This article is mentioned in:

Introduction

Cardiac fibrosis is the major pathological process in ventricular remodelling occurring after myocardial infarction (MI), and is characterised by deposition of extracellular matrix proteins and ventricular dysfunction (1). Multiple pathophysiological factors contribute to the process, including the inflammatory response, activation of the renin-angiotensin-aldosterone system, oxidative stress and apoptosis (2,3). Chronic infiltration of inflammatory cells, particularly macrophages, following MI can lead to the formation of scar tissue, and macrophage-secreted transforming growth factor β (TGF-β) is a major molecule involved in fibrosis following MI (4). In addition, experimental evidence has indicated that the increased production of reactive oxygen species (ROS) contributes to myocardial fibrosis occurring after MI (5). ROS from multiple sources participate in this process, including xanthine oxidase, inflammatory cells, mitochondria and NADPH oxidases (Noxs) (6,7). Nox2 and Nox4 were identified as the major sources of ROS in the heart, while Nox2 deficiency has been reported to mitigate angiotensin II-induced cardiac hypertrophy in mice (8). Studies have also demonstrated that Nox2 knockout mice exhibited reduced interstitial fibrosis and improved survival rates in a myocardial-infarction model, when compared with those in the control group (9). An in vitro study verified that Nox4 knockdown led to decreased fibronectin and collagen synthesis in cardiac fibroblasts treated with angiotensin II (10). In addition, a large amount of ROS exacerbated apoptosis and inflammatory cell infiltration following MI, thus worsening tissue injury and cardiac fibrosis (11).

Imbalances in the production of ROS and the antioxidant capability of the biological system are also important causes of cardiac dysfunction. AMP-activated protein kinase (AMPK) is a critical regulator of cardiomyocyte energy homeostasis and survival. Activation of AMPK has been reported to display a protective effect in myocardial ischaemia-induced damage. AMPK also suppresses oxidative stress through the activation of nuclear factor erythroid 2-related factor 2 (Nrf2) and haem oxygenase (HO)-1, and ameliorates tissue damage (12,13).

Corosolic acid (CRA) is a triterpenoid compound discovered in numerous medicinal herbs, particularly in Lagerstroemia speciosa L. (also known as Banaba). CRA initially attracted much attention for its anti-diabetic function (14), while further studies demonstrated that CRA has more functions, including antitumour (15) and anti-atherosclerotic properties (16). Previous studies have confirmed that CRA inhibits acute inflammation by regulating IRAK-1 phosphorylation via an NF-κB-independent pathway in macrophages (17). In addition, in endothelial dysfunction, CRA protects mitochondrial function by regulating Drp1 phosphorylation (Ser637) in an AMPK-dependent manner, which contributes to inhibiting Nox2 oxidase signalling and suppressing NLRP3 inflammasome activation (18). However, to the best of our knowledge, the effects of CRA on post-MI remodelling have not been reported to date.

Therefore, in the present study, the aim was to evaluate the effects of CRA on MI induced by coronary artery ligation in mice and to explore the underlying mechanism.

Materials and methods

Animals

All animal experimental protocols were approved by the Animal Care and Use Committee of Renmin Hospital of Wuhan University (Wuhan, China) and were conducted in accordance with the National Institutes of Health (NIH) Guide for the Care and Use of Laboratory Animals. Male C57BL/6J mice (n=120; weight, 23.5–27.5 g; age, 8 weeks) were purchased from the Institute of Laboratory Animal Science, CAMS & PUMC (Beijing, China). The animals were housed at a controlled temperature and humidity under a 12-h light-dark cycle with free access to food and water at the Cardiovascular Research Institute of Wuhan University (Wuhan, China). The animals were allowed to acclimatize to the laboratory environment for at least one week, and were then randomly assigned to the control [phosphate-buffered saline (PBS)-treated] and CRA-treated groups (10 and 20 mg/kg; purity, >98%; Baoji Herbest Bio-Tech Co., Ltd.) (19,20). After 14 days of pre-treatment, the mice were subjected to either sham surgery (sham group) or MI by left anterior descending coronary artery ligation. A total of four groups (n=30) were formed, including: Sham group (PBS-treated), MI group (PBS-treated), MI+CRA 10 group (treated with 10 mg/kg CRA), and MI+CRA 20 group (treated with 20 mg/kg CRA). Following surgery, all animals were treated with PBS or CRA for 4 weeks. In the sham, MI, MI+CRA 10 and MI+CRA 20 groups, the number of surviving mice were 30, 15, 22 and 24, respectively at 4 weeks after surgery.

