3T3‑E1 osteoblast cells". International Journal of Molecular Medicine 44, no. 6 (2019): 2336-2344. https://doi.org/10.3892/ijmm.2019.4376
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team