Induction of MI

Briefly, the mice were intraperitoneally anaesthetised with sodium pentobarbital (60 mg/kg), intubated and ventilated with a ventilator. Following a left thoracotomy, the heart was rapidly exposed, and the left anterior descending branch of the coronary artery was quickly identified approximately 2–3 mm away from the inferior margin of the left auricle and ligated with a 7-0 silk suture. In sham-operated mice, the left coronary artery was encircled without ligation. Subsequent to the surgery, all animals were treated with PBS or CRA for 4 weeks.

Echocardiography and haemodynamic analysis

At 4 weeks after surgery, the mice were anaesthetised by inhalation of 1.5–2% isoflurane. Echocardiography was performed to evaluate the function of the left ventricle using a MyLab 30CV system (Biosound Esaote, Inc.) equipped with a 15-MHz probe. M-mode tracings derived from the short axis of the left ventricle at the level of the papillary muscles were recorded. For haemodynamic analysis, insertion of a 1.4-French catheter-tip micromanometer catheter (Millar Instruments) into the left ventricle via the right carotid artery was performed. The heart rates, pressure and volume signals were continuously recorded using an Aria pressure-volume conductance system (Millar Instruments) coupled with a PowerLab/4SP A/D converter. According to the guidelines of the Chinese Animal Welfare Committee, subsequent to pressure-volume measurement, the mice were anaesthetised with 1.5% pentobarbital sodium (60 mg/kg) and then sacrificed by cervical dislocation under anaesthesia.

Injury regions

According to a previous study (21), the heart was described as infarct zone (left ventricle free wall), border zone (left ventricle anterior and posterior walls) and distal zone (interventricular septum). Western blotting and reverse transcription-quantitative PCR (RT-qPCR) were studied using border zone tissue.

Histology

The hearts were removed from the mice, arrested in diastole with 10% KCl, weighed and fixed with 4% formaldehyde, followed by embedding in paraffin. The mouse hearts were cut transversely close to the apex to visualize the left and right ventricles. Tissue sections (4–5 μm) were stained with haematoxylin and eosin (H&E) to assess the infarct size, or stained with picrosirius red (PSR) and Masson’s trichrome to assess the collagen accumulation as an indication of fibrosis. The ratio of interstitial fibrosis to the total left ventricular area was calculated based on the examination of 10 microscopic fields that were randomly selected in three individual sections per heart, and the images were further analysed by Image Pro Plus software (version 6.0; Media Cybernetics, Inc.).

After dewaxing and sequentially deparaffinised, tissue sections were stained with haematoxylin for 5 min at room temperature and then moved into differentiation fluid (1% hydrochloric acid alcohol) for 3 sec. After washing with flowing water for 15 min, sections were placed in eosin liquid for 2 min, and then washed with water for 1 min. Finally, sections were washed in graded alcohol (75, 90 and 100%) and dehydrated with xylene 3 times for 5 min each time at room temperature, and covered by the coverslips. For PSR straining, previous steps up to stained into haematoxylin were the same as H&E staining, and the slides were then immersed in 2% phosphomolybdic acid for 2 min, before covering sections in picro-sirius red solution and incubating for 90 min at room temperature. Finally, sections were washed with acetic acid solution for 2 sec, dehydrated, cleared and covered by the coverslips. For the Masson’s trichrome staining, after dewaxing, the paraffin sections were transferred from the PBS directly in iron hematoxylin for 8 min at room temperature, rinsed for 1–3 sec in 1% hydrochloric acid alcohol, followed by washing with running tap water for 5 min. Following incubation with 1% Acid Ponceau Fuchsin for 20 min, slides were rinsed in distilled water 5 times. Sections were then placed in 1% Phosphormolybdenic acid for 4 min, and then 2% Anilinblue for 5 min, distilled water for 5 min and then 0.2% Acetic Acid for 2 min. Finally, sections were washed with acetic acid solution, dehydrated, cleared and covered by the coverslips.

Immunohistochemistry

Paraffin-embedded heart sections were sequentially deparaffinised and blocked with 10% normal goat serum in Tris-buffered saline with 1% bovine serum albumin at 37°C for 2 h. The sections were incubated overnight at 4°C with primary antibodies against Nox4 (1:200; Abcam; ab154244), HO-1 (1:200; Abcam; ab13243) and CD68+ (1:200; Abcam; ab125212), followed by incubation with EnVision™+/HRP reagent at 37°C for 1 h, and staining with a DAB detection kit (GK600710; Gene Tech). Images of stained cells were captured with a light optical microscope at ×400 magnification.

Western blot analysis

The ventricular tissues were homogenised by a lapping machine and lysed in RIPA lysis buffer. The protein lysates were collected, and the protein concentration was measured with a BCA kit (Synergy HT; BioTek Instruments, Inc.). Next, protein lysates were separated by SDS-PAGE (10% gel) and transferred onto Immobilon-PL transfer membranes (Millipore). The membranes were blocked with 5% skim milk and then incubated overnight at 4°C with the following primary antibodies: Nox2 (1:1,000; ab129068), Nox4 (1:1,000; ab154244), HO-1 (1:1,000; ab13243), Nrf2 (1:1,000; ab31163), TGFβ1 (1:1,000; ab64715), monocyte chemotactic protein 1 (1:1,000; Mcp-1; ab151538), C-C chemokine receptor type 2 (1:1,000; CCR2; ab203128), P-inhibitor of NF-κB kinase β (1:1,000; P-Ikkβ; ab59195) and T-Ikkβ (1:1,000; ab178870), which were purchased from Abcam; P-AMPKα (1:1,000; 2535), T-AMPKα (1:1,000; 2603P), B-cell lymphoma 2 (1:1,000; Bcl2; 2870), Bcl2-associated X protein (1:1,000; Bax; 2772), T-p65 (1:1,000; 8242), P-Smad2 (1:1,000; 3108S), T-Smad2 (1:1,000; 3103s), P-Smad3 (1:1,000; 8769), T-Smad3 (1:1,000; 9513s) and GAPDH (1:1,000; 2118), which were obtained from Cell Signaling Technology, Inc.; and P-p65 (1:1,000; s276; cat. no. BS4135), obtained from Bioworld Technology, Inc. The samples were subsequently incubated with the goat anti-mouse IgG (P/N 925-32210; 1:1,250; LI-COR Biosciences) and goat anti-rabbit IgG (P/N 925-32211; 1:1,250; LI-COR Biosciences) for 1 h at room temperature. (Thermo Fisher Scientific, Inc.). Next, the membranes were incubated with enhanced chemiluminescence reagent (HP193406; Wuhan Servicebio Technology). Finally, the blots were scanned using a ChemiDoc Imaging System (cat. no. 733BR2234; Bio-Rad Laboratories, Inc.) and analysed using ImageJ software (NIH).

RT-qPCR

The relative mRNA expression levels of atrial natriuretic peptide (ANP), B-type natriuretic peptide (BNP), α-myosin heavy chain (α-MHC), β-MHC, connective tissue growth factor (CTGF), Collagen I α1, Collagen III α1, fibronectin, Nox4, Nox2, HO-1, interleukin-1β (IL-1β), tumour necrosis factor α (TNF-α) and IL-6 were determined by RT-qPCR. Briefly, total RNA was isolated from the snap-frozen tissues and cardiomyocytes using an RNA isolation kit (15596-026; Invitrogen; Thermo Fisher Scientific, Inc.). The yield and purity of RNA samples were calculated spectrophotometrically according to the A260/A280 and A230/260 ratios using a SmartSpec Plus spectrophotometer (Bio-Rad Laboratories, Inc.). Next, RNA (2 μg of each sample) was reverse transcribed into cDNA using oligo(dT) primers and the Transcriptor First Strand cDNA Synthesis kit (4897030001; Roche). PCR amplifications were performed using a LightCycler 480 SYBR-Green I Master Mix (04887352001; Roche). All PCR primers are listed in Table SI. The thermal profile consisted of 10 min of pre-incubation step at 95°C for FastStart Taq DNA polymerase activation, followed by 45 cycles of PCR at 95°C for 10 sec (denaturation), 60°C for 20 sec (annealing), and 72°C for 30 sec (elongation). Amplified cDNA products were detected by melting curve analysis which consisted of 95°C for 5 sec and 65°C for 1 min, and heated to 97°C to detect continuous changes in fluorescence of SYBR-Green I. After 45 cycles, the housekeeping gene GAPDH was used to normalize the gene expression (22).

Cell culture

H9C2 cells were cultured in Dulbecco’s modified Eagle medium containing 10% foetal bovine serum (FBS) with streptomycin (100 mg/ml) and penicillin (100 U/ml) under standard conditions at 37°C with 5% CO2. Cells in exponential growth were dissociated with 0.25% trypsin (Gibco; Thermo Fisher Scientific, Inc.) and seeded in 6-well or 24-well culture plates at a density of 1×105 cells/ml prior to incubation for 24 h. Next, different concentrations of CRA were added to the medium 1 h before hypoxia injury. Among the five CRA concentrations tested (0.1, 1, 5, 10 and 20 μM), the H9C2 cells in the 0.1 and 20 μM-treated groups are in poor condition under hypoxia, thus only three CRA concentrations were selected for this analysis, including 1, 5 and 10 μM (data not shown). For the induction of hypoxia injury, the cells were cultured in D-Hank’s solution in an MCO-18M O2/CO2 incubator (Sanyo Electric Co., Ltd.) with 1% O2, 5% CO2 and 94% N2 for 24 h. Oxidative stress was detected by western blotting, PCR and ROS detection, and apoptosis was detected by TUNEL assay.

Transfection experiment

H9c2 cells were transfected with 50 μg AMPK α2 siRNA (GCCCAGATGAACGCTAAGATA) or 50 μg control siRNA; (Guangzhou RiboBio Co. Ltd.) and Lipo6000™ (Beyotime Institute of Biotechnology) according to the manufacturer’s protocol. Briefly, DMEM (Gibco; Thermo Fisher Scientific, Inc.) medium without serum and Lipo6000 were mixed in a PE tube for 5 min, AMPK α2 siRNA (50 μM) and DMEM medium without serum were mixed in another PE tube for 5 min, and the two PE tubes were evenly mixed into another PE tube. After 5 min, they were added to a 6-well plate or a 24-well plate. After 6 h, the medium was replaced and the culture continued for 48 h under standard conditions at 37°C with 5% CO2.

ROS detection

2,7-Dichlorodihydrofluorescein diacetate (DCFH-DA; Invitrogen; Thermo Fisher Scientific, Inc.) was used to detect the ROS levels in H9C2 cells following treatment and hypoxia. Briefly, the cells were cultured in 24-well plates with or without CRA, and then exposed to hypoxia for 24 h. Next, the cells were incubated with DCFH-DA for 30 min at 37°C. The production of ROS by the cells was observed under an Olympus IX53 fluorescence microscope (Olympus Corporation).

TUNEL assay

Apoptotic cells and heart tissue sections were detected by TUNEL straining according to the manufacturer’s instructions (S7111; EMD Millipore Crop). For cells, they were fixed with 4% paraformaldehyde in 4°C overnight, rinsed with PBS and then incubated in 0.1% Triton X-100 for 5 min at room temperature. For tissue sections, after routinely dewaxing and hydration, TUNEL straining was performed according to the protocols provided with each kit. Briefly, equilibration of buffer (EMD Millipore Corp.) was added to cells or tissue sections and incubated for 10 sec at room temperature, the TDT Enzyme (EMD Millipore Corp.) was added to the cells or tissue sections and incubated for 1 h at 37°C in a dark humidified chamber. Stop/Wash buffer (EMD Millipore Corp.) was added and incubated for 10 min at room temperature, rinsed with PBS before Anti-Digoxigenin Fluorescein (EMD Millipore Corp.) was added, and then incubated for 30 min at room temperature in a dark humidified chamber. Finally, stained with 4′, 6-diamidino-2′-phenylindole dihydrochloride (DAPI) (Invitrogen; Thermo Fisher Scientific, Inc.) before washed by PBS. Cells were detected using a fluorescence microscope at ×200 magnification, and the ratio of TUNEL-positive cells to total cells was calculated after at least 20 viewed fields.

Statistical analysis

The data are presented as the mean ± standard error of the mean. Data were analysed with a one-way analysis of variance followed by a post-hoc Tukey’s test using SPSS software (version 22.0; SPSS, Inc.). A value of P<0.05 was considered to denote a statistically significant difference.

Results

CRA improves the survival rates and post-infarction cardiac function of mice

The survival rates of mice in the MI+CRA 10 and MI+CRA 20 groups were significantly higher in comparison with those in the MI group (Fig. 1A). H&E staining revealed that the CRA-treated groups displayed a higher number of cardiomyocytes and reduced infarct size in the border zone at 4 weeks after MI, as shown in Fig. 1B. Echocardiography analysis demonstrated that CRA treatment improved the left ventricular function of mice after MI, as evidenced by increased fractional shortening, ejection fraction, stroke work and cardiac output compared with the untreated MI group (Fig. 1C and D).

Figure 1 Effects of CRA on cardiac dysfunction following MI. (A) Changes in the survival rates of mice following MI (n=30). (B) Haematoxylin and eosin straining results at 4 weeks after MI (magnification, ×200). (C) Echocardiographic analysis of mice at 4 weeks after sham surgery or MI induction, showing the percentages of fractional shortening and ejection fraction (n=10). (D) Hemodynamic analysis of stroke work and cardiac output at 4 weeks after MI (n=10). *P<0.05 vs. sham group; #P<0.05 vs. the MI group. CRA, corosolic acid; MI, myocardial infarction.

CRA attenuates cardiac fibrosis

To explore whether CRA affects cardiac fibrosis following MI, PSR staining (Fig. 2A) and Masson’s trichrome staining (Fig. S1) were performed. It was observed that CRA decreased the interstitial fibrosis caused by MI. Additionally, CRA increased the transcription of α-MHC, and inhibited the transcription of hypertrophic markers (ANP, BNP, and β-MHC) and fibrotic markers (CTGF, Collagen Iα, Collagen IIIα and FN) at 4 weeks after MI, as compared with the untreated MI group (Fig. 2B). These data indicated that CRA treatment alleviated the cardiac remodelling following MI.

Figure 2 Effects of CRA on cardiac fibrosis following MI. (A) Picrosirius red staining of histological sections at 4 weeks after MI (magnification, ×100; n=5). (B) Masson’s’ trichrome staining of histological sections at 4 weeks after MI (magnification: ×100) (n=5). (C) Reverse transcription-quantitative polymerase chain reaction analyses of ANP, BNP, α-SMA, β-MHC, CTGF, Collagen I α1, Collagen III α1 and fibronectin (n=6). *P<0.05 vs. sham group; #P<0.05 vs. MI group. CRA, corosolic acid; MI, myocardial infarction; ANP, atrial natriuretic peptide; BNP, B-type natriuretic peptide; MHC, myosin heavy chain; CTGF, connective tissue growth factor.

CRA reverses MI-induced inactivation of the AMPKα/Nrf2/HO-1 signalling pathway and attenuates oxidative stress

Nox-mediated oxidative stress serves a significant role in the progression of myocardial fibrosis (9,11). In the present study, H9C2 cells were exposed to hypoxia (1% O2) for 24 h with or without CRA treatment. Western blot analysis revealed that Nox2, HO-1 and Nox4 were upregulated in hypoxia-induced cardiomyocytes. However, CRA treatment inhibited the expression levels of Nox2 and Nox4 proteins, while it increased HO-1 expression in the hypoxia-induced cardiomyocytes (Fig. 3A). RT-qPCR data confirmed that CRA pre-treatment led to reduced mRNA expression levels of Nox2 and Nox4, and higher mRNA expression levels of HO-1 (Fig. 3B). Furthermore, as shown in Fig. 3C, immunohistochemical analysis indicated that CRA treatment evidently increased HO-1 and decreased Nox4 expression following MI. Consistently, in vivo studies indicated that CRA decreased the expression levels of Nox2 and Nox4, and increased HO-1 expression in myocardial tissue after 4 weeks of MI (Fig. 3D). In order to identify the underlying mechanism of the effect of CRA, proteins associated with the signalling pathways involved in oxidative stress were also detected in the myocardial tissues. It was observed that MI-induced inactivation of AMPKα/Nrf2/HO-1 signalling was reversed by CRA treatment (Fig. 3D).

Figure 3 Effects of CRA on oxidative stress following MI. (A) Western blot analysis showing the protein levels of Nox2, HO-1, Nox4 and GAPDH in H9C2 cells treated with hypoxia in the presence or absence of CRA (n=5). *P<0.05 vs. Con group; #P<0.05 vs. hypoxia group. (B) Reverse transcription-quantitative polymerase chain reaction analyses of Nox2, Nox4 and HO-1 mRNA levels in the border zone of cardiac tissues obtained from mice subjected to sham surgery or MI, with or without CRA treatment (n=6). (C) HO-1 and Nox4 expression in the border zone was also examined by immunohistochemistry. (D) Western blot analysis indicating the protein levels of HO-1, Nox2, Nox4, AMPKα, Nrf2 and GAPDH in cardiac tissue (n=5). *P<0.05 vs. sham group; #P<0.05 vs. MI group. CRA, corosolic acid; MI, myocardial infarction; Nox, NADPH oxidase; HO-1, haem oxygenase 1; AMPKα, AMP-activated protein kinase α; Nrf2, nuclear factor erythroid 2-related factor 2.

CRA regulates the TGF-β1/Smad signalling pathway and reduces the infiltration of macrophages in vivo

The TGF-β1/Smad signalling pathway is known to serve a crucial role in the pathogenesis of numerous fibrotic diseases, and thus the TGF-β1/Smad cascade activation was tested in the current study. As shown in Fig. 4A, the MI-induced increase in the protein levels of TGF-β1, P-Smad2 and P-Smad3 was attenuated in CRA-treated mice (Fig. 4A). Since macrophage-secreted TGF-β is a major molecule involved in fibrosis after MI, the infiltration of macrophages in the myocardial tissues of each group was then examined. The Mcp-1 and CCR2 expression levels decreased in the MI+CRA 10 and MI+CRA 20 groups, as compared with those in the untreated MI group (Fig. 4B). In addition, immunohistochemical staining for CD68 in the infarct and border zones revealed decreased macrophage infiltration in CRA-treated hearts post-MI as compared with that observed in the MI alone group (Fig. 4C; IgG negative control staining is shown in Fig. S2).

Figure 4 CRA regulates TGF-β1/Smads and macrophage infiltration. (A) Western blot analysis of the protein levels of TGF-β1/Smad signals in cardiac tissue, including TGF-β1, P-Smad2, T-Smad2, P-Smad3, T-Smad3 and GAPDH (n=5). (B) Western blot analysis of the protein levels of Mcp-1, CCR2 and GAPDH in cardiac tissue (n=5). (C) CD68 protein in the infarct and border zones of cardiac tissue was determined by immunohistochemistry (magnification, ×200; n=6). *P<0.05 vs. sham group; #P<0.05 vs. MI group. CRA, corosolic acid; MI, myocardial infarction; TGF-β1, transforming growth factor β1; Mcp-1, monocyte chemotactic protein 1; CCR2, C-C chemokine receptor type 2.

CRA inhibits inflammation and apoptosis in myocardial tissues

The expression levels of several inflammatory markers, including IL-1β, TNF-α and IL-6, in the myocardial tissues were also detected. As indicated by the RT-qPCR results, CRA decreased the mRNA expression levels of IL-1β, TNF-α and IL-6 in the myocardium post-MI (Fig. 5A), and repressed the expression levels of nuclear transcription factor NF-κB p65 and p-Ikkβ (Fig. 5B). TUNEL assay revealed that MI induced apoptosis, as indicated by the large number of TUNEL-positive cells, while CRA reduced the number of apoptotic cells (Fig. 5C). Western blot analysis further demonstrated increased expression of the pro-apoptotic protein Bax and decreased expression of the anti-apoptotic protein Bcl-2 in the MI group, while CRA inhibited these MI-induced changes (Fig. 5D).

Figure 5 CRA regulates inflammation and apoptosis in cardiac tissues. (A) Reverse transcription-quantitative polymerase chain reaction analyses of IL-1β, TNF-α and IL-6 in border zone of cardiac tissue (n=6). (B) Western blot analysis of the protein levels of p-Ikkβ, T-Ikkβ, p-P65 and T-P65 in border zone tissues (n=5). (C) Representative TUNEL staining of border zone tissues (magnification, ×400; n=5). (D) Western blot analysis of the protein levels of Bcl2, Bax and GAPDH in cardiac tissue (n=5). *P<0.05 vs. sham group; #P<0.05 vs. MI group. CRA, corosolic acid; MI, myocardial infarction; IL, interleukin; TNF-α, tumour necrosis factor α; Ikkβ, inhibitor of nuclear factor-κB kinase β; Bcl2, B-cell lymphoma 2; Bax, Bcl2-associated X protein.

Inhibition of AMPKα reverses the protective effect of CRA in H9C2 cells

As detected by the DCFH-DA method, CRA treatment partly blocked the hypoxia-induced ROS upregulation in H9C2 cells; however, the antioxidant capacity of CRA was reversed by AMPKα siRNA (Fig. 6A). In addition, the protective effects of CRA against hypoxia-induced changes were reversed by AMPKα siRNA, as indicated by the results of TUNEL staining (Fig. 6B), and Nox2, P-p65, Nrf2 and HO-1 protein expression levels (Fig. 6C). These results suggested that AMPKα may mediate the protective effects of CRA following MI.

Figure 6 Inhibition of AMPKα reversed the protective effect of CRA against hypoxia in H9C2 cells. (A) ROS production was examined by DCFH-DA staining of H9C2 cells (magnification, ×400; n=5). (B) Representative TUNEL staining in H9C2 cells (magnification, ×200). (C) Western blot analysis of the protein levels of P-p65, T-p65, HO-1, Nrf2, Nox2 and GAPDH in H9C2 cells (n=5). *P<0.05 vs. CON group; #P<0.05 vs. CRA 0 group; $P<0.05 vs. CRA 10 group. AMPKα, AMP-activated protein kinase α; CRA, corosolic acid; ROS, reactive oxygen species; HO-1, haem oxygenase 1; Nox, NADPH oxidase; Nrf2, nuclear factor erythroid 2-related factor 2; CON, control; siAMPKα, AMPKα siRNA.

Discussion

Fibrosis is the major cause of the deterioration of cardiac function in patients who survive acute MI. Targeting cardiac fibrosis may significantly delay the progression of heart failure and improve the quality of life of patients. In the present study, the following results were observed: i) CRA inhibited cardiac fibrosis and improved left ventricular dysfunction following MI; ii) CRA reduced the production of ROS, which was associated with regulating the activity of the AMPKα/Nrf2/HO-1 signalling pathway and Noxs, particularly Nox2 and Nox4; iii) CRA inhibited inflammation and apoptosis caused by MI; and iv) AMPKα inhibition reversed the protective effect of CRA. Collectively, these findings suggest that CRA attenuates MI-induced cardiac fibrosis and dysfunction through modulation of inflammation and oxidative stress associated with AMPKα.

The abnormal deposition of extracellular matrix between non-ischaemic myocardial cells is the main mechanism of fibrosis following MI and is associated with increased mortality (23). It was confirmed that ROS are involved in the synthesis and degradation of collagen (24,25), indicating that oxidative stress serves an important role in synthesis of collagen. It has been reported that Nox2 deficiency attenuates fibrosis and improves left ventricular dysfunction following MI, while inhibition of Nox2 can reduce oxidative stress and apoptosis in hypoxia-induced cells (26). Nox4 is a major source of superoxide (27), and mediates mitochondrial dysfunction and fibronectin synthesis (28). HO-1 is a rate-limiting enzyme in haem degradation and displays a strong protective effect on oxidative damage induced by ROS. The increased expression of HO-1 and the production of bilirubin may regulate the production of endogenous ROS in cells (29). Previous data have also indicated that HO-1 improves mitochondrial damage induced by hypoxia and inhibits the production of Noxs (30). In addition, AMPKα, which is closely associated with cell survival during myocardial ischaemia (31), stimulates Nrf2 and its downstream antioxidant enzyme HO-1 to resist oxidative stress (12). CRA may attenuate cardiac fibrosis by regulating the AMPKα/Nrf2/HO-1/Nox signalling pathway.

In addition to oxidative stress, it has been demonstrated that macrophages are also involved in the process of cardiac fibrosis during MI (32). During the later inflammatory phase of infarct healing, the activity of macrophages is an important cause of fibrosis, while these cells are also an important source of TGF-β following MI (33). In the current study, a decrease in macrophage infiltration was observed in the CRA-treated group, while western blot analysis revealed the downregulation of CCR2 and Mcp-1 following CRA treatment, indicating that CRA attenuated macrophage infiltration through the Mcp-1/CCR2 axis. Previous studies have reported that ROS are associated with the activation of macrophages by participating in the activation of the Mcp-1/CCR2 signalling pathway (34–36). In addition, the current study observed that a high dose of CRA was less effective in blocking Mcp-1 expression, which does not appear to be consistent with the immunohistochemistry results. In fact, there are numerous factors affecting macrophage infiltration in addition to Mcp-1, which may account for the discrepancy in the results. Although the blocking effect of high-dose CRA on Mcp-1 was poor, a downward trend was observed. Compared with western blot assay results, the findings of immunohistochemistry may reflect the infiltration of macrophages more intuitively and have more credibility. Therefore, it can be deduced that, although high dose of CRA is less effective in blocking Mcp-1 expression, it still has a strong inhibitory effect on macrophages. Furthermore, previous studies have demonstrated that the anti-inflammatory effect of AMPKα/Nrf2/HO-1 is due to the anti-peroxidation effect and reduced ROS (20,37). Thus, it was hypothesise that the anti-inflammatory ability of CRA may be due to decreased ROS, although further research is needed to verify this hypothesis.

Increased expression of inflammatory cytokines is also an important factor causing apoptosis (38). Apoptosis caused by myocardial ischaemia is one of the reasons for fibrosis and affected cardiac function following MI. Bax and Bcl2 are important regulatory molecules of apoptosis that belong to the Bcl2 family. Bax is located in the cytoplasm and moves to the mitochondria under the stimulation of apoptosis signals, damaging the permeability of the mitochondrial membrane and promoting apoptosis. Furthermore, Bax inhibits the activity of the anti-apoptotic protein Bcl2. In heart failure, the expression of the pro-apoptotic protein Bax in patients is increased (39), while the activity of Bcl2 is decreased; therefore, enhancing the expression of Bcl2 can effectively reduce the occurrence of apoptosis. In the present study, CRA decreased the expression levels of pro-apoptotic protein Bax and increased the activity of anti-apoptotic protein Bcl2 both in vivo and in vitro, confirming the function of CRA in inhibiting apoptosis of cardiomyocytes.

A previous study revealed that, after 4 weeks of MI, abnormal remodelling occurred in the infarction border zone, accompanied by oxidative stress, inflammation and apoptosis, suggesting that anti-oxidation, anti-apoptotic and anti-inflammatory therapy is an important measure to reduce abnormal remodelling of the border zone (1). The current study attempted to investigate the effect of CRA on ventricular remodelling and heart failure following infarction, and thus the time point of 4 weeks after infarction was selected for investigation. Studies have confirmed that men and women have different risk of cardiovascular disease, which may be associated with metabolism and inflammation (40). To eliminate gender interference in the results, mice of the same sex were selected. However, certain limitations exist in the present study. Firstly, CRA was administered 2 weeks before MI. A previous review on CRA safety reported that using a gel product containing 10 mg CRA can improve the symptoms of patients without causing any adverse effects (41). The current study explored whether CRA can be used as an adjunct drug to improve heart failure in patients with MI or high-risk groups; therefore, prophylactic administration of CRA was provided to the mice. Future studies should verify the effects of CRA on MI when it is only administered to animals following the induction of MI. In addition, the distribution of CRA in the blood following intragastric administration and the proper dosage should be determined in further studies. Finally, whether CRA influences other cell types and signalling pathways in the process of MI requires further investigation.

In conclusion, the data of the present study revealed that CRA attenuated MI-induced cardiac fibrosis and dysfunction through modulation of inflammation, apoptosis and oxidative stress associated with AMPKα. It is, thus, proposed that CRA may be a suitable adjuvant therapy for the treatment of MI and heart failure in clinical practice.

Supplementary Information

Acknowledgements

The authors would like to thank Professor Tang Qizhu, Renmin Hospital of Wuhan University, for the help and support provided.

Funding

This research was supported by the National Natural Science Foundation of China (grant nos. 81530012 and 81700218), National Key R&D Programme of China (grant no. 2018YFC1311300) and the National Natural Science Foundation of Hubei Province (grant no. 2017CFB320).

Availability of data and materials

The datasets used during the current study are available from the corresponding author upon reasonable request.

Authors’ contributions

ZPW and YY designed this study. HZ and YYM performed the data collection. QQW performed the data analysis. YC and YGJ performed the animal experiments. YY and HMW supervised the project and controlled the administration. SSW and HMW performed cell culture; YC wrote the original draft of the manuscript. ZPW and YY reviewed the article. All authors read and approved the final manuscript.

Ethics approval and consent to participate

All animal experimental protocols were approved by the Animal Care and Use Committee of Renmin Hospital of Wuhan University and were conducted in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References